Chronic lymphocytic leukemia B cells are highly sensitive to ... - Nature

Gene Therapy (2000) 7, 1210–1216  2000 Macmillan Publishers Ltd All rights reserved 0969-7128/00 $15.00 www.nature.com/gt

VIRAL TRANSFER TECHNOLOGY

RESEARCH ARTICLE

Chronic lymphocytic leukemia B cells are highly sensitive to infection by herpes simplex virus-1 via herpesvirus-entry-mediator A DJ Eling1, PA Johnson2, S Sharma1, F Tufaro2 and TJ Kipps1 1

Division of Hematology/Oncology, Department of Medicine, UCSD School of Medicine, La Jolla, CA; and 2NeuroVir Therapeutics Inc., Vancouver, BC, Canada

We found that chronic lymphocytic leukemic (CLL) B cells are highly sensitive to infection with vectors derived from replication-defective herpes simplex virus-1 (rdHSV-1). CLL B cells were found to express high levels of herpes virus entry mediator (Hve) A, but not HveC, the other known receptor for HSV-1. An HveA cDNA from CLL cells was found to encode Arg→Lys and Val→Iso substitutions at amino acids 17 and 241, respectively. Nevertheless, this cDNA encoded a functional receptor for HSV-1 when transfected into Chinese hamster ovarian (CHO) cells. Antibodies to HveA could block rdHSV-1 infection of CLL cells and HveA-transfected CHO cells with similar efficiencies in vitro.

In contrast to B cells of normal donors, CLL B cells were resistant to the cytopathic effects of infection by rdHSV-1 and maintained high-level expression of the transgene for several days in vitro. We propose that this is due to the expression by CLL cells of the anti-apoptotic protein, bcl-2. Consistent with this, we found that transduction of HeLa cells with a retrovirus expression vector encoding bcl-2 rendered HeLa cells resistant to the cytopathic effects of rdHSV-1. HSV-1-derived vectors should be excellent vehicles for gene transfer into CLL B cells, allowing for its potential use in gene therapy for this disease. Gene Therapy (2000) 7, 1210– 1216.

Keywords: HveA (HVEM/TR2); herpes viral entry mediator; HSV; herpes simplex virus; CLL; chronic lymphocytic leukemia

Introduction B cell chronic lymphocytic leukemia (CLL) is the most common adult leukemia in Western societies. At present there is no cure, mandating improved treatment modalities.1 Vectors that can mediate gene transfer will allow for development of new therapeutic strategies.2 Adenovirus vectors can be used to transfer genes into CLL B cells.3 However, because CLL B cells lack the fiber receptor necessary for adenovirus attachment, infection of CLL B cells with adenovirus vectors is not efficient and requires high numbers of viral particles per cell. Nevertheless, the ability of adenovirus vectors to transfer genes into CLL B cells has allowed for clinical trials in gene therapy.4 Development of more efficient vectors for transgene expression in CLL B cells could facilitate efforts to develop gene therapy for this disease. Herpes simplex virus-type I (HSV-1) is an excellent candidate for use as a vector for gene transfer into CLL B cells. HSV-1 has a broad host range and can infect resting post-mitotic cells. HSV-1 infection is mediated by envelope glycoproteins B and/or C binding to glycosaminoglycan chains of cell surface proteoglycans,5–7 followed by entry via the herpes virus entry mediators (Hve), HveA or HveC.8–12 HveA, otherwise called HVEM,13 Correspondence: TJ Kipps, University of California San Diego, Department of Medicine, Division of Hematology/Oncology, 9500 Gilman Drive, La Jolla, CA 92093-0663, USA Received 25 September 1999; accepted 26 April 2000

TR2,14 or ATAR,15 is a type I transmembrane protein that is a member of the tumor necrosis factor receptor superfamily. The HSV-1 glycoprotein D has been shown to bind directly to HveA and HveC cell surface receptors.10,16 In this study we examined the relative susceptibility of CLL B cells to transduction using vectors derived from HSV-1. For these studies we used a replication-defective HSV-1 expression vector, Cgal⌬3, that encodes lacZ.17,18 This allowed us to monitor for infection and expression of the lacZ transgene by examining infected cells for their expression of ␤-galactosidase (␤-gal) by flow cytometry.

Results CLL B cells (CLL cells) were infected with Cgal⌬3 at various multiplicity of infection (MOI) ratios and the levels of ␤-gal activity were assessed 24 h later via flow cytometry. We found that the proportion of CLL cells having detectable ␤-gal activity increased with increasing amounts of virus vector. Infection of CLL cells with Cgal⌬3 at an MOI of 0.1 resulted in a transduced cell population of which greater than 25% expressed highlevels of the lacZ transgene (mean 25% ± 12.1% s.d., n = 6) (Figures 1 and 2). We compared relative sensitivity to infection of CLL cells with that of HeLa cells or Vero cells. We found that HeLa cells or Vero cells required approximately 10-fold greater amounts of Cgal⌬3 than that required by CLL cells to express the lacZ transgene (Figure 2). In addition,

Infection of CLL cells by HSV-1 via HveA DJ Eling et al

1211

Figure 1 Cgal⌬3 infection of CLL cells. CLL cells were infected with the replication-defective HSV-1 Cgal⌬3 for 1 h using MOI ratios of 0.1 (shaded), 0.3 (hatched), and 1.0 (cross-hatched). CLL cells were then washed and cultured for 48 h and analyzed for expression of ␤-gal enzymatic activity via flow cytometry. The x-axis denotes fluorescence intensity of ␤-gal staining. The open histogram depicts the fluorescence intensity of non-infected cells.

Figure 2 Cgal⌬3 infection of CLL cells and HeLa cells. CLL cells (n = 6), HeLa cells (n = 2) and Vero cells (n = 2) were infected with the replication-defective HSV-1 Cgal⌬3 for 1 h using MOI ratios of 0.1, 1.0 and 10.0, as indicated. The cells were then washed and cultured for 48 h and analyzed for expression of ␤-gal enzymatic activity via flow cytometry. Graph depicts the average percentage of cells positive for ␤-gal expression at various MOI ratios as measured by flow cytometry analysis. Error bars indicate the standard deviation.

the relative levels of ␤-gal expressed in HeLa cells after transduction with saturating amounts of Cgal⌬3 was significantly lower than that achieved in CLL cells (data not shown). Transduction of normal non-neoplastic B cells also resulted in levels of ␤-gal expression similar to that of CLL B cells (data not shown). As such, the high sensitivity to infection by HSV-1 is not a property unique to transformed B cells. We examined CLL cells for expression of HveA or HveC. These cell surface proteins can function as receptors that facilitate HSV-1 virus entry into cells. Using HveA primer sequences we were able to amplify HveA from cDNA generated from CLL cells. In contrast, oligonucleotide primers specific for HveC failed to generate a PCR product from cDNA made from CLL cells (data not

Figure 3 Surface expression of HveA on CLL cells. Freshly isolated CLL cells were treated with either pre-immune rabbit serum or polyclonal antiHveA followed by a FITC-conjugated goat anti-rabbit IgG. The x-axis denotes fluorescence intensity of HveA surface expression.

shown). These same oligonucleotide primers, however, were able to generate a HveC PCR product from the cDNA generated from HeLa (data not shown). Using antisera specific for human HveA and flow cytometry, we observed relatively high levels of HveA expression on CLL cells (Figure 3). The average mean fluorescence intensity ratio (MFIR) for HveA on CLL cells was 2.9 (± 0.8 s.d., n = 11). The MFIR is the mean fluorescence intensity (MFI) of cells stained with anti-HveA antisera and fluorescein-labeled anti-rabbit Ig divided by the MFI of cells stained with pre-immune sera and fluorescein-labeled anti-rabbit Ig. The relative levels of HveA expressed on HeLa cells (1.39 ± 0.04 s.d., n = 3) or Vero cells (MFIR 1.1 ± 0.1 s.d., n = 3) were significantly less than that noted on CLL B cells (P ⬍ 0.01, Student’s t test). Comparison of the primary sequence of the HveA cDNA cloned from CLL B cells with that of the published HveA sequence revealed two non-conservative substitutions. One resulted in an arginine to lysine substitution at position 17, and the other generated a valine to isoleucine substitution at amino acid 241.13 Nevertheless, Chinese hamster ovarian (CHO) cells transfected with CLL-derived HveA cDNA (CHO-HveA) were sensitive to infection with HSV-1, in contrast to nontransfected CHO cells (Figure 4). To test whether Cgal⌬3 infection of CLL or CHO-HveA cells was dependent upon HveA, we incubated these cells with increasing amounts of anti-HveA antisera before the addition of Cgal⌬3. Infection of both CLL cells and CHO-HveA cells was inhibited in a dose-dependent manner (Figure 5a and b). In contrast, such antisera could not inhibit HSV-1 infection of HeLa or Vero cells, even at the lowest serum dilution (data not shown). Similarly, pretreatment of CLL cells with pre-immune rabbit serum had no effect upon the infection efficiency of Cgal⌬3 (Figure 5). Cgal⌬3 infection of CLL cells from any one of eight different patients resulted in high levels of ␤-gal expression over time. Cgal⌬3 infection of CLL cells resulted in detectable expression of ␤-gal as early as 4 h after infection at an MOI of 1. The level of ␤-gal expression continued to rise, reaching a maximum at 48– 72 h following the addition of the virus. Surprisingly, Gene Therapy


1212

Figure 4 HveA is required for infection of CHO cells by Cgal⌬3. CHO cells transfected with either pcDNA3 or pcDNA3 encoding HveA (pcCLLHveA) were cultured for 2 h with increasing MOI ratios of Cgal⌬3. The cells were then washed and cultured for 48 h and analyzed for expression of ␤-gal enzymatic activity via flow cytometry.

Figure 6 Expression of ␤-gal activity by Cgal⌬3-infected CLL cells. CLL cells were infected at a MOI ratio of 1 and incubated for the indicated times before flow cytometric analysis for ␤-gal enzymatic activity. Graph depicts the percentage of cells positive for ␤-gal and the relative ␤-gal expression levels (MFIR).

Figure 7 Viability of normal B cells and CLL cells following infection with Cgal⌬3. CLL cells (n = 6) or normal B cells (n = 2) alone or infected with Cgal⌬3 at a MOI ratio of 1. The cell viability was determined by staining the cells with propidium iodide before flow cytometric analysis at the times indicated. Error bars indicate the standard deviations. Figure 5 Inhibition of Cgal⌬3 infection by anti-HveA antisera. CLL cells (a) and CHO cells transfected with pcCLL-HveA (b) were incubated for 1 h with the indicated concentrations of either pre-immune rabbit serum or rabbit anti-HveA serum before Cgal⌬3 infection. A MOI ratio of 1 was used for CLL infection and a MOI ratio of 10 was used for CHO cells. The percentage of cells positive for ␤-gal enzymatic activity was determined by flow cytometry analysis 48 h after infection.

expression of ␤-gal in Cgal⌬3-infected CLL cells could be detected for at least 9 days after infection (Figure 6, and data not shown). Moreover, we did not observe any reduction in the viability of infected CLL cells relative to that of control non-infected CLL cells (Figure 7). This contrasts with the known cytopathic effects of replication-defective HSV-1 vectors, such as Cgal⌬3.17 TypiGene Therapy

cally, infection of cells with Cgal⌬3 induces apoptosis of normal cells, including CHO-HveA or HeLa cells within 48 h after infection (data not shown, and Table 1). The viability of normal B cells decreased 48 h after infection with Cgal⌬3, resulting in more than 90% cell death by 5 days (Figure 7). However, we did not observe any decrease in viability of Cgal⌬3-infected CLL cells over that of mock-infected CLL cells of any patient (n = 8), for as long as 9 days after infection, at which point the experiment was stopped (Figure 7). The resistance of CLL cells to the cytopathic effects of HSV-1 may be due to the noted high-level expression of bcl-2 by CLL cells.19–21 We performed limiting dilution analyses to study the effect of bcl-2 on the cloning efficiency of Cgal⌬3-infected


1213

Table 1 Cloning efficiency of Cgal⌬3-infected cells relative to that of non-infected cells Average No. of cells plated per well

50 20 10 1.0 0.1 0.01

Experiment 1 HeLa-neo

Experiment 2 HeLa-bcl-2

HeLa-neo

HeLa-bcl-2

No Cgal⌬3

Cgal⌬3

No Cgal⌬3

Cgal⌬3

No Cgal⌬3

Cgal⌬3

No Cgal⌬3

Cgal⌬3

100 100 100 80 (1.6) 20 (0.2) 0

100 40 (0.5) 20 (0.2) 0 0 0

100 100 100 80 (1.6) 20 (0.2) 0

100 98 (3.9) 91 (2.4) 72 (1.3) 9 (0.1) 0

100 100 100 73 (1.3) 13 (0.1) 0

100 94 (2.8) 33 (0.4) 10 (0.1) 0 0

100 100 100 83 (1.8) 19 (0.2) 0

100 97 (3.5) 83 (1.8) 68 (1.5) 5 (0.1) 0

Data from two separate experiments are provided. Columns labeled ‘HeLa-neo’ provide the data obtained using HeLa cells transduced with MoMLV-neo, whereas the columns labeled ‘HeLa-bcl-2’ provide the data obtained using HeLa cells transduced with MoMLV-bcl-2. The far left column provides the average number of cells per well that were plated at the start of each experiment. With the exception of this column, the numbers in each column represent the proportion of seeded culture wells that developed viable cell colonies. The numbers in parentheses indicate the average numbers of viable cells per well calculated, using the Poisson distribution, m = −ln(x) (where m is the calculated average number of colony-forming cells per well plated and x is the proportion of seeded wells that did not develop cell colonies).

HeLa cells relative to that of non-infected HeLa cells. HeLa cells were transduced with a control retrovirus vector (MoMLV-neo) or a retrovirus vector encoding bcl-2 (MoMLV-bcl-2) selected for transduced clones in media containing G418. HeLa cells transduced with MoMLVneo (HeLa-neo) or MoMLV-bcl-2 (HeLa-bcl-2) were infected with Cgal⌬3 at an MOI ratio of 10 and uniformly found to express ␤-gal by flow cytometry (data not shown). Infected cells or non-infected cells were plated in triplicate on 96-well plates at defined numbers of cells per well to examine the relative cloning efficiency of each cell population. Five days after seeding the plates, culture wells with growing colonies were scored. Cgal⌬3infected HeLa-neo cells had a relative cloning efficiency of only 4 ± 1.4% compared with non-infected cells, as assessed using Poisson distribution (Table 1). However, Cgal⌬3-infected HeLa- bcl-2 cells had a relative cloning efficiency of 82.3 ± 1% compared with that of noninfected HeLa-bcl-2 cells (Table 1). We conclude that expression of bcl-2 can protect HeLa cells from the cytopathic effect of Cgal⌬3 and allow for the generation of daughter cells after infection.

Discussion We found that CLL B cells are highly sensitive to transduction by HSV-1 vectors. In some cases, all the leukemia cells in a given population could be made to express a transgene at MOI ratios of less than 0.3 (Figure 1). Moreover, in all cases, nearly all of the CLL cells could be made to express an HSV-1-encoded transgene at an MOI ratio of 1 (data not shown). The MOI ratio is determined by testing each rdHSV-1 preparation for its ability to develop plaques on E5, which are Vero cells that can complement the genetic defects in the rdHSV-1. Because MOI ratios of less than 1 could infect virtually all leukemia cells, CLL cells appeared more permissive to infection with rdHSV-1 than E5, HeLa, or Vero cells (Figure 2). Consistent with this, we noted that proportions of CLL cells that expressed the transgene were significantly greater than that of HeLa cells at any given MOI ratio (Figure 2). In contrast, the relative sensitivity for infection of CLL cells for adenovirus vectors is significantly less than that noted for HeLa or 293 cells, the cells used to

propagate adenovirus vectors in vitro.3 As such, HSV-1derived vectors are relatively efficient vehicles for effecting gene transfer into CLL cells. The high efficiency transduction achieved with rdHSV1 in CLL may be similar to that noted for vectors derived from HSV-2 on hematopoietic cells.22 A high proportion of CD34+ marrow cells and acute leukemia cells could be made to express a transgene at MOI ratios of less than 1. Again, because such viruses are propagated on modified Vero cells this reflects the high relative sensitivity of hematopoietic cells for infection by HSV-2 relative to other cell types. Similarly, we noted that normal B cells, T cells, precursor B cell lines, and acute lymphocytic leukemia cells were also highly sensitive to infection with vectors derived from HSV-1 (data not shown). Collectively, these data indicate that HSV in general has the potential for making excellent vectors for gene transfer into hematopoietic cells and leukemias. Despite belonging to the same family, HSV-1 and HSV2 use different receptors to mediate cell entry. Whereas HveB (Prr2) appears to serve as a predominant receptor for HSV-2 type virus,11 HSV-1 uses HveA (otherwise called HVEM, TR2 or ATAR) or HveC.9,23,24 In many cell types, HveC appears to be the prominent receptor for HSV-1. However, we found CLL cells express high levels of HveA (Figure 3), but negligible amounts of HveC, as assessed by RT-PCR (data not shown). The HveA cDNA isolated from CLL cells was found to have two non-conservative base substitutions from that of the known HveA. Conceivably, such changes reflect a genetic polymorphism in HveA, as has been noted for HveA by other investigators.25 In any case, one base change resulted in an arginine to lysine substitution at amino acid position 17 within the leader polypeptide, while the other resulted in a valine to isoleucine change at position 241 in the cytoplasmic domain. The change in the leader polypeptide did not affect surface expression of HveA and change in the cytoplasmic domain should not affect the relative binding activity of HveA for HSV-1. Consistent with this, transfection of CHO cells with CLL-derived HveA rendered these cells highly sensitive to infection by HSV-1. That HveA served as the predominant, if not sole, Gene Therapy


1214

receptor for HSV-1 in CLL is indicated by our blocking studies, in which infection could be inhibited completely by anti-HveA antisera. Moreover, the efficiency at which such antisera inhibited HSV-1 infection of CLL cells was similar to that at which they inhibited infection of CHO cells transfected with CLL-derived HveA cDNA (Figure 5). In contrast, such antibodies could not inhibit HSV-1 infection of Vero cells (data not shown). We conclude that expression of HveA is both necessary and sufficient for the high sensitivity of CLL cells to infection with HSV-1. These observations have implications for the biology of HSV-1 infection in patients with CLL. Patients with this disease can develop painful lymphadenitis secondary to infection with HSV-1, even in the absence of mucocutaneous herpetic lesions.26 In view of the current study, it is conceivable that this condition results from the direct infection of CLL cells by HSV-1. On the other hand, antibodies that block the interaction between HSV-1 and HveA may inhibit the de novo infection of CLL cells. The development of such antibodies could mitigate the ability of HSV-1, or HSV-1-derived vectors, to infect CLL cells, or to effect gene transfer into such cells in vivo. Once infected, however, CLL cells appear resistant to the cytopathic effects of rdHSV-1. The rdHSV-1 vector used in these studies, Cgal⌬3, expresses four immediate– early genes and is cytotoxic to most cell types, including HeLa cells (Table 1). 17 Moreover, infection of normal lymphocytes with Cgal⌬3 results in transient high-level transgene expression and then apoptosis within 48–96 h after infection (Figure 7 and data not shown). CLL cells infected with Cgal⌬3, on the other hand, appear resistant to this cytopathic effect and have a viability at 96 h after infection that is not significantly different from that of non-infected CLL cells in vitro (Figure 7). This feature allows the infected CLL cells to express high levels of transgene with little or no relative reduction in viability (Figure 6). The resistance of these leukemia cells to the cytopathic effect of Cgal⌬3 is probably due to the noted high-level expression of bcl-2 by the CLL B cells.19,27,28 Bcl-2 has been shown by Wang and colleagues29 to suppress the cytotoxic effect of rdHSV-1 vectors in PC12 cells. However, it was not determined whether expression of bcl-2 by PC12 cells inhibited apoptosis induced by infection with rdHSV-1 or merely delayed the cytopathic effect, allowing for prolonged expression of the HSV-encoded transgene. We performed limiting dilution analyses to evaluate the relative cloning efficiencies of Cgal⌬3-infected HeLa cells transduced with a bcl-2 expression vector or a control vector. This minimized the possibility that surviving cells in long-term cultures were descendent from those that had escaped initial infection. We found that HeLa cells transduced to express bcl-2 had a cloning efficiency similar to that of non-infected HeLa cells. In contrast, HeLa cells that were not transduced to express bcl-2 had significantly lower cloning efficiency following infection with Cgal⌬3. We conclude from these studies that expression of bcl-2 is sufficient to allow for cells to survive and to generate daughter cells following infection with Cgal⌬3. In conclusion, we find that CLL cells are highly sensitive to infection with HSV-1 and that this is dependent upon expression of HveA. In addition, CLL cells are resistant to the cytopathic effect of Cgal⌬3, and that this

Gene Therapy

resistance most probably is due to the high level of bcl2 expressed by the leukemia cells. Because such rdHSV1-derived vectors can transfer genes so efficiently into CLL cells without inducing a cytopathic effect, Cgal⌬3 appears to be an excellent candidate vector for use in the gene therapy of this hematologic malignancy.

Materials and methods Antibodies and reagents Dr P Spear (University of Pennsylvania) provided the rabbit anti-HveA antiserum and pre-immune serum. Fluorescein-isothiocyanate (FITC)-conjugated goat antirabbit antibodies (Southern Biotechnology Associates, Birmingham, AL, USA) were used to stain cells previously incubated with the anti-HveA antiserum or preimmune rabbit serum before flow cytometry. Fluorochrome-labeled mAbs specific for human CD19 were purchase from PharMingen (San Diego, CA, USA). Cells and culture conditions After informed consent, blood was obtained from normal adult donors or from patients satisfying diagnostic criteria for B cell CLL.1 Mononuclear cells were isolated via density gradient centrifugation using Histopaque 1077 (Sigma Chemical, St Louis, MO, USA). B cells were isolated from the mononuclear cells of normal donors using Dynal beads (Dynal, Lake Success, NY, USA) coated with anti-CD19 mAbs. The cells were detached from the magnetic beads after positive selection using DETACHaBEAD (Dynal), as per the manufacturer’s instructions. Chinese hamster ovarian cells (CHO), HeLa, E5 and Vero cells were obtained from the American Type Culture Collection (ATCC, Rockville, MD, USA). E5 cells were used only for the propagation of Cgal⌬3 (see below). The cells were cultured at 37°C in 5% CO2 in air, in culture medium consisting of RPMI-1640 (BioWhittaker, Parkville, MD, USA), containing 10% fetal calf serum (Gibco BRL, Gaithersburg, MD, USA), 2 mm l-glutamine (Gibco), 100 U/ml penicillin (Gibco), and 100 ␮g/ml streptomycin (Gibco). Virus vectors Amphotropic Moloney murine leukemia (MoMLV) containing the gene coding for resistance to neomycin (MoMLV-neo) or the genes coding for neomycin resistance and bcl-2 (MoMLV-bcl-2), were obtained from the core laboratory of the UCSD Human Gene Therapy Program. Retroviral particles were produced from 293GP cells, as described.30 Cgal⌬3 is an ICP4-deletion mutant derived from D30EBA.18,31 It contains the Escherichia coli lacZ gene under the control of the human cytomegalovirus (CMV) promoter/enhancer within the short unique portion of the HSV-1 genome. Cgal⌬3 was propagated and assessed for its relative concentration of plaque-forming units (p.f.u.) on E5 cells, a cell line derived from Vero cells that had been transfected with HSV-1 ICP4.31,32 The MOI ratio provides the number of p.f.u. relative to the number of cells infected. RT-PCR and cloning of HveA The cDNA was generated from leukemia cells of a patient with CLL, as described.33 The oligonucleotides, corre-


sponding to the sense (dGTCTGGATCCGCCTGA GGCATGGAGCCTC) or antisense (dGTCTCTCGAG GTCAGTGGTTTGGGCTCCTC) strand flanking the known HveA coding region13 were synthesized by Integrated DNA Technologies (Coralville, IA, USA), for use in PCR, as described.33 The PCR product was isolated, digested with BamHI and XhoI (Gibco BRL), to digest flanking restriction sites, and then directionally cloned into pcDNA3 (Invitrogen, San Diego, CA, USA). HveC oligonucleotides, corresponding to the sense (dAGG CAGGCATCCCCCAGCACCA) or antisense (dCTCT CTCGAGCTACACGTACCACTCCTTCTT) strand of the known HveC coding region,12 were synthesized (Integrated DNA Technologies) and used for RT-PCR analysis.

Transfection and transduction CHO cells were transfected with CLL-derived HveA cDNA cloned into pCDNA3 (Invitrogen) via calcium phosphate precipitation to generate CHO-HveA, as described.34 HeLa cells were transduced with MoMLVneo or MoMLV-bcl-2, as described.30 After overnight culture, the transfected cells were selected in culture medium containing 400 ␮g/ml G418 (Geneticin; Gibco BRL). Nontransfected cells were selected in parallel to confirm their sensitivity to G418. Resistant cells were subcloned via limiting dilution in culture medium containing G418. For infection studies with Cgal⌬3, 105 cells per well were infected at various MOI in 1 ml of culture medium. After 1 h at 37°C, the cells were washed and then placed in culture medium or used directly for analyses. Similarly, HeLa-bcl-2 or HeLa-neo cells were infected with Cgal⌬3 at a MOI of 10 for 1 h, washed, and then plated at various cell concentrations into separate wells of 96well microtiter plates (Costar, Corning, NY, USA) for limiting dilution analyses. Aliquots of the infected cells were cultured for 24 h and then used to confirm expression of ␤-gal by flow cytometry. Flow cytometry To assess intracellular ␤-gal activity we used the ␤-gal fluorescent substrate fluorescein di-B-d-galactopyranoside (FDG) (Molecular Probes, Eugene, OR, USA). Expression of ␤-gal was determined using FDG and flow cytometric analysis, as described.35 In brief, the cells were washed in staining media (SM) consisting of RPMI-1640, 3% fetal calf serum, and 0.05% sodium azide. The cells were suspended in 100 ␮l SM and incubated for 10 min at 37°C before adding 100 ␮l of 2 mm FDG in triple-distilled H2O. After 1 min at 37°C, we added 2 ml of icecold SM containing 20 ng propidium iodide, which was then analyzed using a FACS-Calibur (Becton Dickinson, San Jose, CA, USA). To examine for expression of HveA, cells were incubated with normal goat serum before to the addition of the polyreactive anti-HveA antibodies to inhibit nonspecific binding. Subsequently, the cells were incubated in rabbit anti-HveA antiserum or pre-immune rabbit serum in SM. After 30 min at 4°C, cells were washed twice in SM and then stained with the FITC-conjugated goat antirabbit Ig. After 30 min at 4°C, cells were washed with SM containing propidium iodide and then analyzed. Dead cells and debris were detected by their characteristic forward- and side-light-scatter profiles and inability

to exclude propidium iodide. We calculated the mean fluorescence intensity ratio (MFIR) to compare the relative staining intensities of two or more stained cell populations. The MFIR is the mean fluorescence intensity (MFI) of cells stained with anti-HveA antiserum and FITC-anti-rabbit Ig divided by the MFI of cells stained with pre-immune rabbit antiserum and FITC-anti-rabbit Ig. For example, CHO cells that do not express HveA had an average MFIR of 1.0 ± 0.1 (s.d., n = 3 experiments), whereas CHO cells transfected with CLL-derived HveA cDNA had an average MFIR of 2.8 ± 0.4 (s.d., n = 3).

1215

Acknowledgements We greatly appreciate the anti-HveA polyreactive antibody provided to us by Patricia Spear. We also acknowledge Bill Wierda, Jan Burger, Astrid Sandoval and Patricia Diotto for their technical and writing assistance. This work was supported in part by National Institutes of Health grants R01CA66000–05 and R37CA49870–12.

References 1 Kipps TJ. Chronic lymphocytic leukemia and related diseases. In: Beutler E, Lichtman M, Coller B, Kipps TJ (eds). Williams Hematology, edn 5. McGraw-Hill: New York, 1995, pp 1017–1039. 2 Kipps TJ. Chronic lymphocytic leukemia. Curr Opin Hematol 1997; 4: 268–276. 3 Cantwell MJ et al. Adenovirus vector infection of chronic lymphocytic leukemia B cells. Blood 1996; 88: 4676–4683. 4 Kato K et al. Gene transfer of CD40-ligand induces autologous immune recognition of chronic lymphocytic leukemia B cells. J Clin Invest 1998; 101: 1133–1141. 5 Herold BC et al. Glycoprotein C-independent binding of herpes simplex virus to cells requires cell surface heparan sulphate and glycoprotein B. J Gen Virol 1994; 75: 1211–1222. 6 Tufaro F. Virus entry: two receptors are better than one. Trends Microbiol 1997; 5: 257–258; discussion 258–259. 7 Spear PG et al. Heparan sulfate glycosaminoglycans as primary cell surface receptors for herpes simplex virus. Adv Exp Med Biol 1992; 313: 341–353. 8 Eberle´ F et al. The human PRR2 gene, related to the human poliovirus receptor gene (PVR), is the true homolog of the murine MPH gene. Gene 1995; 159: 267–272. 9 Geraghty RJ et al. Entry of alphaherpesviruses mediated by poliovirus receptor-related protein 1 and poliovirus receptor. Science 1998; 280: 1618–1620. 10 Krummenacher C et al. Herpes simplex virus glycoprotein D can bind to poliovirus receptor-related protein 1 or herpesvirus entry mediator, two structurally unrelated mediators of virus entry. J Virol 1998; 72: 7064–7074. 11 Warner MS et al. A cell surface protein with herpesvirus entry activity (HveB) confers susceptibility to infection by mutants of herpes simplex virus type 1, herpes simplex virus type 2, and pseudorabies virus. Virology 1998; 246: 179–189. 12 Lopez M et al. Complementary DNA characterization and chromosomal localization of a human gene related to the poliovirus receptor-encoding gene. Gene 1995; 155: 261–265. 13 Montgomery RI et al. Herpes simplex virus-1 entry into cells mediated by a novel member of the TNF/NGF receptor family. Cell 1996; 87: 427–436. 14 Kwon BS et al. A newly identified member of the tumor necrosis factor receptor superfamily with a wide tissue distribution and involvement in lymphocyte activation. J Biol Chem 1997; 272: 14272–14276. 15 Hsu H et al. ATAR, a novel tumor necrosis factor receptor family member, signals through TRAF2 and TRAF5. J Biol Chem 1997; 272: 13471–13474. Gene Therapy


1216

16 Whitbeck JC et al. Glycoprotein D of herpes simplex virus (HSV) binds directly to HVEM, a member of the tumor necrosis factor receptor superfamily and a mediator of HSV entry. J Virol 1997; 71: 6083–6093. 17 Johnson PA et al. Cytotoxicity of a replication-defective mutant of herpes simplex virus type 1. J Virol 1992; 66: 2952–2965. 18 Paterson T, Everett RD. A prominent serine-rich region in Vmw175, the major transcriptional regulator protein of herpes simplex virus type 1, is not essential for virus growth in tissue culture. J Gen Virol 1990; 71: 1775–1783. 19 Hanada M et al. Bcl-2 gene hypomethylation and high-level expression in B-cell chronic lymphocytic leukemia. Blood 1993; 82: 1820–1828. 20 Molica S et al. Comparative flow cytometric evaluation of bcl-2 oncoprotein in CD5+ and CD5− B-cell lymphoid chronic leukemias. Haematologica 1997; 82: 555–559. 21 Molica S et al. Increased bcl-2/bax ratio in B-cell chronic lymphocytic leukemia is associated with a progressive pattern of disease. Haematologica 1998; 83: 1122–1124. 22 Dilloo D et al. A novel herpes vector for the high-efficiency transduction of normal and malignant human hematopoietic cells. Blood 1997; 89: 119–127. 23 Cocchi F et al. The V3 domain of the HIV-1 gp120 envelope glycoprotein is critical for chemokine-mediated blockade of infection. Nature Med 1996; 2: 1244–1247. 24 Cocchi F et al. The ectodomain of a novel member of the immunoglobulin subfamily related to the poliovirus receptor has the attributes of a bona fide receptor for herpes simplex virus types 1 and 2 in human cells. J Virol 1998; 72: 9992–10002. 25 Marsters SA et al. Herpesvirus entry mediator, a member of the tumor necrosis factor receptor (TNFR) family, interacts with

Gene Therapy

26 27

28

29

30

31 32

33 34

35

members of the TNFR-associated factor family and activates the transcription factors NF-kappaB and AP-1. J Biol Chem 1997; 272: 14029–14032. Higgins JP, Warnke RA. Herpes lymphadenitis in association with chronic lymphocytic leukemia. Cancer 1999; 86: 1210–1215. Pezzella F et al. Expression of the bcl-2 oncogene protein is not specific for the 14;18 chromosomal translocation. Am J Pathol 1990; 137: 225–232. Schena M et al. Growth- and differentiation-associated expression of bcl-2 in B-chronic lymphocytic leukemia cells. Blood 1992; 79: 2981–2989. Wang MJ, Friedmann T, Johnson PA. Differentiation of PC12 cells by infection with an HSV-1 vector expressing nerve growth factor. Gene Therapy 1995; 2: 323–335. Yee JK, Friedmann T, Burns JC. Generation of high-titer pseudotyped retroviral vectors with very broad host range. Meth Cell Biol 1994; 43: 99–112. Johnson PA et al. Cytotoxicity of a replication-defective mutant of herpes simplex virus type 1. J Virol 1992; 66: 2952–2965. DeLuca NA, Schaffer PA. Activities of herpes simplex virus type 1 (HSV-1) ICP4 genes specifying nonsense peptides. Nucleic Acids Res 1987; 15: 4491–4511. Rassenti LZ, Kipps TJ. Lack of allelic exclusion in B cell chronic lymphocytic leukemia. J Exp Med 1997; 185: 1435–1445. Chen CA, Okayama H. Calcium phosphate-mediated gene transfer: a highly efficient transfection system for stably transforming cells with plasmid DNA. Biotechniques 1988; 6: 632–638. Fiering SN et al. Improved FACS-Gal: flow cytometric analysis and sorting of viable eukaryotic cells expressing reporter gene constructs. Cytometry 1991; 12: 291–301.