Chronic fluoxetine upregulates activity, protein and mRNA ... - Nature

The Pharmacogenomics Journal (2006) 6, 413–420 & 2006 Nature Publishing Group All rights reserved 1470-269X/06 $30.00 www.nature.com/tpj

ORIGINAL ARTICLE

Chronic fluoxetine upregulates activity, protein and mRNA levels of cytosolic phospholipase A2 in rat frontal cortex JS Rao1, RN Ertley1, H-J Lee1, SI Rapoport1 and RP Bazinet1 1 Brain Physiology and Metabolism Section, National Institute on Aging, National Institutes of Health, Bethesda, MD, USA

Correspondence: Dr JS Rao, Brain Physiology and Metabolism Section, National Institute on Aging, National Institutes of Health, 9000 Rockville Pike, Bldg. 9, 1S -126, Bethesda, MD 20892, USA. E-mail: [email protected]

Chronic lithium and carbamazepine, which are effective against mania in bipolar disorder, decrease the activity of cytosolic phospholipase A2 (cPLA2) and the turnover rate of arachidonic acid in phospholipids in rat brain. Assuming that stages of bipolar disorder are related to brain arachidonic acid metabolism, we hypothesized that drugs effective in depression would increase cPLA2 activity. To test this hypothesis, adult male CDF-344 rats were administered fluoxetine (10 mg/kg intraperitoneally (i.p.) or saline (control) (i.p.) chronically for 21 days. Frontal cortex cPLA2 protein, phosphorylated cPLA2, activity and mRNA levels were increased after chronic fluoxetine. Transcription factors (activator protein-1, activator protein-2, glucocorticoid response element, polyoma enhancer element-3 and nuclear factor-kappa B ) that are known to regulate cPLA2 gene expression were not significantly changed by chronic fluoxetine, but nuclear AU-rich element/poly(U)binding/degradation factor-1 RNA-stabilizing protein was increased significantly. The results suggest that chronic fluoxetine increases brain cPLA2 gene expression post-transcriptionally by increasing cPLA2 mRNA stabilization. Chronic fluoxetine’s effect on cPLA2 expression was opposite to the effect reported with chronic lithium or carbamazepine administration, and may be part of fluoxetine’s mode of action. The Pharmacogenomics Journal (2006) 6, 413–420. doi:10.1038/sj.tpj.6500391; published online 25 April 2006 Keywords: fluoxetine; brain; cPLA2; AUF-1; arachidonic acid; depression

Introduction

Received 3 January 2006; revised 28 February 2006; accepted 1 March 2006; published online 25 April 2006

The antidepressant drug fluoxetine (Prozac) is widely used to treat major depression and, in combination with a mood stabilizer, to treat the depressive phase of bipolar disorder.1,2 Fluoxetine is a selective serotonin (5-HT) reuptake inhibitor (SSRI) that increases the amount of 5-HT available for signaling in the synaptic cleft.3,4 As 5-HT levels are increased before changes in patient’s mood, it is likely that neuroplastic changes in signaling are required for fluoxetine’s therapeutic effectiveness.5 Neuroplastic effects that include downregulation of 5-HT1A autoreceptors and increased synaptic 5-HT content are involved in the onset of antidepressant efficacy.6,7 These effects are only seen with chronic but not with acute fluoxetine administration.6,8,9 In this regard, chronic fluoxetine administration upregulates 5-HT2C receptors in the rat choroid plexus,10 increases rat brain 5-HT2A receptor signaling11 and increases 2,5-dimethoxy-4-iodoamphetamine-induced cFOS gene expression.12

Fluoxetine increases frontal cortex JS Rao et al

414

Consistent with the above, [18F]setoperone binding to 5HT2A receptors is increased in fluoxetine-treated depressed patients compared to untreated depressed patients.13 Despite the many cellular and molecular targets of fluoxetine, its mechanism of action is not agreed upon. Arachidonic acid (20:4n–6) is a nutritionally essential polyunsaturated fatty acid predominately found in the stereospecifically numbered-2 (sn-2) position of membrane phospholipids. It can be released by a calcium-dependent arachidonic acid-selective cytosolic phospholipase A2 (cPLA2), which is found in post-synaptic sites in the brain.14 In addition to cPLA2, secretory and Ca2 þ -independent phospholipase A2 (sPLA2 and iPLA2, respectively) can cleave fatty acids at the same sn-2 position as cPLA2. However, they differ in their calcium requirement, and phosphorylation and substrate specificities.15–19 A portion of the released arachidonic acid will be converted to bioactive eicosanoids via cyclooxygenase-1 or cyclooxygenase-2, lipoxygenase or cytochrome P450 epoxygenase enzymes.20,21 The released arachidonic acid and its metabolites can modulate signal transduction, transcriptional regulation, neuronal activity, apoptosis and a number of other processes within the central nervous system.22–24 The PLA2 that releases arachidonic acid from neural membranes can be linked to various G-protein-coupled receptors including 5-HT2A/2C25–28 and D2-like dopaminergic receptors,29,30 as well as to the ionotropic N-methyl-D-aspartate (NMDA) receptor.31,32 Acute administration of 5-HT agonists and fluoxetine to unanesthetized rats increases the incorporation coefficient of arachidonic acid from plasma into regions of rat brain that contain 5-HT2A/2C receptors, as a marker of cPLA2 activation.33 When given chronically to rats, drugs that are effective in the manic phase of bipolar disorder (e.g. lithium, valproic acid and carbamazepine) decrease the turnover rate of arachidonic acid in rat brain phospholipids.34–36 The ability of lithium and carbamazepine to do so has been ascribed to their decreasing transcription of cPLA2.37,38 As antidepressant monotherapy of bipolar disorder can induce switching to mania,2,39,40 chronic administration of fluoxetine to rats might exert the opposite effects on brain arachidonic acid kinetics and cPLA2 expression, particularly if the symptoms of bipolar disorder are related to the arachidonic acid cascade. To test this hypothesis, we administered fluoxetine at a therapeutically relevant dose10 to rats for 21 days, and studied expression of PLA2 enzymes in the frontal cortex before or after a 3-day saline washout period. We also made measurements 3 h after a single fluoxetine injection. We further examined known cPLA2 regulating transcription factors and an mRNA-stabilizing protein.41 We used the frontal cortex for our studies, as functional imaging and post-mortem studies from patients with major depression indicate abnormalities in structure and function within this region.42–46 Furthermore, this choice allowed us to compare our results with those on the frontal cortex obtained after chronic administration of lithium and carbamazepine to rats.47,48

The Pharmacogenomics Journal

Results Effect of chronic and acute fluoxetine on cytosolic phospholipase A2 isoforms in rat frontal cortex Chronic fluoxetine administration (21 days) significantly increased (54%) the frontal cortex cPLA2 protein level compared to the level in control rats (Figure 1a) (F ¼ 5.80, df ¼ 2, 19; P ¼ 0.010). This effect was not observed after chronic fluoxetine with a 3-day saline washout or 3 h after acute fluoxetine (Figure 1a and b). Thus, it represented a chronic neuroplastic effect that became statistically insignificant after 3 days of drug washout. Fluoxetine is not detectable in rat plasma 48 h after 21 days of administration,49 and brain half-lives of fluoxetine and its active metabolite norfluoxetine are 5 and 15 h, respectively.50 Effect of chronic fluoxetine on phospho-cytosolic phospholipase A2 and cytosolic phospholipase A2 activity in rat frontal cortex Chronic fluoxetine increased (27%) the level of phosphorylated (Ser-505) cPLA2 protein in rat frontal cortex compared to controls (Figure 1c) (F ¼ 5.30; df ¼ 2, 20; P ¼ 0.013). However, after the 3-day saline washout, the phosphorylated cPLA2 level was not significantly different from the control level (Figure 1c). Cytosolic phospholipase A2 activity was significantly increased (38%) in the frontal cortex of rats chronically administered fluoxetine (F ¼ 5.77; df ¼ 2, 21 P ¼ 0.010), but not after the 3-day saline washout compared to control activity (Figure 1d). Effect of chronic fluoxetine on cytosolic phospholipase A2 mRNA in rat frontal cortex We further examined the basis for increased cPLA2 protein levels after chronic fluoxetine, by measuring cPLA2 mRNA. The frontal cortex cPLA2 mRNA level was significantly increased (1.7-fold) in rats chronically administered fluoxetine (F ¼ 6.34; df ¼ 2, 15; P ¼ 0.010), but not after a 3-day saline washout compared to the control level (Figure 1e). Effect of chronic fluoxetine on phospholipaseA2 isoforms in rat frontal cortex Frontal cortex iPLA2 (F ¼ 1.56; df ¼ 2, 21; P ¼ 0.23) and sPLA2 (F ¼ 0.70; df ¼ 2, 15; P ¼ 0.47) protein levels were not significantly changed after chronic fluoxetine or chronic fluoxetine with 3-day washout, compared to control levels (Figure 2a and b). Effect of chronic fluoxetine on cytosolic phospholipase A2-regulating transcription factors An excess amount of cold (100 times) oliogonucleotide blocked the binding of specific cPLA2 regulating transcription factors (Figure 3a), indicating the specificity of each transcription factor in rat frontal cortex. We examined whether the increase in cPLA2 mRNA with the chronic fluoxetine was associated with upregulation of known cPLA2 regulating transcription factors: activator protein-1(AP-1), activator protein-2 (AP-2), glucocorticoid response element (GRE), nuclear factor-kappa B (NF-kB) and polyoma enhancer element-3 (PEA3).51 There was no significant change


415

∗

150 100 50 0 CON

c

150 125 100 75 50 25 0

Percent of Control

b

200

Percent of Control

Percent of Control

a

∗

150 100 50 0

CON

FLU FLU-WASHOUT

200

CON

FLU

cPLA2 110 KD

pcPLA2 110 KD

β-actin 45 KD

β-actin 45 KD

d

e

∗

Relative expression in folds

PLA2 activity (pmol/min/mg)

8 6 4 2 0 FLU FLU-WASHOUT

CON

FLU FLU-WASHOUT

∗

2.0 1.5 1.0 0.5 0.0 CON

FLU FLU-WASHOUT

Figure 1 Representative immunoblots of cytosolic phospholipase A2 (cPLA2) protein levels in frontal cortex of rats (a) chronically administered saline (control, n ¼ 7), fluoxetine (n ¼ 7) or fluoxetine followed by a 3-day saline washout (washout, n ¼ 8) (*P ¼ 0.010) and (b) acutely administered saline (control, n ¼ 8) or fluoxetine (n ¼ 8). (c) Representative immunoblots of phosphorylated cPLA2 in the frontal cortex from rats chronically administered saline (control, n ¼ 8), fluoxetine (n ¼ 8) and fluoxetine with a 3-day washout (washout, n ¼ 7) (*P ¼ 0.013). Data are ratios of optical density of cPLA2 or phospho-cPLA2 to b-actin, expressed as the percent of control. (d) Cytosolic phospholipase A2 activity was measured as described in materials and methods from rats chronically administered saline (n ¼ 8), fluoxetine (n ¼ 8) and fluoxetine with a 3-day washout (n ¼ 8) (*P ¼ 0.010). (e) Phospholipase A2 mRNA level in the frontal cortex from rats chronically administered saline (control, n ¼ 6), fluoxetine (n ¼ 6) or fluoxetine with a 3-day washout (washout, n ¼ 6) (*P ¼ 0.010) was measured using real time reverse transcription-polymerase chain reaction (RTPCR). Each sample was assayed in triplicate in three independent experiments. Data are expressed as the relative level of cPLA2 in the fluoxetinetreated animals normalized to the endogenous control (b-globulin) and relative to the control rats (calibrator), using the DDCT method. All the data were compared using one-way analysis of variance with Dunnett’s post hoc test for multiple comparisons (mean7s.e.m.).

100

100

Percent of Control

b 125

Percent of Control

a 125 75 50 25 0 CON

iPLA2 85 KD β-actin 45 KD

FLU FLU-WASHOUT

75 50 25 0 CON

FLU FLU-WASHOUT

sPLA2 14 KD β-actin 45 KD

Figure 2 Representative immunoblots of calcium independent phospholipase A2 (iPLA2) (a) (control, n ¼ 8, chronic fluoxetine, n ¼ 8, and chronic fluoxetine followed by a 3-day saline washout, n ¼ 8) and secretory phospholipase A2 (sPLA2) (b) (control, n ¼ 5, chronic fluoxetine, n ¼ 8, chronic fluoxetine followed by a 3-day saline washout (washout), n ¼ 5) protein levels in the frontal cortex from rats chronically administered saline, fluoxetine and fluoxetine with 3-day washout. Data are ratios of optical density of iPLA2 or sPLA2 to b-actin, expressed as the percent of control, and compared using one-way analysis of variance with Dunnett’s post hoc test for multiple comparisons (mean7s.e.m.).

in the binding activity of AP-1, NF-kB, GRE, PEA3 or AP-2 in the frontal cortex of rats chronically administered fluoxetine (Figure 3b–f).

Effect of chronic fluoxetine on RNA-binding protein AU-rich element/poly(U)-binding/degradation factor-1 in rat frontal cortex We examined whether chronic fluoxetine affected the level of the AU-rich element/poly(U)-binding/degradation factor1 (AUF-1) RNA-stabilizing protein in nuclear extracts from frontal cortex.41 The (37 kDa) AUF-1 RNA-binding protein was significantly elevated (59%) in the frontal cortex after chronic fluoxetine (F ¼ 17.25; df ¼ 2, 21; P ¼ 0.0001) but not after chronic fluoxetine with 3-day washout compared to the control level (Figure 4).

Discussion Chronic (21 days) fluoxetine administration to rats significantly increased activity, protein and mRNA levels of cPLA2 in rat frontal cortex. However, these significant increases were not observed after a 3-day washout period or with a single acute injection of fluoxetine. The lack of increased cPLA2 expression after the 3-day saline washout is consistent with a reported half-life of cPLA2 mRNA of 3–4 h,52 and known half-lives of fluoxetine and its active metabolite in the blood and brain.49,50



416

b 150 a b

a b

a b

Free probes

NF-κB

125 100 75 50 25 0

125 100 75 50 25 0

Gelshift

AP-1 AP-2

c 150

AP-1

Percent of Control

a b a b

Percent of Control

a

CON

FLU

CON

FLU

GRE NF-κB PEA3 Gelshift

e 150

125 100 75 50 25 0 CON

f

PEA3

Percent of Control

GRE

Percent of Control

Percent of Control

d 150

125 100 75 50 25 0

FLU

CON

FLU

AP-2

150 125 100 75 50 25 0 CON

FLU

Gelshift

Figure 3 (a) Specificity of DNA–protein binding activity for activator proteinol (AP-2), activator protein-2 (AP-1), glucocorticoid response element (GRE), nuclear factor-kappa B (NF-kB) and polyoma enhancer element (PEA3) in rat frontal cortex nuclear extracts was tested in the absence (a) and presence (b) of excess (100 times) unlabeled probe, as described in the Materials and methods section. The presence of labeled probe produced a gel shift that was blocked and excess amount of unlabeled probed. (b–f) Representative gelshift bands (DNA–protein complex) of AP-1 (b), NF-kB (c), GRE (d), PEA3 (e) and AP-2 (f) in the frontal cortex from rats chronically administered saline (control, n ¼ 8) or fluoxetine (n ¼ 8). DNA-binding activity was measured in brain nuclear extracts as described in the Materials and methods section. Data are mean7s.e.m., expressed as the percent of control, and compared using an unpaired t-test.

Percent of Control

200

∗∗∗

150

100 50

0 CON

FLU

FLU-WASHOUT

Figure 4 Representative immunoblots of nuclear AU-rich element/ poly(U)-binding/degradation factor (AUF-1) protein levels in the frontal cortex from rats chronically administered saline (control, n ¼ 8), fluoxetine (n ¼ 8) or fluoxetine with 3-day washout (n ¼ 8). Data are ratios of optical density of AUF-1 to b-actin, expressed as the percent of control, and compared using an unpaired t-test (mean7s.e.m., ***P ¼ 0.0001).

The increased cPLA2 activity after chronic fluoxetine was likely owing to an increased protein level and increased phosphorylation of cPLA2. Earlier studies have shown that phosphorylation at serine 505 of cPLA2 protein by mitogenactivated protein kinase (MAPK p38) resulted in cPLA2 activation.53,54 Another study reported that fluoxetine


activates MAPK p38 activity in cultured rat astrocytes,55 which could account for the increased phosphorylation of cPLA2 by chronic fluoxetine. The difference in the percent increase of cPLA2 protein level (54%) compared to the percent increase in phosphorylated cPLA2 (serine 505) level (27%) may represent differences in MAPK activity54 and cPLA2 protein half-life. The difference in the percent increase of cPLA2 activity (38%) compared to its phosphorylation may be owing to other kinases (protein kinase C (PKC) or MAPK p42) that phosphorylate cPLA2 at other sites,56,57 or it may reflect methodological differences. Increased expression was specific for cPLA2 as sPLA2 and iPLA2 protein levels were not changed significantly after chronic fluoxetine. Cytosolic phospholipase A2 protein levels were likely increased because of the increased level of mRNA. Consistent with this neither, cPLA2 mRNA nor protein was increased in the frontal cortex of animals chronically administered fluoxetine followed by a 3-day washout. Chronic fluoxetine did not significantly alter any of five measured cPLA2 regulating transcription factors (AP-1, AP-2, GRE, NF-kB and PEA3). This suggests that the increased mRNA was owing to post-transcriptional changes as opposed to a transcription change. Several known factors can enhance the half-life of cPLA2 mRNA in vitro. Epidermal growth factor, platelet derived growth factor, phorbol 12myristate 13-acetate and cytokines increase steady-state cPLA2 mRNA in cultured rat glomerular mesangial cells.52 An increase in cPLA2 mRNA could result from either increased transcription or decreased degradation.52 There


417

are three ATTTA motifs distributed over a 180 bp region in the 30 untranslated region, and cPLA2 mRNA can be destabilized by the presence of inserted adenosine–uridinerich element.52 The attachment of RNA-binding protein to mRNA can stabilize mRNA and decrease its degradation, thus increasing its half-life. Thus, the increase in nuclear 37 kDa AUF-1 protein in rat frontal cortex after chronic fluoxetine but not after fluoxetine plus washout could have accounted for the increased cPLA2 mRNA, which would further contribute to the increased expression and activity of cPLA2. Chronic fluoxetine is reported to increase phospholipase C (PLC) activity11 and 5-HT2A receptor density in the postmortem brain of patients with depression.13 This implies that chronic fluoxetine can enhance 5-HT2-coupled activation of PLC and possibly other 5-HT receptor-coupled effectors such as PLA2. Like fluoxetine, the SSRI fluvoxamine increased rat cortex total PLA2 activity after 7 days but not after 1 day of administration.58 Chronic fluoxetine’s ability to increase cPLA2 activity could increase the turnover of arachidonic acid in brain phospholipids. Acute fluoxetine administration to awake rats increases arachidonic acid incorporation into phospholipids at 5-HT2A/2C containing sites of brain,33 and chronic fluoxetine could have a similar effect. This is supported by the recent evidence that even chronic fluoxetine followed by a 3-day washout increased the incorporation coefficients of arachidonic acid in the brain of unanesthetized rats.59 Several studies report that chronic administration of drugs (lithium, valproic acid and carbamazepine) effective in the manic phase of bipolar disorder selectively decrease the turnover of arachidonic acid in brain phospholipids of unanesthetized rats.34–36,60,61 Although valproate likely targets a long-chain acyl-Coenzyme A synthetase,62 lithium and carbamazepine decrease the mRNA, protein and activity levels of cPLA2,37,38 most likely by decreasing the AP-2 transcription factor.47,48 sPLA2 and iPLA2 expression are unaffected by chronic lithium or carbamazepine.37,63 Monotherapy with SSRIs in patients with bipolar depression often induces switching to mania.2,40 Thus, it is possible that drugs effective in depression have opposite effects on the arachidonic acid cascade, particularly on cPLA2, compared to the effects of drugs effective in mania, which implies that activity of the arachidonic acid cascade may correlate with mania or depression in bipolar disorder. Testing other SSRIs and antidepressants may help to confirm this hypothesis. Increased arachidonic acid signaling can modulate PKC64 and the neuroendocrine system. Arachidonic acid regulates the release of adrenal corticotrophin hormone from cultured anterior pituitary cells65 and corticotrophin-releasing factor66 from superfused rat hypothalami. The hypothalamic-pituitary-adrenal (HPA) axis is altered in patients with depression, who have a reduced plasma cortisol response to dexamethasone/corticotrophin.67 Thus, increasing arachidonic acid signaling could have beneficial effects in depression by upregulating the HPA axis. More studies are needed to elucidate the relations between SSRIs, arachidonic acid metabolism and neuroendrocrine function.

In conclusion, 21 days of fluoxetine administration to adult rats at a therapeutically relevant dose increased the mRNA, protein, phosphorylation and activity levels of cPLA2 in the frontal cortex, without altering sPLA2 or iPLA2 protein levels. These effects may lead to an upregulation of the brain arachidonic acid cascade, which remains to be tested. They did not occur with acute fluoxetine administration and disappear after 3-days of washout. As chronic fluoxetine increases cPLA2 activity, whereas several drugs effective in treating mania decrease cPLA2 activity, it may be that the arachidonic acid cascade is increased in mania and decreased in bipolar depression. This could be tested in humans using positron emission tomography.68,69 Further studies examining a broad class of antidepressants on the regulation of the arachidonic acid cascade are warranted. Materials and methods Animals The study was conducted following the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals (Publication no. 80–23), and was approved by the Animal Care and Use Committee of the National Institute of Child Health and Human Development. Male CDF-344 rats, weighing 200–215 g (Charles River Laboratories; Wilmington, MA, USA), were acclimatized for 1 week in an animal facility with controlled temperature, humidity and light cycles and food and water were provided ad libitum. Rats were randomly assigned into three chronic treatment groups and administered drug or saline by i.p. injection. First group (control, n ¼ 8) received vehicle (0.9% saline) once daily for 21 days, a second group (fluoxetine, n ¼ 8) received 10 mg/kg fluoxetine (Prozac; (7)-N-methyl-g-[4(trifluoromethyl) phenoxy] benzenepropanamine; Sigma Chemical Co., St Louis, MO, USA) once daily for 21 days, and a third group (washout, n ¼ 8) received the same 21-day drug regimen as the fluoxetine group but followed by a 3-day drug-free period in which the rats received vehicle injections. This chronic dosing regimen of fluoxetine has been shown to decrease depression in rodents as measured by a variety of behavioral tests and biomarkers related to depression.70–72 Three hours after the last drug or saline injection, all rats were anesthetized with CO2 and decapitated. The brain was rapidly excised and the frontal cortex dissected, frozen in 2-methylbutane at 501C and stored at 801C until use. For acute fluoxetine studies, animals were randomized into two treatment groups that received a single intraperitoneal (i.p.) injection of either 10 mg/kg fluoxetine (n ¼ 8) (Sigma Chemical Co., St Louis, MO, USA), or an equivalent volume of saline (vehicle) (n ¼ 8). Three hours after injection, animals were anesthetized with CO2 and decapitated, and the frontal cortex was removed and stored as described above. Preparation of cytoplasmic and nuclear extracts Cytoplasmic and nuclear extracts were prepared from the frontal cortex of rats, as described previously.48 Protein



418

concentrations of cytoplasmic and nuclear extracts were determined using Bio-Rad protein Reagent (Bio-Rad, Hercules, CA, USA). Western blot analysis Proteins from cytoplasmic and nuclear extract (75 mg) were separated on 10–20% SDS-polyacrylamide gels (PAGE) (Bio-Rad). Following SDS-PAGE, the proteins were electrophoretically transferred to a nitrocellulose membrane. Cytoplasmic protein blots were incubated overnight in Tris-buffered saline buffer, containing 5% non-fat dried milk and 0.1% Tween-20, with specific primary antibodies (1:200 dilution) for the group IVA cPLA2, group IIA sPLA2, group VIA iPLA273 (Santa Cruz Biotech, Santa Cruz, CA, USA) and phosphocPLA2 (1:500 dilution) (Cell Signaling, Beverly, MA, USA). The nuclear AUF-1 protein levels were determined using nuclear protein blots incubated overnight with specific primary antibody (1:200 dilution) for AUF-1 (Upstate USA Inc., Charlottesville, VA, USA). Cytoplasmic and nuclear protein blots were incubated with appropriate horse radish perxidase (HRP)-conjugated secondary antibodies (Bio-Rad) and visualized using a chemiluminescence reaction (Amersham, Piscataway, NJ, USA) on X-ray film (XAR-5, Kodak). Optical densities of immunoblot bands were measured using Alpha Innotech Software (Alpha Innotech, San Leandro, CA, USA) and were normalized to b-actin (Sigma) to correct for unequal loading. All experiments were carried out twice with eight independent samples. Values are expressed as the percent of control. Total RNA isolation and real-time reverse transcription-Polymerase chain reaction Total RNA and cDNA were prepared as described48 from frontal cortex and measured by real-time quantitative reverse trancription-Polymerase chain reaction (RT-PCR), using the ABI PRISM 7000 sequence detection system (Applied Biosystems, Foster City). Specific primers and probes for cPLA2, purchased from TaqManR gene expression assays (Applied Biosystems), consisted of a 20 mix of unlabeled PCR primers and Taqman minor groove binder (MGB) probe (FAM dye-labeled). The fold change in gene expression was determined using the DDCT method.74 Data were expressed as the relative level of the target gene (cPLA2) in the chronic fluoxetine, chronic fluoxetine with washout and acute fluoxetine animals normalized to the endogenous control (b-globulin) and relative to the control rats (saline injected) (calibrator), as described previously.37,48 All experiments were carried out twice in triplicate with six independent samples per group. Phospholipase A2 activity Frontal cortex cPLA2 activity was measured as described by Yang et al.18 Briefly, a portion of the cytoplasmic fraction was incubated in 100 mM 1-palmitoyl-2-arachidonoyl-snglycerol-3-phosphorylcholine and phosphatidylinositol 4,5-bisphosphate (97:3) containing approximately 100 000 c.p.m. of 1-palmitoyl-2-[1-14C] arachidonoyl-sn-glycerol-3-phosphorylcholine and 4,5 biphosphatidylinositol


in 400 mM Triton X-100 mixed micelles containing 100 mM Hepes, pH 7.5, 80 mM Ca2 þ , 2 mM dithiothretiol (DTT) and 0.1 mg/ml fatty acid-free bovine serum albumin. The assay was started by adding the reagent to cytoplasmic extracts for 30 min at 401C in a shaking bath. The reaction was terminated by the addition of Dole’s reagent (2-propanol: heptane:0.5 M sulfuric acid, 400:100:20, by volume) followed by vortexing. Released [1-14C]arachidonic acid was extracted with the addition of heptane and water. One milliliter of the heptane was loaded on a bond elute reservoir with a frit preloaded with silicic acid. The free [1-14C]arachidonic acid was eluted from the silicic acid and by adding diethyl ether with the help of a vacuum. Radioactivity of the elutant was then determined by liquid scintillation counting, and activity was calculated after correcting for the background of blank samples. All samples were run in triplicate and values were expressed in pmol/ min/mg of protein. Electrophoretic mobility shift assay Gelshift assays were performed on the nuclear extracts from rat frontal cortex to examine the DNA-binding activities of transcription factors (AP-1, AP-2, GRE, NF-kB, PEA3) known to regulate cPLA2 mRNA expression. Nuclear protein extracts (15 mg) were incubated with a non-radioactive (10 ng) biotin-labeled DNA oligo consensus (Panomics, Redwood City, CA, USA) in gelshift buffer (10 mM Tris-HCl, pH 7.5, 1 mM NaCl, 1 mM MgCl2, 0.5 mM ethylenechiamine tetraacetic acid , 0.5 mM DTT, 4% glycerol and 50 mg/ml poly-dI:dC) for 30 min on ice. The DNA–protein complex was separated on a 5% Tris-borate EDTA (TBE) gel and electrophoretically transferred to a nylon membrane. The biotin-labeled oligonucleotide complex was visualized using a streptavidin–HRP conjugate coupled with chemiluminescence on X-ray film (Kodak, Rochester, NY, USA). The following oligonucleotide sequences were used for the gelshift assay: AP-1 – CGCTTGATGAGTCAGCCGGAA; NFkB – AGTTGAGGGGACTTTC C CGGC; AP-2 – GATCGAACT GACCGCCCGCGGCCCGT; GRE – GACCCTAGAGGATCTG TACAG GATGTTCTAGATCCAATTCG and PEA3 – GATCTCG AGCAGGAAGTTA. The specificity of each transcription factor was determined using 100 times excess unlabeled probe with a fixed amount of biotin-labeled DNA oligo consensus (10 ng) and nuclear extracts (15 mg). Optical densities of gelshift bands were quantified using Alpha Innotech software (Alpha Innotech). Values were expressed as the percent of control. Statistical analysis Data are expressed as mean7s.e.m. When three groups were compared (chronic fluoxetine, chronic fluoxetine with washout and control), statistical significance was determined using a one-way analysis of variance with Dunnett’s post hoc test for multiple comparisons vs control. Statistical significance was set at Pp0.05. When two groups were compared (acute fluoxetine and control), statistical significance was determined using an unpaired two-tailed t-test.


419

Abbreviations AP-1 AP-2 AUF cPLA2 iPLA2 MAPK PEA3 NF-kB sPLA2 SSRI 5-HT

activator protein-1 activator protein-2 AU-rich element/poly(U)-binding/degradation factor cytosolic phospholipase A2 calcium-independent phospholipase A2 mitogen-activated protein kinase polyoma enhancer element 3 nuclear factor kappa B secretory phospholipase A2 selective serotonin reuptake inhibitor serotonin

15

16

17

18

19

Acknowledgments This research was supported by the Intramural Research Program of the NIH, NIA.

References

20 21

22 23

1 Tohen M, Vieta E, Calabrese J, Ketter TA, Sachs G, Bowden C et al. Efficacy of olanzapine and olanzapine-fluoxetine combination in the treatment of bipolar I depression. Arch Gen Psychiatry 2003; 60: 1079–1088. 2 Goodwin GM. Evidence-based guidelines for treating bipolar disorder: recommendations from the British Association for Psychopharmacology. J Psychopharmacol 2003; 17: 149–173; discussion 147. 3 Benfield P, Heel RC, Lewis SP. Fluoxetine. A review of its pharmacodynamic and pharmacokinetic properties, and therapeutic efficacy in depressive illness. Drugs 1986; 32: 481–508. 4 Wong DT, Perry KW, Bymaster FP. Case history: the discovery of fluoxetine hydrochloride (Prozac). Nat Rev Drug Discov 2005; 4: 764–774. 5 Nierenberg AA. Do some antidepressants work faster than others? J Clin Psychiatry 2001; 62(Suppl 15): 22–25. 6 Gardier AM, Malagie I, Trillat AC, Jacquot C, Artigas F. Role of 5-HT1A autoreceptors in the mechanism of action of serotoninergic antidepressant drugs: recent findings from in vivo microdialysis studies. Fundam Clin Pharmacol 1996; 10: 16–27. 7 Le Poul E, Laaris N, Hamon M, Lanfumey L. Fluoxetine-induced desensitization of somatodendritic 5-HT1A autoreceptors is independent of glucocorticoid(s). Synapse 1997; 27: 303–312. 8 Hjorth S, Auerbach SB. 5-HT1A autoreceptors and the mode of action of selective serotonin reuptake inhibitors (SSRI). Behav Brain Res 1996; 73: 281–283. 9 Dawson LA, Nguyen HQ, Smith DI, Schechter LE. Effects of chronic fluoxetine treatment in the presence and absence of (7)pindolol: a microdialysis study. Br J Pharmacol 2000; 130: 797–804. 10 Laakso A, Palvimaki EP, Kuoppamaki M, Syvalahti E, Hietala J. Chronic citalopram and fluoxetine treatments upregulate 5-HT2c receptors in the rat choroid plexus. Neuropsychopharmacology 1996; 15: 143–151. 11 Damjanoska KJ, Van de Kar LD, Kindel GH, Zhang Y, D’Souza DN, Garcia F et al. Chronic fluoxetine differentially affects 5-hydroxytryptamine (2A) receptor signaling in frontal cortex, oxytocin- and corticotropin-releasing factor-containing neurons in rat paraventricular nucleus. J Pharmacol Exp Ther 2003; 306: 563–571. 12 Tilakaratne N, Yang Z, Friedman E. Chronic fluoxetine or desmethylimipramine treatment alters 5-HT2 receptor mediated c-fos gene expression. Eur J Pharmacol 1995; 290: 263–266. 13 Massou JM, Trichard C, Attar-Levy D, Feline A, Corruble E, Beaufils B et al. Frontal 5-HT2A receptors studied in depressive patients during chronic treatment by selective serotonin reuptake inhibitors. Psychopharmacology (Berlin) 1997; 133: 99–101. 14 Ong WY, Sandhya TL, Horrocks LA, Farooqui AA. Distribution of cytoplasmic phospholipase A2 in the normal rat brain. J Hirnforsch 1999; 39: 391–400.

24 25

26

27

28

29

30

31

32

33

34

35

Murakami M, Kambe T, Shimbara S, Kudo I. Functional coupling between various phospholipase A2s and cyclooxygenases in immediate and delayed prostanoid biosynthetic pathways. J Biol Chem 1999; 274: 3103–3115. Murakami M, Shimbara S, Kambe T, Kuwata H, Winstead MV, Tischfield JA et al. The functions of five distinct mammalian phospholipase A2S in regulating arachidonic acid release. Type IIa and type V secretory phospholipase A2S are functionally redundant and act in concert with cytosolic phospholipase A2. J Biol Chem 1998; 273: 14411–14423. Akiba S, Mizunaga S, Kume K, Hayama M, Sato T. Involvement of group VI Ca2+-independent phospholipase A2 in protein kinase C-dependent arachidonic acid liberation in zymosan-stimulated macrophage-like P388D1 cells. J Biol Chem 1999; 274: 19906–19912. Yang HC, Mosior M, Johnson CA, Chen Y, Dennis EA. Group-specific assays that distinguish between the four major types of mammalian phospholipase A2. Anal Biochem 1999; 269: 278–288. Murakami M, Kudo I. Phospholipase A2. J Biochem (Tokyo) 2002; 131: 285–292. Funk CD. Prostaglandins and leukotrienes: advances in eicosanoid biology. Science 2001; 294: 1871–1875. Lands WEM, Crawford CG. Enzymes of membrane phospholipid metabolism. In: Marinosi A (ed). Plenum press: New York, 1976, pp 3–85. Kam PC, See AU. Cyclo-oxygenase isoenzymes: physiological and pharmacological role. Anaesthesia 2000; 55: 442–449. Leslie JB, Watkins WD. Eicosanoids in the central nervous system. J Neurosurg 1985; 63: 659–668. O’Banion MK. Cyclooxygenase-2: molecular biology, pharmacology, and neurobiology. Crit Rev Neurobiol 1999; 13: 45–82. Felder CC, Kanterman RY, Ma AL, Axelrod J. Serotonin stimulates phospholipase A2 and the release of arachidonic acid in hippocampal neurons by a type 2 serotonin receptor that is independent of inositolphospholipid hydrolysis. Proc Natl Acad Sci USA 1990; 87: 2187–2191. Garcia MC, Kim HY. Mobilization of arachidonate and docosahexaenoate by stimulation of the 5-HT2A receptor in rat C6 glioma cells. Brain Res 1997; 768: 43–48. Qu Y, Villacreses N, Murphy DL, Rapoport SI. 5-HT2A/2C receptor signaling via phospholipase A2 and arachidonic acid is attenuated in mice lacking the serotonin reuptake transporter. Psychopharmacology (Berlin) 2005; 180: 12–20. Stout BD, Clarke WP, Berg KA. Rapid desensitization of the serotonin(2C) receptor system: effector pathway and agonist dependence. J Pharmacol Exp Ther 2002; 302: 957–962. Hussain T, Lokhandwala MF. Dopamine-1 receptor G-protein coupling and the involvement of phospholipase A2 in dopamine-1 receptor mediated cellular signaling mechanisms in the proximal tubules of SHR. Clin Exp Hypertens 1997; 19: 131–140. Hayakawa T, Chang MC, Rapoport SI, Appel NM. Selective dopamine receptor stimulation differentially affects [3H]arachidonic acid incorporation, a surrogate marker for phospholipase A2-mediated neurotransmitter signal transduction, in a rodent model of Parkinson’s disease. J Pharmacol Exp Ther 2001; 296: 1074–1084. Basselin M, Chang L, Bell JM, Rapoport SI. Chronic lithium chloride administration attenuates brain NMDA receptor-initiated signaling via arachidonic acid in unanesthetized rats. Neuropsychopharmacology 2005; Nov. 9. Weichel O, Hilgert M, Chatterjee SS, Lehr M, Klein J. Bilobalide, a constituent of Ginkgo biloba, inhibits NMDA-induced phospholipase A2 activation and phospholipid breakdown in rat hippocampus. Naunyn Schmiedebergs Arch Pharmacol 1999; 360: 609–615. Qu Y, Chang L, Klaff J, Seemann R, Rapoport SI. Imaging brain phospholipase A2-mediated signal transduction in response to acute fluoxetine administration in unanesthetized rats. Neuropsychopharmacology 2003; 28: 1219–1226. Bazinet RP, Rao JS, Chang L, Rapoport SI, Lee HJ. Chronic carbamazepine decreases the incorporation rate and turnover of arachidonic Acid but not docosahexaenoic acid in brain phospholipids of the unanesthetized rat: Relevance to bipolar disorder. Biological Psychiatry 2006; 59: 401–407. Chang MC, Contreras MA, Rosenberger TA, Rintala JJ, Bell JM, Rapoport SI. Chronic valproate treatment decreases the in vivo turnover of



420

36

37

38

39 40 41

42 43

44

45 46

47

48

49

50

51

52

53

54

55

arachidonic acid in brain phospholipids: a possible common effect of mood stabilizers. J Neurochem 2001; 77: 796–803. Chang MC, Grange E, Rabin O, Bell JM, Allen DD, Rapoport SI. Lithium decreases turnover of arachidonate in several brain phospholipids. Neurosci Lett 1996; 220: 171–174. Ghelardoni S, Tomita YA, Bell JM, Rapoport SI, Bosetti F. Chronic carbamazepine selectively downregulates cytosolic phospholipase A2 expression and cyclooxygenase activity in rat brain. Biol Psychiatry 2004; 56: 248–254. Rintala J, Seemann R, Chandrasekaran K, Rosenberger TA, Chang L, Contreras MA et al. 85 kDa cytosolic phospholipase A2 is a target for chronic lithium in rat brain. Neuroreport 1999; 10: 3887–3890. Feder R. Fluoxetine-induced mania. J Clin Psychiatry 1990; 51: 524–525. Ghaemi SN, Hsu DJ, Soldani F, Goodwin FK. Antidepressants in bipolar disorder: the case for caution. Bipolar Disord 2003; 5: 421–433. Dean JL, Sully G, Clark AR, Saklatvala J. The involvement of AU-rich element-binding proteins in p38 mitogen-activated protein kinase pathway-mediated mRNA stabilisation. Cell Signal 2004; 16: 1113–1121. Drevets WC. Prefrontal cortical–amygdalar metabolism in major depression. Ann NY Acad Sci 1999; 877: 614–637. Uranova NA, Vostrikov VM, Orlovskaya DD, Rachmanova VI. Oligodendroglial density in the prefrontal cortex in schizophrenia and mood disorders: a study from the Stanley Neuropathology Consortium. Schizophr Res 2004; 67: 269–275. Cotter D, Mackay D, Chana G, Beasley C, Landau S, Everall IP. Reduced neuronal size and glial cell density in area 9 of the dorsolateral prefrontal cortex in subjects with major depressive disorder. Cereb Cortex 2002; 12: 386–394. Rajkowska G. Depression: what we can learn from postmortem studies. Neuroscientist 2003; 9: 273–284. Drevets WC, Ongur D, Price JL. Neuroimaging abnormalities in the subgenual prefrontal cortex: implications for the pathophysiology of familial mood disorders. Mol Psychiatry 1998; 3: 220–226, 190–221. Rao JS, Bazinet RP, Lee HJ, Rapoport SI. Mood stabilizers that downregulate the brain arachidonic acid cascade reduce AP-2 or NFkB transcription factors in rat frontal cortex. Neuro Psychopharmacology – Supplement 44th ACNP Annual Meeting. Waikoloa, Hawaii, 2005. Rao JS, Rapoport SI, Bosetti F. Decrease in the AP-2 DNA-binding activity and in the protein expression of AP-2 alpha and AP-2 beta in frontal cortex of rats treated with lithium for 6 weeks. Neuropsychopharmacology 2005; 30: 2006–2013. Durand M, Berton O, Aguerre S, Edno L, Combourieu I, Mormede P et al. Effects of repeated fluoxetine on anxiety-related behaviours, central serotonergic systems, and the corticotropic axis axis in SHR and WKY rats. Neuropharmacology 1999; 38: 893–907. Caccia S, Cappi M, Fracasso C, Garattini S. Influence of dose and route of administration on the kinetics of fluoxetine and its metabolite norfluoxetine in the rat. Psychopharmacology (Berlin) 1990; 100: 509–514. Morri H, Ozaki M, Watanabe Y. 50 -Flanking region surrounding a human cytosolic phospholipase A2 gene. Biochem Biophys Res Commun 1994; 205: 6–11. Tay A, Maxwell P, Li ZG, Goldberg H, Skorecki K. Cytosolic phospholipase A2 gene expression in rat mesangial cells is regulated post-transcriptionally. Biochem J 1994; 304(Part 2): 417–422. Borsch-Haubold AG, Bartoli F, Asselin J, Dudler T, Kramer RM, ApitzCastro R et al. Identification of the phosphorylation sites of cytosolic phospholipase A2 in agonist-stimulated human platelets and HeLa cells. J Biol Chem 1998; 273: 4449–4458. Hefner Y, Borsch-Haubold AG, Murakami M, Wilde JI, Pasquet S, Schieltz D et al. Serine 727 phosphorylation and activation of cytosolic phospholipase A2 by MNK1-related protein kinases. J Biol Chem 2000; 275: 37542–37551. Mercier G, Lennon AM, Renouf B, Dessouroux A, Ramauge M, Courtin F et al. MAP kinase activation by fluoxetine and its relation to gene expression in cultured rat astrocytes. J Mol Neurosci 2004; 24: 207–216.


56

57

58

59

60

61

62

63

64

65

66

67

68

69

70

71

72

73

74

Coulon L, Calzada C, Moulin P, Vericel E, Lagarde M. Activation of p38 mitogen-activated protein kinase/cytosolic phospholipase A2 cascade in hydroperoxide-stressed platelets. Free Radic Biol Med 2003; 35: 616–625. Nemenoff RA, Winitz S, Qian NX, Van Putten V, Johnson GL, Heasley LE. Phosphorylation and activation of a high molecular weight form of phospholipase A2 by p42 microtubule-associated protein 2 kinase and protein kinase C. J Biol Chem 1993; 268: 1960–1964. Kucia K, Malecki A, Gabryel B, Trzeciak HI. Effect of antidepressants on the phospholipase A2 activity in plasma membranes of the rat brain cortex. Pol J Pharmacol 2003; 55: 5–15. Qu Y, Chang L, Klaff J, Seemann R, Greenstein D, Rapoport SI. Chronic fluoxetine administration enchances brain phospholipase A2 signaling via arachidonic acid in unanesthetized rats. Eur J Pharmacol 2006; March 2. Bazinet RP, Rao JS, Chang L, Rapoport SI, Lee HJ. Chronic valproate does not alter the kinetics of docosahexaenoic acid within brain phospholipids of the unanesthetized rat. Psychopharmacology (Berlin) 2005; 182: 180–185. Chang MC, Bell JM, Purdon AD, Chikhale EG, Grange E. Dynamics of docosahexaenoic acid metabolism in the central nervous system: lack of effect of chronic lithium treatment. Neurochem Res 1999; 24: 399–406. Bazinet RP, Weis MT, Rapoport SI, Rosenberger TA. Valproic acid selectively inhibits conversion of arachidonic acid to arachidonoyl-CoA by microsomal long-chain fatty acyl-CoA synthetases: Relevance to bipolar disorder. Psychopharmacology (Berlin) 2006; 1: 122–129. Weerasinghe GR, Rapoport SI, Bosetti F. The effect of chronic lithium on arachidonic acid release and metabolism in rat brain does not involve secretory phospholipase A2 or lipoxygenase/cytochrome P450 pathways. Brain Res Bull 2004; 63: 485–489. Koide H, Ogita K, Kikkawa U, Nishizuka Y. Isolation and characterization of the epsilon subspecies of protein kinase C from rat brain. Proc Natl Acad Sci USA 1992; 89: 1149–1153. Abou-Samra AB, Catt KJ, Aguilera G. Biphasic inhibition of adrenocorticotropin release by corticosterone in cultured anterior pituitary cells. Endocrinology 1986; 119: 972–977. Cambronero JC, Rivas FJ, Borrell J, Guaza C. Role of arachidonic acid metabolism on corticotropin-releasing factor (CRF)-release induced by interleukin-1 from superfused rat hypothalami. J Neuroimmunol 1992; 39: 57–66. Pfennig A, Kunzel HE, Kern N, Ising M, Majer M, Fuchs B et al. Hypothalamus-pituitary-adrenal system regulation and suicidal behavior in depression. Biol Psychiatry 2005; 57: 336–342. Giovacchini G, Chang MC, Channing MA, Toczek M, Mason A, Bokde AL et al. Brain incorporation of [11C]arachidonic acid in young healthy humans measured with positron emission tomography. J Cereb Blood Flow Metab 2002; 22: 1453–1462. Giovacchini G, Lerner A, Toczek MT, Fraser C, Ma K, DeMar JC et al. Brain incorporation of 11C-arachidonic acid, blood volume, and blood flow in healthy aging: a study with partial-volume correction. J Nucl Med 2004; 45: 1471–1479. El Yacoubi M, Bouali S, Popa D, Naudon L, Leroux-Nicollet I, Hamon M et al. Behavioral, neurochemical, and electrophysiological characterization of a genetic mouse model of depression. Proc Natl Acad Sci USA 2003; 100: 6227–6232. Dulawa SC, Holick KA, Gundersen B, Hen R. Effects of chronic fluoxetine in animal models of anxiety and depression. Neuropsychopharmacology 2004; 29: 1321–1330. De Foubert G, Carney SL, Robinson CS, Destexhe EJ, Tomlinson R, Hicks CA et al. Fluoxetine-induced change in rat brain expression of brainderived neurotrophic factor varies depending on length of treatment. Neuroscience 2004; 128: 597–604. Lucas KK, Dennis EA. Distinguishing phospholipase A2 types in biological samples by employing group-specific assays in the presence of inhibitors. Prostaglandins Other Lipid Mediat 2005; 77: 235–248. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(Delta Delta C(T)) Method. Methods 2001; 25: 402–408.