Chronic Lymphocytic Leukemia and Subseq

0 downloads 0 Views 3MB Size Report
Ig iso- type^.^^.^'.'^ In addition, Southern blot analysis of Ig gene rearrangements has not shown ..... Nucleic Acids Res 15: 10605, 1987. 47. Kevin J, Trainor KJ, ...

Molecular Genetic Demonstrationof the Diverse Evolutionof Richter’s Syndrome (Chronic Lymphocytic Leukemiaand Subsequent Large Cell Lymphoma) By Andrhs Matolcsy, Giorgio Inghirami, and Daniel M. Knowles Paired samples of chronic lymphocytic leukemia (CLL) or small lymphocytic lymphoma (SLL) and the subsequent diffuse largecell lymphoma (DLL) of sixcases of Richter’s syndrome were investigated to establish the clonal relationship between the CLL/SLL and the DLL components and to define the oncogene and/ortumor-suppressorgene alterations involvedin the morphologic transformation of CLL/SLL. Southern blot hybridizationanalysisshowed identical clonal immunoglobulin (lg) gene-rearrangement patterns in the CLL/SLL and DLL components in four cases and different lg gene-rearrangement patterns in two cases. Polymerase chain reaction (PCR) amplification, cloning, and DNA sequencing of complementary determinant region 3(CDR3) of the 19-heavychain gene of one of the two cases in which the lg gene-rearrangement patterns were different showed nonidentical sequences in the CLL/SLL and DLL components. In the other case, monomorphic Epstein-Barr virus(EBV) genome integrationwas detected in the DLL but not in the CLL, suggestingthat theCLL and DLL components in this case of Richter‘s syndrome also represent unrelated clones. Single-strand conformation polymorphism (SSCP) analysisandsequencing of exons 5

through 9 of the p53 tumor-suppressor gene showed a mutation in codon 176 of the DLL but not in the CLLJSLL component in onecase where the CLL/SLL and C)LL represented different clones. The p53 mutation probably played a role in the development of the lymphoma rather than morphologic transformation of the CLL/SLL in this case. SSCP analysis and sequencing also showed identicalmutations in codon 282 in both the CLL/SLL and DLL comWnents in a case where the CLL and DLL represented identiual clones. Thus, this p53 gene mutation was presentboth before and after morphologic transformation, and therefore, probably did not play a primary role in this process. Southern blot hybridization analysis failed to show evidence of bcl-l , bcl2, c-myc proto-oncogene or retinoblastoma (Rb) tumorsuppressorgenerearrangements in these six cases of Richter‘ssyndrome. In conclusion, the original CLL/SLL and the subsequent DLL in Richter’s syndrome may or may not be derived from identical clones, and the well-known proto-oncogenes and tumor-suppressor genes do not appear to play an obvious and consistent role in the morphologic transformation of CLL/SLL to DLL. 0 1994 by The American Society of Hematology.

A

events may play a role in this transformation. However, comparative studies of structural alterations of oncogenes and tumor-suppressor genes in both the CLL/SLL and the DLL components occumng in the same patient have not been performed. For these reasons, we sought to determine the clonal relationship between the original CLL/SLL and thesubsequent DLL inRichter’s syndrome and identify the oncogenes and tumor-suppressor genes that are involved in morphologic transformation and tumorprogression. We investigated six cases of Richter’s syndrome in which both the CLL/SLL and the DLL components in each case were available for analysis. Using a variety of molecular genetic approaches we were able to show that Richter’s syndrome may occur through different pathways, ie, the DLL maybe clonally related to or clonally distinct from the original CLL/SLL, and that specific oncogene or tumor-suppressor gene alterations

PPROXIMATELY 3% to 5% of cases of chronic lymphocytic leukemia (CLL) and/or small lymphocytic lymphoma (SLL) show evidence of morphologic transformation todiffuse large cell lymphoma (DLL).’ This process is commonly referred to asRichter’s ~yndrome.~“ It is usually accompanied by marked clinical progression of the dis.~ despite the well-known ease and a fatal o ~ t c o m eHowever, occurrence of this phenomenon, theprecise clonal relationship between the two neoplastic cell populations is still unclear. It has been suggested, based on immunohistologic, immunoglobulin (Ig) isotype, anti-idiotype, Ig gene rearrangement and cytogenetic studies, that the DLL develops as a clonal evolution from CLL/SLL?I5 or alternatively, that thetwo neoplasms are distinct, unrelated clonal proliferations.16-20 Unfortunately, a definitive conclusion can not be drawn from these conflicting reports.21*22 In fact, there are many potential explanationsfor these disparate results. For example, different cases have been evaluated by different methods, each of which possess their own limitations. Furthermore, somatic point mutation:’-24 isotype switching and postrearrangement gene deletion12 of the Ig genes may be responsible for observed differences in Southernblot analyses and different reactivities of anti-idiotype antibodies. Oncogene activation and tumor-suppressor gene mutation are not known to occur inthe majority of cases of CLL/ SLL,25although bcl-l and bcl-2 rearrangements and p53 gene mutations have been reported in sporadic cases.26In contrast, elevated c-myc oncogene expression:’ retinoblastoma (Rb)gene deletion,28and p53 tumor-suppressor gene m u t a t i ~ nhave ~ ~ been . ~ ~ reported in somecases ofCLL/SLL showing clinical progression and morphologic transformation. These findings suggest that certain specific genetic B/&,

Vo183. No 5 (March l), 1994: pp 1363-1372

From the Division of Surgical Pathology and the Hematopathology Laboratory, Department of Pathology, Columbia University, College of Physicians and Surgeons, New York,NY. Submitted August l I , 1993; accepted October 28, 1993. Supported by National Institutes ofHealth Grants No. CA42836 and EY 06337 to D.M.K. A.M.is partiallysupported by TheSoros Foundation, Hungary. Address reprint requests to Daniel M . Knowles, MD, Department of Pathology, ColumbiaUniversity, College of Physicians and Surgeons, 630 W 168th St New York,NY 10032. The publication costs of this arlicle were defrayed in part by page charge payment.This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C.section I734 solely to indicate thisfact. 01994 by The American Society ofHematology. 0006-4971/94/8305-0002$3.00/0 1363

1364

MATOLCSY, INGHIRAMI,AND KNOWES

BurnHI digested DNAs to an Ig-K light chain joining region probe ( J K ) ~and an Ig-h light chain constant region probe (CA), respecti~ely.~’ The T-cell receptor 0 chain (TB) gene was investigated by hybridization of BarnHI-digested DNAs to the TB gene-constant MATERIALS AND METHODS region probe.38The organization of the c-myc locus was analyzed Patients and pathologic samples. Six cases of Richter’s synby hybridization of EcoRI- and HindIII-digested DNAs to the drome were included in this reportbased strictly upon the availabilMC4 13RC probe.39The hcl- 1 locus of chromosomeI 1 was investiity of sufficient quantities offresh pathologic specimens of both the gated by hybridization of Hind111 and EcoRI digests of DNA to the CLL/SLL and DLL components to perform the studies described 2. l-kb Sac I fragment for the major translocation cluster (MTC) below. Heparinized peripheral blood (PB) samples and lymph node breakpoint and 460-bp Pvu 11-Smu 1 genomic fragment designated biopsy specimens were collected during the course of routineclinip94PS that lies approximately 23.4-kb of the MTC.40The bcl-2 local evaluation using standard diagnostic procedures and promptly cus was investigated by hybridization of BamHI-digested DNAs to delivered to the laboratory. Mononuclear cells were separated from the pFL- l and pFL-2 probes representing a portion ofchromosome the PB and lymph node samples by Ficoll-Hypaque (Pharmacia 18 at themajor andminor bcl-2 breakpoint regions, respecFine Chemicals, Piscataway, NJ) density gradient centrifugation. t i ~ e l y . ~The ’ , ~ Rbl ~ locus was analyzed by hybridization ofHindI11The mononuclear cells were cryopreserved in a viable state in fetal digested DNAs using 5’-Rb (0.7-kb, Hpa I-EcoRI) and 3”Rb (3.9calf serum and dimethylsulfoxide at - 170°C until needed. Reprekb, EcoRI-EcoRI) subclones derived from the full-length Rbl sentative hematoxylin- and eosin-stained sections were prepared cDNA (gift of S. Friend, Harvard Medical School, Charlestown, from portions of each lymph node biopsy that was routinely fixed MA)43corresponding to exons 1 to 9 and I O to 27, respectively. The in buffered formalin, B5, or Bouin’s and embedded in paraffin. RepEpstein-Barr virus (EBV) genome was detected by hybridization of resentative portions of each tissue specimen were embedded in a BamHI-digested DNAs to the 5.2-kb BarnHI-EcuRI fragment of cryopreservativesolution(OCT compound, Miles, Elkhart, ID) and EBV genomic termini.44 Two highly polymorphic markers for loci stored at -70°C. The diagnosis of Richter’s syndrome was based onchromosome 17,pYNZ22.145andp144-D646wereusedtoassess upon correlative analysis of the clinical, morphologic, and immuthe loss of heterozygocity in the p53 mutated case, as well as to nophenotypic characteristics. evaluate the possibility of p53 deletion in the nonmutated cases. Immunophenotypic characterization. The immunophenotypic The nitrocellulose filter of the EcoRI-digested DNAs ofcase numprofiles of the CLL/SLLs and DLLs was determined at the timeof b e r two, which was probed with JH, was rehybridized with diagnosis by immunohistochemical staining of frozen or paraffin case-specific CDR3 synthetic oligonucleotides (ACCCACCTC tissue sections using a three step avidin-biotin immunoperoxidase TTGGGTACGGATGACCTCCCGGGGAGGCGCTAC and technique or an immunoalkaline phosphatase antialkaline phosAGATTGGGCCGCCTGGTGGTTCGGGGAGTCCCACTTTphatase method, and/or by direct and indirect immunofluorescent GACTAC). flow cytometry of isolated cells in suspension using the FACScan DNA [email protected] Heavy-chain Ig gene-rearrangement prodfluorescent activated cell sorter (Becton Dickinson, Mountain ucts were amplified using genomic DNA ( 1 pg) in the presence of View, CA) in conjunction with a large panel of polyclonal and mixed oligonucleotide primers (ACACGGC[C/T][G/C]TGTATTmonoclonal antibodies(MoAbs) as previously de~cribed.~’ ACTGT) (FR3A) designed on consensus sequences for codons 89 DNA extraction. Genomic DNA was extracted from cryoprethrough 95 (thirdframework region) of human Ig/heavychain variserved mononuclear cell suspensions and tissue blocks using a saltable region (VH):’ and a universal JH oligonucleotide primer ing-out procedure.32 Briefly, the cells or frozen tissue sections were (GGATGGTACCAAGCTTTGAGGAGACGGTGACCA) (JHresuspended in 3 mL of nuclei lysis buffer containing I O mmol 33). Oligonucleotides were synthesized by the solid-phase triester TrisHCI, 400 mmol NaCI, and 2 mmol EDTA; 200 pL of 10%somethod. Both oligonucleotide primers are equipped with Clu I and dium dodecyl sulfate (SDS) and 500 p L of proteinase K solution ( l EcoRI restriction sites, and a Kpn I and Hind111 restriction site, remg proteinase K in I % SDS and 2 mmol EDTA)were subsequently spectively, enabling cloning and sequence determination of the added. After overnight digestion at 37”C, I mL of saturated NaCl PCR-amplified fragments. DNA was amplified in the presence of was added. This mixturewas centrifuged at 2,500 rpm for 20 min250 pmol deoxynucleotide triphosphates (dNTPs), 50 mmol KCI, utes, and 2 volumes of ethanol were added to the supernatant to I O mmol Tris-HCI pH 8, 1 mmol MgClz, 1% gelatin, 20 pmol of precipitate the DNA, which was washed several times in 70% ethaeach oligonucleotide and 2.5 U of Taq DNA polymerase. The mixnol. ture was overlayered with mineral oil and subjected to onecycle of Sotrfhern blot analysis. Five-microgram aliquots of genomic l minute at94“C, 3 minutes at 52”C, 40 minutes at 72”C, followed DNA were digested with the appropriate restriction endonucleases 40 cycles of 1 minute at 94°C 2 minutes, 30 seconds at 56% 90 by according to the manufacturer’s instructions (Boehringer-Mannseconds at 72”C, followed by a final extension of 7 minutes at 72°C heim, Indianapolis, IN), electrophoresed in 0.8 or I % agarose gels, performed on an automatedheat block (DNA Thermal-Cycler, Perdenatured with alkali, neutralized, and transferred to nitrocellulose kin-Elmer Cetus). In all experiments, samples of genomic DNAs filters (Schleicher & Schuell, Keene, NH).” The filters were hybridfrom monoclonal neoplastic B cells, normal reactive lymph nodes, ized in 50% formamide/3X standard-citrate (SSC) buffer at 37’C tonsils, and T-cell leukemias were included aspositive and negative to DNA probes that had been 3zP-labeledby the random-primer controls. In addition, mixtures without templatewere included as a extension method and tosynthetic oligonucleotide probes that had negative control. PCR products were size fractionated on alkaline been 5’end labeled with “P using direct T4 kinase phosphorylation 4% agarose gels by electrophoretic separation enabling the detection according to the manufacturer’s instructions (Boehringer-Mannof PCR fragmentsof approximately 70to 120 bp. Based on the fact heim). The filters were washed in 0.2X SSC/0.5%SDS at 60°C for 2 that the tumor cell population comprised at least 10%of the total hours and then autoradiographed at -70°C for 16 to 48 hours as cells in all our neoplastic samples, discrete bands should be present previously described.34 if the neoplastic cells have undergone Ig gene rearrangement. DNA and synthetic oligonucleotide probes. The Ig heavy chain PCR-SSCP anal-vsis. The sequences of p53 primers used for gene was investigated by hybridization of EcoRI and Hind111 diPCR amplification are as follows: P5-5, S-TTCCTCTTCCTGgested DNAs to anIg heavy chain joiningregion probe (JH).35 The CAGTACTC-3’; P5-3,5’-AGTTGCAAACCAGACCTCAG-X Pi” Ig light chain genes were studied by hybridization of EcoRI and

do not appear to characterize the morphologic transformation and clinical progression of CLL/SLL to DLL.

RICHTER’S SYNDROME

six pairs of samples expressed IgM. In addition, the CLL in 3 and both theCLL and the DLL in case 4 expressed case CaseSex Age Dateof Biopsy Diagnosis Site as well. Both the CLL/SLL and the DLL samples in IgD l 79 F 104/03/9 LN SLL three patients (cases 2,3, and 6) expressed CD5. In the other LN DLL 03/25/92 three patients (cases 1,4, and 5) the neoplastic B-cell popuF 1 1 /og/as 2 CLL PB lations were CDY. In case 3, the high proportion (73%)of DLL 11/13/as Vallecula CD20’ CLL cells contrasted with 15% CD20’ DLL cells. In 3 F 01 /05/as CLL PB case 5, the low percentage ( 1 1%) of CD20’ SLL cells conDLL ol/1a/ag LN 4 76 F 0212a186 CLL PB trasted with 80% CD2Ot DLL cells. The proportion of DLL Spleen 061I 0186 CD20’ CLL/SLL and DLL cells were comparably high 5 52 F 0312319 l LN SLL (67% to 96%)in the other fourcases. DLL LN 05/27/92 Southern blot analysis of Ig and T-cell receptor gene reM oa12319 1 6 CLL PB arrangements. The CLL/SLL and DLL samples of the six 09/27/9 1 LN DLL Richter’s syndrome patientswere evaluated in parallel. The Abbreviations: LN, lymph node; PB, peripheral blood; SLL, small lymresults of Southern blot analysis of the various restriction phocytic lymphoma;CLL, chronic lymphocytic leukemia. endonuclease-digested DNA samples for antigen-receptor gene rearrangements are depicted in Table 3 and illustrated in Figs 1 and 2. Clonal rearrangement of the Ig-heavy-chain 5 , S-GTGTTGTCTCCTAGGTTGGC-3’; P7-3, S-GTCAGAgene was detected in all sixpairs of DNA samples. The moGGCAAGCAGAGGCT-3 P8-5, S-TATCCTGAGTAGTGGlecular size of the rearranged JH locus of the CLL/SLL and TAATC-3 P8-3,S-AAGTGAATCTGAGGCATAAC-3’; P9-5,5” DLL components was identical infour cases and was GCAGTTATGCCTCAGATTCAC-3’; P9-3, S-AAGACTTAGdifferent intwo cases (Fig 1). Five of the six cases had TACCTGAAGGGT-3’. SSCP analysis was accomplished according more thanone restriction-band fragment indicating reto an adapted version of a previously reportedm e t h ~ d ? ~ Briefly, .~’ arrangement of both alleles. Analysis of the K light chain PCRs were performed with 1 0 0 ng of genomic DNA, 10 pmol of gene in BamHI-digested DNAs showed clonal reeach primer, 2.5 pmol dNTPs, 1 pCi of [a-32P]deoxycytidine triphosphate (New England Nuclear, [Boston, MA]; specific activity, arrangement in the CLL/SLL and DLL samples of four 3,000 Ci/mmol), 10 mmol Tris (pH 8.8), 50 mmol KCI, I mmol cases and in the SLL sample of one case (case 1). In the MgClz,0.01% gelatin, 0.5 U Taq polymerase, in a final volume of group of four cases where both sampleswere rearranged, the 10 pL. Thirty cycles of denaturation (94”C), annealing (63°C for Southern blot patterns were identical in three cases and p53 exons 5, 6, and 9; 62’C for p53 exon 7; 58°C for p53 exon 8), different in one case (case 2 ) (Fig I , top). Clonal reand extension (72°C) weredone on an automated heat block. The arrangement of the X light chain gene was detected in both reaction mixture (2 pL) was diluted 1:25 in 0.1% SDS, 10 mmol the CLL and DLL samples in one case (case 6) and in the EDTA and further mixed I : 1 with a sequencingstop solution, conDLL sample of one case (case 1) (Fig 1, bottom). The 8taining 20 mmol NaOH. Samples were heated at 95’C for 5 minkb CA germline bands were missing because of restriction utes, chilledon ice, and immediately loaded onto a 6% acrylamide0.08 mol/L TRIS-borate, 0.089 mol/L boric acid, 0.002 mol/L fragment length polymorphism in case L 3 ’ In summary, EDTA (TBE) gel containing 10%glycerol. Gels wererun at 4 to 8 Southern blot analysis showed an identical Ig gene-reW for 14 to 16 hours at room temperature. The gels were fixed in arrangement pattern in the CLL/SLL and DLL components 10%acetic acid, air dried and autoradiography was performed at in four cases and a different Ig gene-rearrangement pattern -70°C with an intensifying screenfor 6 to 24 hours. in the CLL/SLL and DLL components in two cases. The TCloning and sequencing of PCR products. PCR products were cell receptor B chain gene was present in the gemlineconcloned in the pCR 1,OOO vector usingthe TA cloning system (Invifiguration in all the samples from all six patients (Table 3). trogen Corp, San Diego, CA), following the manufacturer’s instrucPCR amplification, cloning, and sequencing of the CDR3 tions. DNA sequencingwas performed directly froma small-scale region of the Ig-heavy chain gene. Cloning and sequencing plasmid preparation4’after determining the presence of an insert. studies were performed to determine whether differences in The Sequenase version2.0 (US Biochemical, Cleveland,OH) sys tern was used according to the manufacturer’s instructions. DNA the Southern blot pattern of Ig gene rearrangement were the sequences were analyzed with the assistance of Mec-Vector version result of two different clones or somatic mutations.The two 3.5 software. Richter’s syndrome cases where the CLL/SLL and the DLL components have different patterns of clonal Ig gene reRESULTS arrangement, and oneof the cases where they have identical Clinical, morphologic, and immunophenotypic characterpatterns of clonal Ig gene rearrangement were selected for ization. The clinical data of the six patients are presented cloning and sequencing the CDR3 region of the Ig heavy in Table 1 and the results of immunophenotypic analysis chain gene. PCR amplification of the six samples from the of the CLL/SLL and DLL samples obtained from these six three cases resulted in PCR products ranging in size between patients are summarized in Table 2. The CLL/SLLs and 120 and 75 bp. The physical maps andnucleotide sequences DLLs in all six patients expressed a B-cell phenotype of the Ig-heavy chain CDR3 region isolated from the CLL/ (CD20+, HLA-DR’, Ig’). The Ig light chain isotypes of the SLLs and DLLs of these three cases are illustrated in Fig 3. CLL/SLL and DLL components were identical in five of the The framework segments (FR) 3 and 4 and CDR3 region six cases.In the sixth case (case I), the SLL expressed K light are indicated according to Kabat et al.” The CDR3 sechains and thesubsequent DLL expressed X light chains. All quences of the SLL sample of case 1 showed two cl’onalp o p Table 1. Clinical Data of Six Patients With Richter‘s Syndrome

92 83

42

1365

1366

MATOLCSY, INGHIRAMI, AND KNOWLE!

Table 2. lmmunophenotypeof Paired CLL/SLL and DLL Samples in Six Cases of Richter's Syndrome 2

1

Phenotypic Marker

85

%SLL

89 15 1 1 89 2 92 12 11 80

%DLL

3

5

4

6

%CLL

%DLL

%CLL

%DL1

%CLL

%DLL

%SLL

%DL1

%CLL

%DL

90 2 ND ND 73 90

52 6 0 0

90 90 0 0 90 0

92 95 0 0 93 1

31 6 3 2 27 2

80 ND0 0 ND8 79 60 2

58

0

85 85 1 0 88 2

50

0 0 1 82

92 8 0 0 96 0

ND ND ND 2 90

73 13 14 77

98 2 39 67

89 92 3 23 80

86 1 85 73

96 ND

97 ND 3 96

ND 22 24 11

99

63

28

10

22 80

30 67

10

5

38 77 15

1 96

ND 0

60 32 90 75

Abbreviatlon: ND, not determined.

ulations with 63- and 42-bp long DNA sequences. The CDR3 region of the DLL sample from the same case consisted of 30 bp. Homologous CDR3 sequences were not detected in the SLL and DLL samples of case l . Case 2 contained two clones in the CLL and two clones in the DLL that were identical. Somatic point mutations or deletions were not detected. The sequencing data of the CLL and DLL samples of case 3 showed identical clones. CDR3-specific oligonucleotide hybridization oj' the JHprobed Southern blot. In case 2, the rehybridization of the JH-probed EcoRI-digested nitrocellulose filter with synthetic oligonucleotides specific for CDR3 showed a hybridization band at thesite ofthe rearranged JH band in the CLL sample but not inthe DLL sample (datanot shown). EBVanalysis. The six DNA samples were digested with theBamHI restriction endonuclease and subjected to Southern blot hybridization using a DNA probe specific for the fused termini of the EBV genome. A lymphoid cell line derived by EBV infection of normal polyclonal B cells and an EBVCclonal B-cell lymphoma line were used as controls for polymorphic and monomorphic EBV termini, respectively. The DLL sample from case 2 displayed a single intense positive band analogous to the monoclonal control (data not shown). None of the remaining CLL/SLL or DLL specimens contained evidence of EBV infection. Proto-oncogene and tumor-suppressor gene analysis. The results of Southern blot and SSCP analysis of the c-myc, hcl-l, and bcl-2 proto-oncogenes and the Rb and p53 tumor-suppressor genes are presented in Table 4. Southern blot analysis showed the germline configuration of the bcl-

1, bcl-2, c-myc,and Rbgenes (not shown). PCR-SSCP anal ysis of the p53 gene showed three abnormally migratin! bands: in exon 5 in the DLL sampleof case 1, and in exon I in both the CLL and DLL samples of case 4 (Fig 4).Thc nature of the p53gene mutations detected by SSCP analysi: were further studiedby cloning and sequencing of the PCR amplified exons. The DLL in case l had a G to T transitior in the second nucleotide of codon 176 resulting in a changc in the encoded amino acid from cysteine to phenylalaninc (Fig 5). The CLL and DLL samples of case 4 contained thc identical point mutation, a C to T transition in the first nu cleotide of codon 282 leading to analteration from argininc to tryptophane (Fig 3). Southern blot analysis of Hinff-di gested DNA with 17 chromosome-specific pYNZ22. I anc p144-D6 probes showed only the mutated allele, implyini loss of the normal allele (not shown). DISCUSSION

Human B-cell lymphomas are generally believed to rep resent monoclonal proliferations of neoplastic B cells tha originate from a single transformed lymphoid precursor.' The genetic defect of the parent cell is expressed in all o the members of the clone. However, the occasional biclona derivation and histologic transformation of B-cell lympho. mas indicates that additional genetic alterations of the neo, plastic clone or the development of a new and differen clone may occur.23.24*53 The majority of lymphomas that un. dergo transformation are low-grade follicular and diffua small lymphocytic lymphomas. The morphologic transfor, mation of CLL/SLL to DLL, which is usually associatec

Table 3. lg and T-cell Receptor Gene-Rearrangement Analysis of Paired CLLfSLL and DLL Samples in Six Cases of Richter's Syndrome 2

1

cDNA Probes

JH JH Jh GCA TB

Restriction Enzymes

EcoRl Hindlll BamHl G EcoRl G BamHl

DLL

SLL

R R R

G G G

Z Z

R R G RG

DLL

CLL

R R R G G

3

#G Z Z G G

R R R G G

4

CLL

G R R G G

= =

G

DLL

CLL

R R

R R R

G

5 DLL

=G R = R = R

G

SLL

G R G

=

6

DLL

CLL

R G

G R R

G

Abbreviations: G, germline configuration; R. gene rearrangement; =, gene rearrangementidentical; f, gene rearrangement different.

R G

DL1

G = =

R R

=

R G

1367

RICHTER‘S SYNDROME

case I represents a case of Richter’s syndrome where the DLL unrelated is to the original SLL. In contrast, despite U P In0 23kbthe different Ig gene-rearrangement patterns by Southern -+G blot analysisin case 2, the CDR3 sequences of the CLL and DLL components were identical. The discordant data of 9.4kbsequence and Southern blot analysis canbe interpreted in 6.6hbdifferent ways. One. the two neoplasms represent different clones and JH33 and/orFR3 primers do not recognize the Eco RI JH Ig sequence of the DLL, but do amplify the CLL.s4 Alternatively, the DLL developed fromthe CLL, and represent the same clones, and somatic mutations that modified the restriction sites lie outside of the sequenced CDR3 regions. 23kbTo exclude one or the other possibility, the JH-probed ni-G trocellulose filter was rehybridized with case-specific CDR3 synthetic oligonucleotides. Because only the CLL 9.4kb6.6kbDNA sample showed hybridizationwith the CDR3 probes, 4.4kb* the nonidentical JH-rearranged band of the DLL sample represents a new clone that was not amplifiedby the FR4JH33 PCR. However, further data concerning the clonal 2.3kbrelationship in this case is providedby the results of EBVHindIll JH DNA analysis. The integration of EBV genome in the DLL may occur before or after the morphologic transformation Fig 1. Southern blot analysisof the 19-heavy chain-gene lociin of CLL. If the infection is a posttransformation event, the six paired samples of CLL/SLL and the subsequent DLL. EcoRl digests probedwith JH (top) and Hindlll digests probedwith JH (botjntegrated EBV termini should show a polymorphic pattom). The left-sidearrows indicatemolecular-weightmarkers in kb. tern on Southern blotting. I f EBV infected the parent cell The right-side arrows denote the germline position(G). before expansionof the tumor cell population, the Southern blot will show a monomorphic pattern.55Southern blot analysis showeda monomorphic pattern in this case, sugwith clinical progression, has been designated Richter’s syn- gesting that this clonal expansion derived froma progenidrome. Twoissues must be resolvedin order to understand tor B cell which was already infected by EBV. Meanwhile, the developmentof Richter’s syndrome: the clonal origin of the CLL sample from case2 was EBV-. Therefore, the CLL the DLL and the secondary biologic effects onthe CLL/SLL and DLL cells do not apparently represent the same clone that are responsible fortransformation. in this instance. There are two possible explanations for the occurrence of The other model for the development of Richter’s syntwo histologically different lymphomas in the same patient. drome proposes that the two neoplasms are identical B-cell First, the neoplasticcell populations mayrepresenttwo different clonesas a result of different transforming events. Several reportsdescribecases of Richter’ssyndrome in which the CLL and the DLLexpressdifferent Ig isotype^.^^.^'.'^ In addition, Southern blot analysis of Ig gene rearrangements has not shown concordant rearrangement bands in the CLL and DLL components of individual cases 9,4kb+ of Richter’ssyndrome.’8.20According to these reports, Rich.4 6.6 hb’ ter’s syndrome may be biclonal. However, in the transforBamHI JK mation of follicular lymphoma the altered DNA sequences are the result ofsomatic mutation^.^^ Because somatic mutations changerestriction-enzymesites, the discordant case1 case?. case6 case5 case4 case3 Southern blot analyses do not necessarily indicate unreJ J J J -1-I J - 1 J J 4 - 1 J J J J J J J J J J lated clonal development. In the present study, Southern U P Inn U P U 0 U P In0 blot analysesof Ig gene rearrangements showed discordant -W I U W -*x: G bands in two cases (cases1 and 2). We performed PCR am9.4 kb 6.6 kbplification, cloning, and sequencing of the CDR3 region G of the Ig-heavy chain gene to determine whether somatic 4.4 kbmutations or the development of a new clone is responsible Eco RI CA for these different Ig gene-rearrangement patterns on the Fig 2. Southern blot analysis of the 19-light chain-gene loci six in Southern blot. Two differentCDR3 sequences were found paired samplesof CLL/SLL andthe subsequent DLL.BamHl digests in the SLL sample from case1 indicating rearrangement of probedwith JK(top)and EcoRl digests probed with CA (bottom). The both alleles. Becausethe CDR3 sequence of the DLL sam- left-side arrows indicate molecular-weightmarkers in kb. The rightple from case I did not match any of the SLL sequences, side arrows denote the germline position(G). case1

case2

-1-I

J J U

care4 care3

care5 case6

“””

J

J

J J P

-1-1 J U

J 0

J - 1 J - 1 J J J - 1 I n 0 U 0

J - 1 J - I

-

-

”””

J

1

J

KNOWLES 1368

AND

pripar

I'

MATOLCSY. W 3 primer

3'

I'

3'

I'

3'

PR4

COR3

PR3

l .DLL-l l .DLL-2 l .DLL-3 1.DLL-4 1 .D=-5

INGHIRAMI,

S'

l'

ACACGCCTGTGTATTACTCTGCGAG

""""""""".""" """"""."" """". """-ccc""^^-"~'~-~"

L"L"LC.""".""

ACACGGCTGTCTATTACTGTGCGAG 2. c m - 1 2.CLL-2 2. CLL-S """"c"""""""~~ 2 . CLL-3 2. CLL-8""^~.^"^"^^^^^^^^^^.. "^^^^^^^^~^^^^^^"^^^^^. 2.CLL-9

"""""""""""."

Fig 3. Clonal nucleotide sequences of FR3A-JH33 PCR product of paired CLL/SLL and DLL samplesin three cases of Richter's syndrome. The FR3, CDRB, and FR4 segments are indicated according to Kabat et atw and are demarcated with solid horizontal lines. Different sequences are indicated by appropriate base changes.

clones, and that otherfactors are responsible for the transformation withoutchanging the B-cell clone. Reports documenting the same Ig isotype and anti-idiotype expression,4,8.56 identical chromosome aberrations,6.I4 similar reactivity with MoAbs," and matching Ig gene-rearrangement pattern^^,'^ support this theory. In our report, four of the six cases exhibited identical Ig gene-rearrangement patterns by Southern blot analysis, and DNA sequence analysis of the CLL/SLL and DLL of one case showed identical clones. In the multistep process of tumorigenesis, Nakamineet all5 suggested, according to their Southern blot data, that a series of somatic pointmutations alter the CLL/SLL cells to develop DLL. Cherepakhin et a157reported a case where the Ig VH sequences of the CLL and DLL differed in several somatic point mutations. Because the precise sites of somatic mutations of Cherepakhin's case are notpublished, it is not clear whether the antigen-driven somatic mutation of CDR regions of the VH gene play a role in the development of Richter's syndrome.58 The CDR3 region including variable (V), diversity (D), and joining (J) segments, is the most unique region of the Ig gene.s9The occurrence of somatic point mutations is highest in the CDR3region because ofthe randomassortment of

V, D, and J segments and imprecise joining mechanisms.60 Though somatic pointmutations of the CDR3region were not detected in our cases, other segments could be mutated. Based on sequencing data of CLL cases, the frequency and sites of somatic mutations arenot obvious. Lack of somatic mutations,6' random distribution of somatic m u t a t i o n ~ , 6 ~ . ~ ~ and selective CDR I mutation of the VH region6" have been reported as well. The molecular genetic analysis of our six cases of Richter's syndrome in conjunctionwith other analyses of individual cases indicates that the histologic transformation ofCLL to DLL does not occur ainsingle homogenous manner.Apparently, the DLLin Richter's syndrome may represent either a clonal progression of the original CLL or a second lymphoid malignancy. We investigated the involvement of several proto-oncogenes and tumor-suppressor genes in theprogression of CLL to DLL using Southern blot and SSCP analysis. We studied loci that are known to be involved in B-cell malignanCies28,29.65-67 and are suspected of playing a role in lymphoma p r o g r e s s i ~ n . ~ ~ .The * ~ . ~examination ~ of large numbers of CLLs hasshown no or only rare cases containing bcl-l, bcl-2, or c-myc [email protected] DLLs have been found to be bcl- 1 or bcl-2 rearrangedt9 andInce

RICHTER'S SYNDROME

1369

Gene Analysis of Paired CLL/SLL and DLL Samples in Six Cases of Richter's Syndrome Table 4. EBV, Proto-oncogene, and Suppressor 2

1

cDNA Probes and Primers

E8V-TR &/-l (MTC) &/-l (p94PS) &l-2 (PFL-1) &l-2 (PFL-2) c-myc c-myc

Rb 3 exon Rb 5 exon p53 exon 5 p53 exon 6 p53 exon 7 p53 exon 8 p53 exon 9

AestrictionEnqmes

SU

DLL

SLL

BamHlN Hindlll EcoRl BamHl BamHl EcoRl Hindlll

G G G G G G

G

N G

G G G G G

Hindlll Hindlll

G G WT WT

N

WT WT WT

3

DU

SLL

5

4

DU

SU

DU

SU

N G G G

N G

N G

NN G

G G G

G G G G G

G G G G G

NP

N

G G G G G

G G G G G G

G G G G G G

G G G G G G

G G

G G

G G

G G

G G

G G

G G

M

WT WT WT WT WT

WT WT WT WT WT

WT WT WT WT WT

WT

WT WT WT M WT

WT WT WT M WT

WT WT WT WT

WT WT WT WT

6

DU

SU

DLL

N

G G G G G

G G G G G G

G G G

G G

G G

G G

G G

WT

WT WT WT WT WT

WT

WT

WT

WT

WT WT WT

WT

WT WT

WT WT

G G G

WT WT

Abbreviations: G,germ line;M, mutated; WT. wild type;N. negative; P, positive.

etsuggested that bcl-lrearranged DLLs representcases of transformed CLL/SLL. By contrast, other studies, including our own, have not foundthe hcl- 1 locus rearranged in DLLs." The possible effect ofthe c-myc oncogene on tumor progression is described in a case of blastic transforma-

7-r EXON 5

l

"

EXON 8 Fig 4. PCR-SSCP analysis of p53 gene mutations in six cases of CLL/SLL andthe subsequent DLL. Representative examplesare 8. The lane at the left end (U)indicates unshown for exons 5 and denaturedcontrol DNA. The arrows showaberrantlymigrating fragments.

tion of follicularlymphoma.70andclinically aggressive CLL,26but increased c-tnyc oncogene expression has been detected in blastic transformationof CLL without gene rearrangement." It has been proposed that inactivation of the Rb locus may contribute to the progressionofhumanmalignanc i e ~ . ~Using ' . ~ ~Southern blot analysis, as many as 13% of CLLs have been shownto exhibit Rb gene deletion.73 Ginsberg et a!'* described Rb mutations in low-grade lymphomas witha poor clinical prognosis and suggested that mutations in the Rb locus contributes to progressionof the lymphoidneoplasm.However, in our study, neither the CLL/SLL nor the DLL components of the six cases of Richter'ssyndrome showedRbgenedeletion.Oscieretreported a case of Richter's syndrome whereCLL thecells but not the DLL cells were mutated, also suggesting that Rb gene deletions do not contribute to histologic transformation of CLL. Recently, however, using the more sensitive fluorescent in situ hybridization (FISH) technique, as many as 3 1% of CLLs have been shownto contain Rbgene delet i ~ nTherefore, . ~ ~ applicationof the FISH technique, which is more sensitive than Southern blotting,in the futuremay better helpto delineate the role of Rb gene deletion in Richter's syndrome. The p53 gene is one of the tumor-suppressor genesthat maybeinvolved in negative regulation of cell proliferat i ~ n . ~ "Several '~ lines of evidence support the notion that loss, alteration, or inactivation of this gene contributesto the development andprogression ofhuman malignancies.'* Gaidano et a129investigated the frequency ofp53 mutations in a large series of B-cell malignancies and found histologically transformed cases of CLL (Richter's syndrome)to be frequently mutated.Ichikawa et aI3'described p53 gene mutations in a large series ofclinically advanced B-cell lymphomas. However, neither of the two studies analyzed the tumor cell populations from the same patients both before and after transformation. We performed SSCP and sequence analysis of exons5 through 9 of the p53 gene in six paired

MATOLCSY, INGHIRAMI, AND KNOWLES

1370

Case I A

C

G

T

G C T

i ’TI

C C

cys + Phe (codon 176)

C

e

DLL

DLL

Fig 5. Nucleotide sequences showing p53 gene mutations. Nucleotide sequences of wild type are indicated accordingto Buchman et al.‘’ The DLL cells of case 1 show a point mutation in codon 176 (TGC-lTC; CysPhe). The CLL and DLL cells of case 4 have the identicalpoint mutation incodon 282 (CGGTGG; Arg-TV).

samples of CLLand the subsequent DLL inorder to determine the possible role of the p53 gene intumor progression and transformation. We detected mutations in exon 5 (codon 176) of the DLL in casel and in exon 8 (codon 282) of both the CLL and the DLL in case 4. The exon 8 mutations in the CLL and DLL were identical. We did not detect p53 gene mutations in the other four cases of Richter’s syndrome. It is obvious that p53 mutation was not primarily responsible for morphologic transformation in case 4, because the identical p53 mutation was present both before and after histologic transformation in both the CLL and DLL. In case I , the CLL and DLL clones were different and only the DLL cells were p53 mutated. Therefore, the p53 mutation may have played a role in the development of a new clone rather than in the morphologic transformation of the CLL/SLL in this case. This study addressed the issue of the clonal relationship between CLL and the subsequent DLL in Richter’s syndrome, and sought to identify the factors responsible for transformation. We showed that the DLL may represent either the identical cloneas the CLL/SLL, or may representa new unrelated clone,and that none of the well-known oncogenes and tumor-suppressor genesare responsible forthe transformation of CLL/SLL to DLL. Becausethe DLL may develop from the original CLL/SLL or may represent a different malignant clone,the transforming events involved in the development of Richter’s syndrome may be different as well. In those cases of Richter’s syndrome where the CLL and DLL represent the same clones, random or antigendriven somatic mutations may be involved in the progression of the lymphoma. In the development of biclonal Richter’s syndrome, a genetic malformationthat has no effect on the CLL cells, suchas p53 gene mutation, may initiate the second malignancy.

REFERENCES I . Foucar K: B cell chronic lymphocytic and prolymphocytic leukemia, in KnowlesDM (ed):Neoplastic Hematopathology,Baltimore, MD, Williams& Wilkins, 1992, p 1181 2. Richter MN: Generalizedreticular cell sarcoma of lymph nodes associated with lymphatic leukemia. Am J Pathol 4285, I928 3. Lortholary P, Boiron M, Ripault P, Levy JP, Manus A, Bernard J: Leuckmie lymphoide chronique secondairment associik i une kticulopathie maligne, syndrome de Richter. Nouv Rev Fr Hematol4:62 I , I964 4. Foucar K, Rydell R E Richter’s syndrome in chronic lymphocytic leukemia.Cancer 46: I 18, 1980 5. Armitage JO, Dick FR. Corder M P Diffuse histiocytic lymphoma complicating chronic lymphocytic leukemia. Cancer 41: 422, 1978 6. Nowell P, Finan J, Glover D, Guerry D Cytogenetic evidence for the clonal nature of Richter’s syndrome. Blood 58: 183,198I 7. D e l s o l G, Laurent G, Kuhlein E, Familiades J, Riga1 F, Pris J: Richter’s syndrome. Evidence for the clonal origin of the two proliferations. Am J Clin Pathol76:308, 198I 8. Bertoli LF, KubagawaH. BorzilloGV, MayumiM, Prchal JT, Kearney JF, Durant JK, Cooper M D Analysis with anti-idiotype antibody of a patient with chronic lymphocytic leukemia and a large celllymphoma (Richter’ssyndrome). Blood 70:45, 1987 9. Michiels JJ, vanDongen JJM. Hagemeijer A, Sonneveld P, Ploemacher RE, AdriaansenHJ, van der Kwast ThH, Brederoo P, Abels J: Richter’s syndrome with identical immunoglobulin gene rearrangements in the chronic lymphocytic leukemia and the supervening non-Hodgkin lymphoma. Leukemia3:819, 1989 IO. Sun T, Susin M, Desner M, Pergolizzi R, Cuomo J, Koduru P The clonal originoftwo cell populations in Richter’s syndrome. Hum Pathol2 1:722, 1990 I I . Miyamura K, Osada H. Yamauchi T, ltoh M, Kodera Y, Suchi T, Takahashi T, Ueda R: Single clonal origin of neoplastic Bcells with different immunoglobulin light chains in a patient with Richter’s syndrome.Cancer 66: 140, 1990

Case 4 A A

A

C

G

T

A

C

G A

...

Arg cTrp (codon 282)

CLL

RICHTER’S SYNDROME

12. Schots R, Dehou MF, Jochmans K, Heirman C, de Waele M, van Camb B, Thielemans K Southern blot analysis in a case of Richter’s syndrome. Evidence for a postrearrangement heavy chain gene deletion associated with the altered phenotype. Am J Clin Patho1 95571, 1991 13. Bernard DJ, Bignon YJ, Pauchard J, Ramos F, Fonck Y, Coujal F, Chollet, Plagne R: Genotypic analysis of Richter’s syndrome. Cancer 67:997, 1991 14. Han T, Ohtaki K, Sadamori N, Block AW, Dadey B, Ozer H, Sandberg AA: Cytogenetic evidence for clonal evolution in B cell chronic lymphocytic leukaemia. Cancer Genet Cytogenet 23:32 1, 1986 15. Nakamine H, Masih AS, Sanger WC, Wickert RS, Mitchell DW, Armitage JO, Weisenburger D D Richter’s syndrome with different immunoglobulin light chain types. Molecular and cytogenetic features indicate a common clonal origin. Am J Clin Pathol 97:656, 1992 16. Splinter TAW, Bom-van Noorloos A, van Heerde P CLL and diffuse histiocytic lymphoma in onepatient. Clonal proliferation of two different B cells. Scand J Haematol20:29, 1978 17. van Dongen JJM, Hooijkaas H, Michiels JJ, Grosveld G, de Klein A, van der Kwast, Prinns MEF, Abels J, Hagemeier A: Richter’s syndrome with different immunoglobulin light chain and different heavy chain generearrangements. Blood 6457 1, 1984 18. McDonnell JM, Beschorner WE, Staal SP, Spivak JL, Mann RB: Richter’s syndrome with two different B-cell clones. Cancer 58: 2031, 1986 19. Triimper L, Matthaei-Maurer DU,Knauf W, Moller P: Centroblastic lymphoma of the thyroid supervening long-lasting chronic lymphocytic leukaemia (B-cell). Demonstration of biclonality by immunohistochemical and gene rearrangement analysis. Klin Wochenschr 66:736,1988 20. Ostrowski M, Minden M, Wang C, Bailey D Immunophenotypic and gene probe analysis of a case of Richter’s syndrome. Am JClin Pathol91:215, 1989 21. Medeiros U,Stetler-Stevenson MA: Composite B-cell and T-cell lymphoma. Coincidental occurrence or related neoplasms? Am J Clin Pathol98:387, 1992 22. Foon KA, Thiruvengadam R, Saven A, Bernstein ZP, Gale RP: Genetic relatedness of lymphoid malignancies. Transformation of chronic lymphocytic leukemia as a model. Ann Intern Med I19:63, 1993 23. Cleary ML, Galili N, Trela M, Levy R, Sklar J: Single cell origin of bigenotypic and biphenotypic B cell proliferations in human follicular lymphomas. J Exp Med 167582, 1988 24. Zelenetz AD, Chen TT, Levy R Histologic transformation of follicular lymphoma todiffuse lymphoma represents tumor progression by a single malignant B cell. J Exp Med 173:197, 199 1 25. Raghoebier S, van Krieken JHJM, Kluin-NelemansJC, Gillis A, van Ommen GJB, GrinsbergAM, Raffeld M, Kluin PhM: Oncogene rearrangements in chronic B-cell leukemia. Blood 77: 1560, 1991 26. Rechavi G, Katzir N, Brok-Simoni F, Holtzman F, Mandel M, Curlinkel N, Givol D,Ben-Bassat I, Ramot B: A search for bcl l, bcl2, and c-myc oncogene rearrangement in chronic lymphocytic leukemia. Leukemia 357, 1989 27. Torelli UL, Torelli GM, Emilia G, Selleri L, Venturelli D, Artusi T, Donelli A, Col0 A, Fornieri C: Simultaneously increased expression ofthe c-myc and p chain genes in the acute blastic transformation of a chronic lymphocytic leukaemia.Br J Haematol 65: 165,1987 28. Ginsberg AM, Raffeld M, Cossman J: Inactivation ofthe retinoblastoma gene in human lymphoid neoplasms. Blood 77:833, 1991

1371

29. Gaidano G,Ballerini P, Gong JZ,Inghirami G, Neri A, Newcomb EW, Magrath IT, Knowles DM, Dalla-Favera R p53 mutations in human lymphoid malignancies: Association with Burkitt lymphoma and chronic lymphocytic leukaemia. Proc Natl Acad Sci USA 885413,1991 30. Ichikawa A, Hotta T, Takagi N, Tsushita K, Kinoshita T, Nagai H, MurakamiY, Hayashi K, SaitoH: Mutations of p53gene and their relationto disease progression in B-cell lymphoma. Blood 79:2701, 1992 3 I . Inghirami G, Zhu BY, Chess L, Knowles DM: Flow cytometric and immunohistochemical characterization of the y/6 Tlymphocyte population in normal human lymphoid tissue and peripheral blood. Am J Pathol 136:357, 1990 32. Miller SA, Dykes DD, Polesky H F A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic AcidRes 16:1215, 1988 33. Southern EM: Detection of specific sequences among DNA fragments separated by gelelectrophoresis. J Mol Biol91:503, 1975 34. Knowles DM, Neri A, Pelicci PG, Burke JS, Wu A, Winberg CD, Sheibani K, Dalla-Favera R: Immunoglobulin and T-cell receptor &chain gene rearrangement analysis of Hodgkin’s disease: Implications for lineage determination and differential diagnosis. Proc Natl Acad Sci USA 83:7942, 1986 35. Korsmeyer SJ, Hieter PA, Ravetch JV, Poplack QG, Waldmann TA, Leder P Developmental hierarchy of immunoglobulin gene rearrangements in human leukemic pre-B-cells. ProcNatl Acad Sci USA 78:7096, 198 1 36. Siminovitch KA, Bakhshi A, Goldman P, Korsmeyer SJ: A uniform deleting element mediates the loss of K genes in human B cells. Nature 3 16:260, 1985 37. Taub RA, Hollis GF, Hieter PA, Korsmeyer S, Waldmann TA, Leder P: Variable amplification of immunoglobulin X lightchain genes in human populations. Nature 304: 172, 1983 38. Yanagi Y, Yoshikai Y, Leggett K, Clark SP, Aleksander I, Mak TW: A human T cell-specific cDNA clone encodesa protein havingextensive homology to immunoglobulin chains. Nature308: 145,1984 39. Pelicci P-G, Knowles DM, Magrath I, Dalla-Favera R: Chromosomal breakpoints and structural alterations of thec-myc locus differ in endemic and sporadic forms of Burkitt lymphoma. Proc Natl Acad Sci USA 83:2984, 1986 40. Williams ME, Meeker TC, Swerdlow SH: Rearrangement of the chromosome I I bcl- I locus in centrocytic lymphoma: Analysis with multiple breakpoint probes. Blood 78:493, 1991 4 1. Cleary ML, Sklar J: Nucleotide sequenceof a t( 14; 18) chromosomal breakpoint in follicular lymphoma anddemonstration of a breakpoint-cluster region near a transcriptionally active locus on chromosome 18. Proc Natl Acad Sci USA 82:7439, 1985 42. Cleary ML, Galili N, Sklar J: Detection of a second t( 14; 18) breakpoint cluster region in human follicular lymphomas. J Exp Med 164:315, 1986 43. Ballerini P, Gaidano G, Gong JZ, Tassi V, Saglio G, Knowles DM, Dalla-Favera R: Multiple genetic lesions in acquired immunodeficiency syndrome-related non-Hodgkin’s lymphoma. Blood 81:166, 1993 44. Weiss LM, Srickler JG, Warnke RA, Purtilo DT, Sklar J: Epstein-Barr viral DNA in tissues of Hodgkin’s disease. Am J Patho1 129:86, 1987 45. Nakamura Y, Ballard L, Leppert M, OConnell P, Lathrop GM, Lalouel JM, White R: Isolation and mapping ofa polymorphic DNA sequence (pYNZ22)on chromosome 17p [D17S30]. Nucleic AcidsRes 165707, 1988 46. Kondoleon S, Vising H, Luo XY, Magenis RE, Kellogg J, Litt M: A hypervariable RFLP on chromosome 1 7 ~ 1 is 3 defined

1372

by an arbitrary single copy probe p144-D6 (HGM9 No. 0173341. Nucleic Acids Res 15: 10605, 1987 47. Kevin J,Trainor KJ, Brisco MJ, Story CJ, Morley AA. Monoclonality in B-lymphoproliferative disorders detected at the DNA level. Blood 75:2220, 1990 48. Orita M, Suzuki Y, Sekiya T, Hayashi K: Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics 5:874, 1989 49. Maniatis T, Fritsch EF, Sambrook J: Molecular Cloning. A Laboratory Manual. Cold Spring Harbor, NY, Cold Spring Harbor Laboratory, 1982 50. Kabat EA, Wu TT, Reid-Miller M, Perry HM, Gottsman KS: Sequences of proteins of immunological interest. US Public Health Service, Bethesda, MD 5 1. Buchman VL, Chumakov PM, Ninkina NN, Samarina OP, Georgiev G P A variation in the structure of the protein-coding region ofthe human p53 gene. Gene 70:245, 1988 52. Levy R, Warnke R, Dorfman RF, Haimovich J: The monoclonality ofhuman B-cell lymphomas. J Exp Med 145:1014, 1977 53. Sklar J, Cleary ML, Thielemans K, Gralow J, Warnke R, Levy R: Biclonal B-cell lymphoma. N Engl J Med 3 1 1:20, 1983 54. Inghirami G, Szabolcs M, Yee HT, Corradini P, Cesarman E, Knowles DM: Detection of immunoglobulin gene rearrangement of B cell non-Hodgkin’s lymphomas and leukemias in fresh, unfixed and formalin-fixed, paraffin-embedded tissue by polymerase chain reaction. Lab Invest 68:746, 1993 55. Raab-Traub N, Flynn K: The structure of the termini of the Epstein-Barr virus as a marker of clonal cellular proliferation. Cell 47983, 1986 56. Harousseau JL, Flandrin G, Tricot G, Brouet JC, Seligmann M, Bernard J: Malignant lymphoma supervening in chronic lymphocytic leukemia and related disorders. Richter’s syndrome: A study of 25 cases. Cancer 48: 1302, 198 1 57. Cherepakhin V, Baird SM, Meisenholder GW, Kipps TJ: The clonal relationship between CLL and thesecondary lymphoma in Richter’s syndrome. Blood 80:48a, 1992 (suppl, abstr) 58. Zelenetz AD, Chen TT, Levy R: Clonal expansion in follicular lymphoma occurs subsequent to antigenic selection. J Exp Med 176:1 137, I992 59. Kurosawa Y, Tonegawa S: Organization, structure, and assembly of immunoglobulin heavy chain diversity DNA segments. J ExpMed 155:201, 1982 60. French DL, Laskov R, Scharff MD: The role of somatic hypermutation in the generation of antibody diversity. Science 244: 1152, 1989 6 I . Meeker TH, Grimaldi JC, ORourke R, Loeb J, Juliusson G, Einhorn S: Lack of detectable somatic hypermutation in the V region of the Ig H chain gene of a human chronic B lymphocytic leukemia. J Immunol 141:3994, 1988 62. Levy R, Levy S, Cleary ML, Carroll W, Kon S, Bird J, Sklar J: Somatic mutation in human B-cell tumors. Immunol Rev 96:43, 1987 63. Cleary ML, Meeker TC, Levy S, Lee E, Trela M, Sklar J,

MATOLCSY, INGHIRAMI,ANDKNOWLES

Levy R Clustering of extensive somatic mutations in the variable region of an immunoglobulin heavy chain gene from a human B cell lymphoma. Cell 44:97, 1986 64. Cai J, Humphries C, Richardson A, Tucker PW: Extensive and selective mutation of a rearranged VH5 gene in human B cell chronic lymphocyticleukemia. J Exp Med 176: 1073,1992 65. Ince C, Blick M, Lee M, Pathak S, Vadhan-Raj S, Selvanayagam P, Gutterman JU,Cabanillas F: Bcl-l gene rearrangements in B cell lymphoma. Leukemia 2:343, 1988 66. Tsujimoto Y, Cossman J, Jaffe E, Croce CM: Involvement ofthe bcl-2 gene in human follicular lymphoma. Science 228: 1440, 1985 67. Dalla-Favera R, Bregni M, Erikson J, Patterson D, Gallo RC, Croce CM: Human c-myc onc gene is located on the region of chromosome 8 that is translocated in Burkitt lymphoma cells. Proc Natl Acad Sci USA 79:7824, 1982 68. Athan E, Foitl DR, Knowles MD: Bcl- I rearrangement: Frequency and clinical significance among B-cell chronic lymphocytic leukemias and non-Hodgkin’s lymphomas. Am J Pathol 138:59 I , 1991 69. Aisenberg AC, Wilkes BM, Jacobson JO: The bcl-2 gene is rearranged in many diffuse B-cell lymphomas. Blood 7 1:969, 1988 70. De Jong D, Voetdijk BMH, Beverstock GC, Van Ommen GJB, Willemze R, Kluin PM: Activation of thec-myc oncogene in a precursor-B-cell blast crisis of follicular lymphoma, presenting as composite lymphoma. N Engl J Med 3 18:1373, 1988 7 I . Benedict WF, Xu H-J, Hu S-X, Hu S-X, Takahashi R Role of the retinoblastoma gene in the initiation and progression of human cancer. J Clin Invest 85:988, 1990 72. Scrable HJ, Sapienza C, Cavenee W K Genetic and epigenetic losses of heterozygosity in cancer predisposition and progression. Adv Cancer Res 54:25, 1990 73. Juliusson G, Oscier D C , Fitchett M, Ross FM, Stockdill G, Mackie MJ, ParkerAC, Castoldi CL, CuneoA, Knuutila S, Elonen E, Gahrton G: Prognostic subgroups in B-cell chronic lymphocytic leukemia defined by specific chromosomal abnormalities. N Engl J Med 323:720, 1990 74. Oscier D, Kruger A, Sadullah S, Chapman R, Hodges E, to investigate clonHamblin T: Use of a retinoblastoma gene probe ality in Richter’s syndrome. Blood 80:473a, 1992 (abstr, suppl) 75. Stilgenbauer S, Dohner H, Bulgay-Morschel M, Weitz S, Bentz M, Lichter P: High frequency of monoallelic retinoblastoma gene deletion in B-cell chronic lymphoid leukemia shown by interphase cytogenetics. Blood 8 I :2 1 18, I993 76. Finlay CA, Hinds PW, Levine AJ: The p53 proto-oncogene can act asa suppressor oftransformation. Cell 57: 1083, 1989 77. Eliyahu D, Michalovitz D, Eliyahu S, Pinhasi-Kimhi 0, Oren M: Wild-type p53 can inhibit oncogene-mediated focus formation. Proc NatlAcad Sci USA 86:8763, 1989 78. Nigro JM, Baker S J , Preisinger AC, Jessup JM, Hostetter R, Cleary K, Bigner SH, Davidson N, Baylin S, Devilee P, Glover T, Collins FS, Weston A, Modali R, Hams CC, Vogelstein B: Mutations in the p53 gene occur in diverse human tumor types. Nature 342:105, 1989