MET25 and MET16 promoters are maintained in a nucleosome-free state and that this .... site, creating pYGCPF1. ... pSP73 (Promega) to create pSPMET25.
Vol. 14, No. 8
MOLECULAR AND CELLULAR BIOLOGY, Aug. 1994, p. 5229-5241 0270-7306/94/$04.00+0 Copyright © 1994, American Society for Microbiology
Chromatin Structure Modulation in Saccharomyces cerevisiae by Centromere and Promoter Factor 1 NICHOLAS A. KENT, JIMMY S. H. TSANG, DANIEL J. CROWTHER, AND JANE MELLOR* Microbiology Unit, Department of Biochemistry, University of Oxford, Oxford OX1 3QU, United Kingdom Received 2 February 1994/Returned for modification 16 March 1994/Accepted 12 May 1994
CPF1 is an abundant basic-helix-loop-helix-ZIP protein that binds to the CDEI motif in Saccharomyces cerevisiae centromeres and in the promoters of numerous genes, including those encoding enzymes of the methionine biosynthetic pathway. Strains lacking CPF1 are methionine auxotrophs, and it has been proposed that CPF1 might positively influence transcription at the MET25 and MET16 genes by modulating promoter chromatin structure. We test this hypothesis and show that the regions surrounding the CDEI motifs in the MET25 and MET16 promoters are maintained in a nucleosome-free state and that this requires the entire CPF1 protein. However, the chromatin structure around the CDEI motifs does not change on derepression of transcription and does not correlate with the methionine phenotype of the cell. An intact CDEI motif but not CPF1 is required for transcriptional activation from a region of the MET25 upstream activation sequence. Our results suggest that CPF1 functions to modulate chromatin structure around the CDEI motif but that these changes at the MET25 and MET16 promoters do not explain how CPF1 functions to maintain methionineindependent growth. The presence of CPF1-dependent chromatin structures at these promoters leads to a weak repression of transcription.
unable to activate expression from a LexA binding site fused to a reporter gene (48). Therefore, it has been suggested that CPF1 might function to modulate chromatin structure in MET gene promoters, allowing other factors access to the DNA (32, 39, 48). Support for this theory comes from the demonstration of chromatin structure changes at the TRP1 promoter in cpfl strains (34). Thomas et al. have proposed a model in which CPF1 is required, together with the bZIP protein MET4, for transcriptional activation via elements found in the promoter of the MET25 gene (48). Masison et al. tested a number of mutated CPF1 proteins for their ability to maintain methionine-independent growth and optimal centromere function (32). They reported a direct and quantitative correlation between chromosome loss and the methionine phenotype of strains carrying loss-of-function mutations and suggested that CPF1 performs the same general chromatin-related function at both centromeres and MET gene promoters. These conclusions are in line with the proposal of Thomas et al. (48). However, three recent reports suggest a more complicated picture (20, 33, 35). One report contradicts the results of Thomas et al. concerning the reduction in MET25 mRNA levels in strains lacking CPF1 (48). No significant decrease in MET25 mRNA levels was observed under repressed or derepressed growth conditions; under some conditions the levels of MET25 mRNA appeared to increase slightly in strains lacking CPF1 (35). A second report demonstrates that secondary mutations in the SPT21, SIN3, CCR4, and RPD3 genes suppress cpfl methionine auxotrophy (33). However, in spt2l cpfl and sin3 cpfl strains, the centromere function remains defective, suggesting that the same mechanism is unlikely to be responsible for both methionine-independent growth and optimal centromere function (33). Finally, in mutagenesis experiments, it was found that the centromere function of CPF1 was not always correlated with the ability of the protein to maintain methionine prototrophy (20, 33, 35). For instance, a strain expressing normal levels of a version of CPF1 carrying a glutamic acid-to-alanine change at position 231 is a methionine prototroph but shows a rate of centromere loss similar to that of a cpfl null strain (35). No CPF1-CDEI DNA binding activity
Centromere and promoter factor 1 (CPF1), also known as CP1 and CBF1, is a protein from Saccharomyces cerevisiae originally identified as the factor bound to the centromere DNA motif centromere determining element I (CDEI) (2, 5, 6, 23, 34). It belongs to the class of proteins, found in both lower and higher eukaryotes, that contain the basic-helix-loop-helix (b/HLH) and heptad leucine repeat (ZIP or Z) domains involved in DNA binding and protein dimerization (14, 15). Members of this b/HLH/Z class have been implicated in transcriptional regulation and include N-myc, C-myc, and L-myc, max, USF, TFE3, and AP4 (3, 4, 12, 22, 25). Disruption of the CPF1 gene and mutation of the CDEI motif (consensus, RTCACRTG) at yeast centromeres, to which the protein binds in vitro and in vivo, show that CPF1 is required for optimal centromere function during mitosis and meiosis (10, 31, 38; reviewed in reference 23). Disruption of the CPF1 gene also renders the cells auxotrophic for methionine (2, 6, 34). Interestingly, the CDEI motif is found at many other sites in the yeast genome, including gene regulatory sequences. The motif occurs in a diverse range of promoters including TRPJ, GAL2, and the promoters of several coregulated genes of the methionine biosynthetic pathway, including ME725, MET16, MET2, MET14, MET8, MET3, and SAM2 (5, 8, 29, 30, 46, 47). It has been suggested that CPF1 associates with these sites and plays a role in transcriptional activation (2, 5, 6, 34). Attempts to elucidate the mechanism of action of CPF1 at gene regulatory regions have produced contradictory results. Thomas et al. have shown that sulfate uptake is defective in strains lacking CPF1, that under certain growth conditions MET25 mRNA levels are reduced by one-third, and that MET16 mRNA levels are undetectable in cpfl strains. They suggest that this is an explanation for the methionine auxotrophy of cpfl strains (48). CPF1 does not, however, appear to be a transcriptional activator on its own. A CPF1-LexA fusion is * Corresponding author. Mailing address: Microbiology Unit, Department of Biochemistry, University of Oxford, South Parks Rd., Oxford OX1 3QU, United Kingdom. Phone: (0865) 275306. Fax: (0865) 275259.
5229
5230
KENT ET AL.
can be detected in this strain. Strains with leucine 245 changed to threonine show the opposite phenotypes of methionine auxotrophy, a marginal reduction in centromere function, and
greater than 50% of normal DNA binding activity (33). On the basis of these data, an alternative view of CPF1 function is possible. In this model there is a good correlation between the amount of CDEI binding activity present in nuclei and the degree of centromere function observed but no correlation with the ability of the protein to maintain methionine-independent growth. Thus, direct DNA binding of CPF1 may not be required for maintenance of methionine-independent
growth (35). The present study was undertaken to attempt to resolve the discrepancies surrounding the biological function of CPF1. In order to test the prevailing view that CPF1 functions as a positively acting chromatin modulator, we examined the chromatin structure at, and transcription from, the promoters of the MET25 and MET16 genes. We show in this report that DNA-bound CPF1 functions to maintain the region of DNA surrounding its binding motif in a nucleosome-free state. We then define, by examining the chromatin in a number of CPF1 mutant yeast strains, the regions of the protein necessary to produce this effect. We show that the chromatin structure at the MET25 and MET16 gene promoters does not correlate with the methionine phenotype of the strains and does not change on derepression of transcription. The changes in chromatin structure described here are also independent of the SPT21 and SIN3 genes, which, when mutated, can suppress cpfl-related methionine auxotrophy (33). Using a reporter gene, we show that the intact CDEI motif from the MET25 promoter activates transcription independently of CPF1. This suggests that a different factor interacts at the CDEI in the MET25 upstream activation sequence (UAS) to activate transcription, and the role of CPF1 in methionine-independent growth remains elusive. The work presented here suggests that the centromere, promoter, and transcription factor interactions of CPF1 represent separable functions which are mediated via specific domains of the protein. We show that the role of CPF1 in the promoters of two methionine biosynthetic genes is to modulate chromatin structure, which results in weak repression of transcription under basal and derepressed growth conditions.
MATERUILS AND METHODS S. cerevisiae strains. The wild-type CPF1 strain used was DBY745 (a leu2-3 leu2-112 ura3-52 adel-100). Strains in the YAG series (except where noted) are isogenic to DBY745 and contain various modifications to the CPF1 locus. Cy57 (cx ura3-52 leu2AJ lys2-801 ade2-101 his3A200 swi2A::HIS3) was a gift from C. Peterson (41). GNX193-2B (ot ura3-52 leu2Al lys2-801 trpl Al his3A200 spt2l::HIS3) was a gift from J. Boeke (37). YAG235 is isogenic to GNX193-2B except that it contains a URA3 insertion at the CPFI locus. M613 (cx ura3-52 leu2Al trplAl his3A200 rpdl::TRPl) was obtained from R. Gaber (50). YAG233 is isogenic to M613 except that it contains a URA3 insertion at the CPF1 locus. YAG94 is a diploid derived from Y699/700 (a gift from S. Kearsey; a/ax ade2-1/ade2-1 trplAlItrplAl canl-100/canl-100 leu2-3-112/ leu2-3-112 his3-11-15/his3-11-15 ura3-52/ura3-52 cpfl::URA3/
cpfl::LEU2). Construction of CPF1 mutant strains. The large deletions in the CPF1 gene were made exactly as described previously (14, 15). Deletion 301 was created by digesting pSP73-22 (35) with AatII and purifying and religating the 2,327- and 1,580-bp bands such that there was a deletion between the AatII sites at
MOL. CELL. BIOL.
nucleotides +481 and + 715. Deletion 302 was made by joining a 14-bp BglII linker (CAAAAGATCTTITG) at the MscI site of CPFI to a C-terminally exonuclease III-digested DNA (endpoint, bp 777, one base after amino acid [aa] 174) to which a 14-bp BglII linker was ligated. The junctions were as follows: for deletion 301, TQSQYESGLT(aa 76)/(aa 155)SSPME STQQS; and for deletion 302, NDMLIPLAE(aa 174)PKDRS E(aa 214)ATTDEWKKQR. New amino acids encoded by the linker are underlined. The deleted versions of CPF1 were analyzed after being integrated into the CPFI locus (35). For regulated expression of CPF1 under the control of the GAL] promoter, the CPF1 gene fragment (a BamHI fragment isolated from pSP73-22 in which the XhoI site had been modified with a BamHI linker [34]) was inserted into plasmid pYG (CEN4 UR43 ARSI) containing a unique BamHI expression site, creating pYGCPF1. Probe DNA. The MET25 end label was derived from pM2517, a gift from Y. Surdin-Kerjan (47). The MET25 5' region probes were derived from pSPMET25. DNA amplified from yeast strain DBY745 by PCR was ligated into the SmaI site of pSP73 (Promega) to create pSPMET25. The MET25 DNA was amplified from nucleotides -672 to +6 by using primers ATGGATCCTTGCGTT'TCAGCT'T1CC and AAGGATCCG GTCATIGTATGGATGGGGG on the basis of the published sequence of MET25 DNA (29). The MET16 end label was derived from pSPMET16. On the basis of the published nucleotide sequence of the MET16 gene, two PCR primers, TGGATAAAAGAGAATGGTGGG and ATCGTACTCTA TCTATCTAGG, were designed to amplify MET16 from nucleotides -332 to +801 (46). DNA amplified from yeast strain DBY745 was ligated into the SmaI site of pSP73 (Promega) to create pSPMET16. The TRPI probe was derived from YRp7 (49). The HIS3 probe was derived from plasmid pSPHIS3, which was created by ligating the 1.85-kb BamHI fragment containing the HIS3 gene from pMA700, a gift from A. J. Kingsman, into pSP73 (44). Chromatin digestion. The method used involves digesting chromatin in Nonidet P-40-permeabilized yeast spheroplasts. The protocol was adapted from the approach used by Stewart et al. (43) to digest chromatin in cultured rat hepatoma cells and is described in reference 27. Yeast cells were grown to a density of 1.0 x 107 cells per ml in YPD (1% yeast extract, 1% peptone, 2% D-glucose) or 5.0 x 106 to 7.0 x 106 cells per ml in synthetic medium at 30°C. Spheroplasts for indirect end-label studies were digested in the presence of 150 U of micrococcal nuclease (MNase; Pharmacia) per ml for 3 to 5 min at 37°C. DNA to be analyzed by indirect end labelling was digested to completion with the relevant restriction endonuclease, and fragments were separated on agarose gels. DNA was blotted to Hybond-N (Amersham) membranes and hybridized with radiolabelled probes in a solution containing 1.5 x SSC (lx SSC is 0.15 M NaCl plus 0.015 M sodium citrate), 5x Denhardt's reagent, and 0.1% sodium dodecyl sulfate (SDS) for 16 h at 64°C. All blots were washed to high stringency, i.e., in 0.1 x SSC-0.1% SDS at 65°C, before autoradiography. For mapping of probe regions in nucleosome ladders, the spheroplasts were digested with 800 U of MNase per ml. Purified DNA was blotted and probed as described above. Gel mobility shift assay and immunoblotting. The mobility shift assay was carried out by using 10 ,ug of total yeast protein and a radiolabelled double-stranded CDEI oligonucleotide as described previously (15). The same extracts (20 ,ug) were separated by using a 7.5% gel (30:0.8 acrylamide/bisacrylamide ratio) and blotted onto Immobilon-P (Millipore). Immunoglobulin G raised against a glutathione S-transferase (GST)-
VOL. 14, 1994
CPF1 fusion protein was used at a concentration of 1 ,ug/ml and detected with the Amersham ECL kit. RNase protection mapping. Mapping was carried out as described previously (33) except that 5 ,ug of total RNA prepared from yeast strains grown to an optical density at 600 nm of approximately 0.5 to 1.0 in either 0.2 mM DL-homocysteine, 1 mM L-methionine, or 0.01 mM L-methionine was used. The MET16 template for the production of antisense probe was an MscI-EcoRI (nucleotides +412 to +736) fragment (obtained by PCR and sequenced before use) directionally cloned into PvuII-EcoRI-cut pSP73 (Promega). The MET25 template was an XbaI-EcoRI (+ 146 to +415) fragment cloned into pSP73. The actin template was the BglII-BglII (+778 to +1090) fragment cloned into the BamHI site of pSP73. The template was linearized with RsaI. Antisense probes were produced by using SP6 polymerase or T7 polymerase (actin) and 200 L,Ci of [ 2P]CTP (no cold CTP) and used in >10X excess. The protected products were separated by using a 4% polyacrylamide-8 M urea gel and dried, and the radioactivity was quantified by using a Molecular Dynamics Phosphorlmager as described previously (33). P-Galactosidase assay for CDEI-dependent transcriptional activation. Plasmid pGV256 was a gift from C. Goding and contained a UAS-less CYCl promoter driving lacZ expression on a pBR322 backbone containing the URA3 selectable marker and the 2,um origin. Oligonucleotides corresponding to -311 to -294 of the MET25 promoter with UAS activity (5' TGGCAAATGGCACGTGAAG 3' and 5' TGGCAAATG GCACGTTAAG 3' with GATC overhangs) were inserted into a BglII site engineered at the XhoI site of the CYCI promoter and sequenced to check for orientation and integrity. The plasmids were cut with HindlIl, religated to remove 2,um sequences, and then linearized at the StuI site in the URA3 gene prior to integration at the URA3 locus. P-Galactosidase was assayed as described by Miller (36). RESULTS Chromatin structure in CPF1 and cpfl yeast cells. Chromatin analysis was performed by using spheroplasts prepared from yeast strains DBY745 (CPFI) and YAG93 (an isogenic cpfl null strain). Chromatin was digested with MNase in the presence of 0.075% Nonidet P-40 to permeabilize the cells. This technique produces results identical to those of traditional methods but obviates the need to prepare nuclei and is therefore rapid and easy to perform (27). MNase-digested DNA was analyzed by indirect end labelling using probes specific for the MET25, MET16, TRPI, and HIS3 genes (Fig. 1). The MET25 promoter, which has two CDEI motifs within its UAS, and the MET16 and TRP1 promoters, which each have one, all show altered MNase cleavage patterns in cpfl yeast cells (Fig. 1A through C). The regions of changed nuclease accessibility map to the area surrounding the CDEI motifs. The cleavage patterns obtained for the TRP1 promoter with this technique are identical to those obtained by using isolated nuclei (26, 27, 34). The HIS3 promoter, which does not contain any CDEI-related motif, shows no change in MNase accessibility in cpfl yeast cells (Fig. 1D). It should be noted that some cleavage sites close to the probe regions in MET25 and MET16 show band intensities on blots prepared from CPF1 yeast cells that are different from those shown on blots prepared from cpfl yeast cells. This variation is not CPF1 dependent, and the band intensities vary from experiment to experiment and with the concentration of MNase used. This variation in band intensities has been noted by others (40). The nuclease acces-
CPF1 AND CHROMATIN STRUCTURE
5231
sibility changes indicated in Fig. 1 are stable for nuclease concentrations of 30 to 300 U/ml and have been repeated in at least five separate batches of spheroplasts (data not shown). Chromatin structure changes are dependent on CPF1. Expression of the MET25 and MET16 genes is regulated by the concentration of S-adenosylmethionine in the cell, which is reflected by the concentration of methionine in the medium. We grew CPF1 and cpfl yeast cells in synthetic complete medium containing concentrations of L-methionine that either repress (1 mM) or derepress (0 or 0.01 mM) MET25 transcription and examined the chromatin structure (Fig. 1). Figure 1A shows that the nuclease accessibility of the MET25 promoter has the same cleavage pattern in CPF1 strains regardless of whether the yeast cells are grown under repressing (lanes 3 and 5) or derepressing (lane 6) conditions, suggesting that there is no CPF1-dependent chromatin transition during derepression of this promoter. Similarly, although the cleavage pattern in cpfl strains is different from that seen in CPFJ strains (compare lanes 5 and 6 with lanes 7 and 8), no difference is seen after a change from repressing (1 mM methionine) to derepressing (0.01 mM methionine) conditions (compare lanes 7 and 8). This suggests that the changes in nuclease accessibility observed at the MET25 promoter depend only on the CPFI genotype of the cell and do not change on activation of transcription from basal levels to derepressed levels. In order to confirm that transcription was derepressed at the time the cells were harvested and used to measure nuclease accessibility (in lanes 5 to 8 of Fig. 1A), we prepared RNA from the same batch of cells and hybridized it to actin-, MET25-, or MET16specific probes in a quantitative RNase protection assay. Table 1 shows the MET25 and MET16 RNA levels corrected for the actin loading control from these cultures. MET25 mRNA levels were derepressed about 20-fold in both the wild-type and cpfl strains, confirming that derepression of transcription had occurred in the cultures in which the nuclease accessibility was measured. To confirm that this chromatin effect is specific to CPF1, we transformed the cpfl null strain YAG93 with plasmid pYGCPF1 (URA3 CEN4), an expression vector containing the CPF1 gene under the control of the GALI promoter (14). Growth of this strain in media containing galactose (inducing expression of the CPF1 gene) restores wild-type chromatin structure to the MET16 promoter (Fig. 2). Similar results were also seen with the MET25 promoter (data not shown). The nature of the chromatin change. In the CPF1 yeast strain DBY745, the region of DNA associated with the CDEI motif in the TRP1, MET16, and MET25 promoters shows an MNase cleavage pattern similar to that of naked DNA (Fig. 1A through C). In the cpfl strain YAG93, MNase accessibility is altered in this region. In the MET25 promoter, two cleavage sites at nucleotides -200 and -250 are lost in cpfl yeast cells and two new sites appear at nucleotides -290 and -330 in the region of the two CDEI motifs (Fig. 1A; compare lanes 3 and 4). In the MET16 gene two sites at nucleotides -140 (near the CDEI motif at -175) and +30 are protected in cpfl yeast cells (Fig. 1B; compare lanes 3 and 4). The TRPI chromatin shows a similar change in nuclease accessibility to the MET25 promoter, with a site just 3' to the CDEI motif at nucleotide -25 being protected in cpfl yeast cells and a site at nucleotide -50 becoming more accessible (Fig. 1C). It would therefore appear that in MET25 and TRP1 the area just 3' of the CDEI motif(s) becomes protected from MNase cleavage in cpfl yeast cells. This is consistent with the presence of a single nucleosome in this region in cpfl cells. In the MET16 gene, the region protected is larger, with the CDEI motif and an area about 120 bp 3' of the CDEI motif becoming protected in cpfl yeast cells.
5232
MOL. CELL. BIOL.
KENT ET AL.
A
B
0) 1
z 140 0)
(.2Kb)
(-4Kb)
r--4
Q,
M.
ECo RI U)
't iZ
1z
Eco RI
>,
CL.
ZZN
c:)
6
z
"adr-
72Z(0 C
U:
.
LI CDEI
(-1 0)
Ec RV(.389)
TATA 1
CDEI U
CDEI U Nar I -
(236)
I
0% n
}
TATA (
:J cm
(+412) 5.
Xha I
-
j I(+146)
VC 17
*1
g-a
iEo RIl(+736
70
1
IS
c2 O
4
3
5
6
7
8
1
(+415)
3
4
MET16
MET25
Eco RI-
2
D
C
Kpnl Ilindlll
n
(-Kb)
\U4
(-3Kb)
z 1\.-
U4
EcoRI (-103)
TATA
CDEI
(r+) ftl
Dral
(.67)
N.
-i W
:9
&Ia
t'N (.31 1)
tBtI_
EcoRV (+284)
IlIn5ldIlI (.513)
-(+324)
34
12 TR Pll
iiRPi
Kpnl
1234 IS3
FIG. 1. MNase analysis of gene promoters in yeast strains DBY745 (CPFJ) and YAG93 (cpfl A). Yeast strains were grown in YPD unless otherwise stated. Chromatin was digested with 150 U of MNase per ml and digested to completion with the restriction endonucleases indicated. DNA purified from untreated chromatin was partially digested with MNase and then completely digested with the restriction nucleases to provide the naked DNA cleavage control. The DNA was separated on 1.5% agarose gels and analyzed by indirect end labelling of Southern blots. Schematic maps of each of the genes appear to the left of the blots, with the CPF1 binding motif CDEI denoted by solid boxes and potential TATA
5233
CPF1 AND CHROMATIN STRUCTURE
VOL. 14, 1994 TABLE 1. MET25 and MET16 RNA levels in cells used to probe nuclease accessibility as described in the legend to Fig. 1A mRNA levelb
DBY745 YAG93 YAG214
T-
MET25
MET16
Strain' +c
_d
1.0 1.7 1.9
2.0 3.9 2.8
+
-
3.4 4.1 4.2
75.4 81.3 100.9
+
+
+
cP.,
C~
IM
CL
Media:
a Strains were grown to a cell density of approximately 1 x 107 cells per ml. b RNA was hybridized to MET25-, MET16-, or actin-specific riboprobes and quantified relative to the actin control. RNA levels relative to the level of MET16 RNA in DBY745 are presented. c +, cells were grown in medium containing 1 mM methionine. d -, cells were grown in medium without methionine (DBY745 and YAG214) or medium containing 0.01 mM methionine (YAG93).
The nuclease cleavage pattern at this locus is consistent with the presence of two nucleosomes in this region in cpfl cells. Interpretations of the MNase cleavage patterns at the ME125 and MET16 loci, in terms of nucleosome positioning, are shown in Fig. 3A and B, respectively. In all three genes, flanking chromatin further away from the CDEI motif remains unchanged. In addition to the area associated with the CDEI motif in the MET25 gene, an MNase cleavage site that maps to a position close to the TATA box also appears to cleave differently in cpfl yeast cells (see Fig. 1A). This site shows protection in CPFI cells that appears to be relieved in cpfl cells, and therefore it behaves in a manner opposite to that of the other sites described above. In cpfl cells this region could map to the linker DNA 3' of the nucleosome responsible for the protection of the two sites at nucleotides -200 and -250 (Fig. 3A), thus explaining the increase in the accessibility of the site. To confirm that the CPF1-dependent change in nuclease cleavage that we observed is due to some kind of nucleosomal reorganization, we probed nucleosomal ladders (prepared by extensively digesting chromatin with MNase) with three small restriction fragments corresponding to different regions of the MET25 promoter (Fig. 3C). Probe 1, a 173-bp BamHI-DraI fragment, corresponds to nucleotides -673 to -506 of the MET25 gene. This region is protected from MNase cleavage in indirect end-label experiments (Fig. 1A), which is consistent with the presence of a positioned nucleosome in both CPFI and cpfl yeast cells. This probe hybridizes strongly to the mononucleosomal DNAs from both CPF1 and cpfl yeast cells on the blot in Fig. 3C (lanes 4 and 5), confirming the presence of a nucleosome in both strains. Probe 2 is a 153-bp EcoRVNarl fragment corresponding to nucleotides -389 to -236, the region identified as a UAS and containing the two CDEI motifs (45). This probe hybridizes with the mononucleosomal band in the cpfl yeast strain DNA but not with that from the CPFJ yeast strain (compare lanes 6 and 7). This is in agree-
+ Eco RI (-gKb)
CDEI I (-180)
TATA E
}
a3 0K -~I
a-0It K
(.412)
2 Eco RI
(.7)6)
-
3
4
56
MET16
FIG. 2. Regulated expression of CPF1 from a plasmid can produce wild-type chromatin structure in the cpfl null strain YAG93. MET16 chromatin in DBY745 and YAG93 grown in YPD as described in the legend to Fig. 1 was analyzed. YAG93 was transformed with plasmid pYG or pYGCPF1 and grown in 1% glucose (GLU; pYG expression repressed) or 1% galactose (GAL; pYG expression induced), and chromatin was analyzed as described in the legend to Fig. 1. The CPF1-dependent chromatin change is indicated by the brace.
ment again with the indirect end-label analysis, in which this region, like naked DNA, is accessible to MNase in CPF1 yeast cells but becomes protected in cpfl yeast cells. It therefore appears that the UAS region of the MET25 gene is indeed nucleosome free in CPFI yeast cells but associates with a nucleosome in the absence of CPF1. Probe 3 is a 133-bp NarI-XmnI fragment corresponding to nucleotides -236 to -103 of the MET25 gene and contains the potential TATA box. This probe hybridizes to the mononucleosomal DNAs from both CPFI and cpfl yeast cells (lanes 8 and 9). The interpretation of the cleavage patterns that is shown in Fig. 3A suggests that this probe is probably hybridizing to DNA in the same nucleosome that probe 2 detects in cpfl cells. However, the signal in CPF1 DNA is not as strong as that in cpfl DNA. This may suggest that this region is nucleosomal in a smaller fraction of CPF1 cells than of cpfl cells, implying that the
elements denoted by open boxes. mRNA initiation sites are marked with arrows. CPF1-dependent changes in nuclease cleavage are in braces. (A) MET25 chromatin structure. DNAs were cleaved with EcoRI and probed with the 269-bp EcoRI-XbaI fragment from the MET25 coding region (29). The marker fragments were prepared by digesting aliquots of DBY745 genomic DNA with Narl, EcoRV, and XbaI and then with EcoRI. DNA from DBY745 and YAG93 was prepared from strains grown in YPD (lanes 3 and 4) or in synthetic complete medium in the presence or absence of methionine (Met) as indicated (lanes 5 through 8). A cleavage site that maps to the TATA region is indicated with a dotted line. (B) MET16 chromatin structure. This blot is a reprobe of the left-hand filter from Fig. 1A with the 324-bp EcoRI-MscI fragment of the MET16 coding region (46). Markers are lambda DNA digested with BstEII. (C) TRPI chromatin structure. DNAs were cleaved with HindIII and probed with the 229-bp HindIII-EcoRV fragment of the TRPJ coding region (49). Markers were prepared from DBY745 genomic DNA digested with EcoRI and EcoRV and then with HindIll. (D) HIS3 chromatin structure. DNAs were cleaved with KpnI and probed with the 298-bp KpnI-BglI fragment of the HIS3 coding region (44). Markers were prepared by partial digestion of DBY745 genomic DNA with DraI followed by digestion with KpnI.
5234
KENT ET AL.
MOL. CELL. BIOL.
A
PROBE 2
PROBIE 1
Dm1
EcRV) Xn . Narl -UAS-- I.I I
-900
-800 *
*
*
ID*
-600
-700
4D*
-500 *
400
m 0 -300
_*
-200 00
+1
_0
Cleavage
*
cpflChromatin
Pattern
t
-800
-700
-600
-500
-400
-300
-200
* _0 0* 0*
+1
100
0
S
Mscl
MET16 CODING REGION
fj
-100
*
O S1
200
300
400
INaked DNA MNase *CPFIChronIatn Cleavage
S *
IcpflChrontln
CPF1 Chromatin
I-------I
--I
C
1-4 -z
1-
C_ s-K %z DZ
,
_-LK CJ
t
K
-
Cr4 CX
0
C-
r-c
0 0
z 702bp
4 3
2
224bp
1
1 2
3 Ethidium Stained Gel.
4
6
5
Probe
1
I
1 cpJ Chromatin
Cad
*
1
400
CPFI Chromatin
F
..CDEI TATA
EcoRi I
Naked DNA
CPFI CbronuUn
KIZ&
I
3000
0 @
B -900
200
100
*-
ID
* v
A r
-100
*S@@
*
Xbal I
I.MET25 CODING REGION Ii
TATA
A B
ID
**
PROBE 3
7
Probe 2
8
9
Probe 3
cpfl ChromRatin
Pattern
VOL. 14, 1994
influence of CPF1 can extend to the TATA region in the MET25 gene. Alternatively a nucleosome may be present around this region but may not have such a defined position as the nucleosome detected in the probe 1 region. We conclude from the data presented above that CPF1 can function to maintain DNA associated with the CDEI motif in a nucleosome-free state. Chromatin structure in strains expressing mutant versions of CPF1. We have previously created a number of mutations in the CPF1 gene, producing point, deletion, and domain-swap mutants, to allow us to define the functional regions of the molecule (14, 15, 33, 35). These mutant CPF1 proteins (Fig. 4A) are expressed from the CPF1 locus as gene replacements in yeast strains isogenic to DBY745. We analyzed the chromatin structures of the MET25 and MET16 promoters in several of these yeast strains to identify regions of CPF1 required to modulate chromatin and to test whether the null cpfl chromatin structure correlates with methionine auxotrophy. This might be expected if having promoter DNA of a methionine biosynthetic gene packaged into chromatin causes genes to be refractory to transcriptional activation as predicted by others (32, 39, 48). In particular we were interested in two yeast strains which express CPF1 proteins with single point mutations in highly conserved residues in the basic domain affecting DNA binding. DNA binding, in vitro, of CPF1 in strain YAG216 is impaired, and in YAG214 it is abolished completely (35). We have previously shown that both of these strains are defective in centromere function but are strong methionine prototrophs (35). One explanation for this result would be that these mutated proteins retain sufficient in vivo CDEI binding activity at promoters. If this is the case, we might expect to see CPF1-dependent chromatin modulation in these strains. Figure 4A shows that the chromatin structure at the MET16 loci in strains YAG214 (no DNA binding), YAG216 (impaired DNA binding), YAG300 (N terminus deleted from aa 10 to 214), and YAG341 (CPF1 with USF ZIP domain swap) is identical to that in the cpfl null strain. At the MET25 locus YAG214 and YAG216 again show a chromatin structure identical to that in the cpfl null strain (Fig. 4B, lanes 5 and 6). YAG300 shows an intermediate pattern of cutting, and the pattern of YAG341 is similar to the wild-type pattern. Figure 5A shows a mobility shift assay performed with a radiolabelled CDEI oligonucleotide (from the MET25 UAS and identical to the oligonucleotide used for the data in Tables 3 and 4) and equal amounts of protein extracts from DBY745 and some of the YAG strains. In this assay comparable levels of CPF1CDEI binding were observed in DBY745, YAG300, and YAG341 extracts, whereas no binding was observed in YAG93 and YAG214 extracts. In addition to the retarded complexes produced by CPF1, there are other complexes which are also specific to the CDEI motif (Fig. 5A) (15). This suggests that
CPF1 AND CHROMATIN STRUCTURE
5235
other factors can bind specifically to the CDEI motif in the MET25 UAS. A Western blot (immunoblot) with affinitypurified anti-CPF1 antibodies and the extracts used in the mobility shift assay showed levels of the CPF1 proteins in strains YAG214 and YAG216 comparable to those in the wild-type strain (Fig. 5B). These results suggest that CPF1 functions to modulate chromatin in a DNA-bound form. The proteins from strains YAG214 and YAG216 are defective in DNA binding, and these strains both show a nuclease cleavage pattern similar to that of the cpfl strain YAG93 at the MET25 and MET16 promoters. At the MET16 locus the N-terminal domain and the wild-type ZIP domain are also required. At the MET25 locus CPF1 proteins lacking the N terminus or using the USF ZIP domain are at least partially functional in chromatin modulation. A possible explanation for this difference between the two MET gene promoters is that the CPF1 defects in YAG300 and YAG341 can be offset by the presence of two CDEI motifs in MET25. Earlier work had shown that the N-terminal two-thirds of CPF1, containing two short acidic regions reminiscent of some transcriptional activation domains, seemed to be dispensable for CPF1 function (15, 34). The data presented above show that the N terminus of the protein appears to be required for CPF1 to properly modulate chromatin at a single CDEI motif. To test whether either of the two acidic domains in the N terminus is involved in chromatin modulation, we next analyzed the chromatin of the MET16 promoters in two yeast strains, YAG301 and YAG302, which express smaller deletions in the CPF1 N terminus and which remove each of the two acidic regions. Both YAG301 (CPF1 deleted from aa 76 to 155) and YAG302 (CPF1 deleted from aa 175 to 214) show a wild-type MET16 chromatin structure (Fig. 4C). This suggests that if the acidic domains are required for chromatin modulation, then either one of the domains is sufficient for this function. The yeast strains YAG214 and YAG216 both show chromatin structures at the MET25 and MET16 loci identical to that seen in the methionine auxotroph YAG93. However, both of these strains are methionine prototrophs, as are YAG300 and YAG341 (Fig. SC), which also show a cpfl chromatin structure at the MET16 locus. In addition to being methionine prototrophs, both YAG300 and YAG341 are functional at the yeast centromere. Taken together, these data suggest that the maintenance of methionine prototrophy, optimal centromere function, and chromatin modulation are separate functions of CPF1. Transcriptional activation at the MET25 or MET16 promoter does not require CPF1. The transcription of the MET25 and MET16 genes is reported to be reduced or abolished in cpfl strains (48), but it is not known if this is responsible for the methionine auxotrophy associated with cpfl strains. We have demonstrated that chromatin structure changes do not corre-
FIG. 3. (A) Map of the MET25 gene. The solid boxes marked A and B are the CDEI motifs in the UAS region, and the open box is the TATA element. The solid circles in the table denote MNase cleavage sites in naked DNA, CPF1 yeast chromatin, and cpfl yeast chromatin on the basis of the pattern from Fig. 1A. The marker DNAs from this experiment were used to create a plot of log1o molecular weight against mobility. This was used to estimate the sites of MNase cleavage. As MNase can potentially cleave anywhere in linker DNA in chromatin, the sizes of the black circles represent about ± 15 bp around the estimated cleavage site. Below the table is a possible interpretation of the cleavage patterns based on the protection of cleavage sites in naked DNA, the spacing of new sites in chromatin, and the small-probe analysis described in the legend to Fig. 3C. The shaded circles represent nucleosome core particles protecting 146 bp of DNA. Circles not shaded denote areas in which a single nucleosome will not fit the pattern or in which chromatin cleavage patterns are similar to those in naked DNA (and therefore are uninformative). (B) Map of the MET16 gene. The table shows the MNase cleavage patterns from Fig. 1B. The markings and interpretation are as for the MET25 map. (C) Short-probe nucleosome mapping of the MET25 promoter. Chromatin from DBY745 and YAG93 was digested with 800 U of MNase per ml for 5 min at 37°C. Purified DNA was separated on a 1.5% agarose gel and blotted. The blot was probed with the three probes shown in Fig. 3A.
5236
Ce
KENT ET AL.
A ll:
MOL. CELL. BIOL.
1
B
0-0
-C _
m~
t
-
m
>-
>-
m
< cn
