Citron kinase controls a molecular network required for midbody formation in cytokinesis Zuni I. Bassia, Morgane Audusseaua, Maria Giovanna Riparbellib, Giuliano Callainib, and Pier Paolo D’Avinoa,1 a Department of Pathology, University of Cambridge, Cambridge CB2 1QP, United Kingdom; and bDepartment of Evolutionary Biology, University of Siena, 53100 Siena, Italy
Edited by R. Scott Hawley, Stowers Institute for Medical Research, Kansas City, MO, and approved April 30, 2013 (received for review January 22, 2013)
Cytokinesis partitions cytoplasmic and genomic materials at the end of cell division. Failure in this process causes polyploidy, which in turn can generate chromosomal instability, a hallmark of many cancers. Successful cytokinesis requires cooperative interaction between contractile ring and central spindle components, but how this cooperation is established is poorly understood. Here we show that Sticky (Sti), the Drosophila ortholog of the contractile ring component Citron kinase (CIT-K), interacts directly with two kinesins, Nebbish [the fly counterpart of human kinesin family member 14 (KIF14)] and Pavarotti [the Drosophila ortholog of human mitotic kinesin-like protein 1 (MKLP1)], and that in turn these kinesins interact with each other and with another central spindle protein, Fascetto [the fly ortholog of protein regulator of cytokinesis 1 (PRC1)]. Sti recruits Nebbish to the cleavage furrow, and both proteins are required for midbody formation and proper localization of Pavarotti and Fascetto. These functions require Sti kinase activity, indicating that Sti plays both structural and regulatory roles in midbody formation. Finally, we show that CIT-K’s role in midbody formation is conserved in human cells. Our findings indicate that CIT-K is likely to act at the top of the midbody-formation hierarchy by connecting and regulating a molecular network of contractile ring components and microtubule-associated proteins.
C
ytokinesis requires the coordinated action of many proteins that control sequential events. First, cells position the cleavage plane through signals generated by the spindle microtubules, which, during anaphase, reorganize into an array of antiparallel and interdigitating microtubules known as the central spindle. Central spindle and astral microtubules promote ingression of the cleavage furrow that bisects the dividing cell (1). Furrow ingression, driven by assembly and constriction of the actomyosin contractile ring, compacts the central spindle to form a structure known as the midbody (MB), which contains at its center an electron-dense structure, the MB ring or Flemming body, which is important for abscission. Cleavage furrow ingression and MB formation require cooperation between contractile ring and central spindle factors, but how this is established is poorly understood (2, 3). Some interactions between the components of these two structures have been described. The contractile ring component anillin associates with two central spindle proteins: the RhoGEF epithelial cell transforming sequence 2 (ECT2), responsible for RhoA activation at the cleavage site, and the RacGAP component of the centralspindlin complex (4–6), a key regulator of multiple events during cytokinesis, including furrowing, central spindle assembly, and MB formation and stability (7). However, anillin depletion does not affect localization of either protein to the central spindle midzone (4–6), suggesting that these interactions do not play a major structural role but, rather, establish a platform necessary to maximize the efficiency of signaling pathways required for cleavage furrow ingression (8). Another contractile ring component, the serine/threonine kinase Citron kinase (CIT-K), associates with the central spindle kinesin family member 14 (KIF14), and these two proteins depend on each other for proper localization during cytokinesis (9). This led to the proposal that KIF14 could direct CIT-K localization to the cleavage site at furrowing onset and that the two proteins could act together 9782–9787 | PNAS | June 11, 2013 | vol. 110 | no. 24
during cytokinesis, but the exact function of this interaction is still obscure. CIT-K was originally identified as a RhoA effector that could regulate myosin contractility by phosphorylating the myosin regulatory light chain (10, 11). However, CIT-K and its Drosophila ortholog, Sticky (Sti), are not required for furrowing (12–16), and evidence in both Drosophila and human cells has challenged the original model by showing that CIT-K is required for proper RhoA localization at the cleavage site during late cytokinesis, thus behaving more like a RhoA regulator than an effector (14, 17). Moreover, Sti is not required for myosin regulatory light chain phosphorylation and associates with actomyosin filaments to localize to the cleavage furrow (17). This indicates that CIT-K acts as an important regulator of late events during cytokinesis, but the molecular details are still missing. Here we show that Sti directly binds to two kinesins, Pavarotti [Pav, the Drosophila ortholog of human mitotic kinesin-like protein 1 (MKLP1), the other centralspindlin component] (18) and Nebbish (Neb, the fly counterpart of human KIF14) (19–21), which in turn interact with each other and with another central spindle component, Fascetto [Feo, the fly ortholog of protein regulator of cytokinesis 1 (PRC1)] (22). Furthermore, we show that Sti depletion affects MB formation and localization of Neb, Pav, and Feo, and that Sti kinase activity is necessary for these functions. We also found that Neb depletion phenocopied sti RNAi MB defects. Finally, we report that CIT-K performs similar roles in human cells. Our findings, together with those of previous studies (14, 17), indicate that Sti/CIT-K acts as a key regulator of MB formation in late cytokinesis through its association with a network made up of contractile ring components (anillin, actin, myosin, and RhoA) and at least three microtubule-associated proteins (MAPs; Neb, Pav, and Feo) necessary for central spindle organization. Results N-Terminal Region of the Sti Coiled-Coil Domain Interacts with the Kinesins Pav and Neb. We previously identified a region in the Sti
coiled-coil domain, dubbed “StiCC1,” which unexpectedly localized to the central spindle midzone (Fig. 1A and see Fig. S2) (17). This localization differs from that of endogenous Sti, which instead accumulates at the cleavage furrow (12, 17). As StiCC1 is not necessary for Sti localization to the cleavage furrow (17), we reasoned that StiCC1 localization to the midzone might reflect an interaction with one or more MAPs. To identify these MAPs, we tagged both StiCC1 and full-length Sti (StiFL) with two IgG binding motifs of protein A (PtA) and isolated proteins that interact with these two baits by affinity purification coupled with mass spectrometry (23). This approach led to the identification of two kinesins, Pav and Neb (Table S1). In vivo pull-down assay confirmed that PtA::StiCC1 formed a complex with both kinesins,
Author contributions: P.P.D. designed research; Z.I.B., M.A., M.G.R., G.C., and P.P.D. performed research; Z.I.B. and P.P.D. analyzed data; and P.P.D. wrote the paper. The authors declare no conflict of interest. This article is a PNAS Direct Submission. 1
To whom correspondence should be addressed. E-mail:
[email protected].
This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. 1073/pnas.1301328110/-/DCSupplemental.
www.pnas.org/cgi/doi/10.1073/pnas.1301328110
Fig. 1. Sti interacts with Neb and Pav via its CC1 region. (A) Schematic diagrams illustrating the protein domains of Sti, Neb, and Pav and the positions of the different fragments used for the in vitro pull-down assays. (B) GST::StiCC1 and GST alone were incubated with in vitro translated and radiolabeled Neb, Pav, and Feo polypeptides (Right) and then pulled down using glutathione beads. (C) The GST::Neb proteins indicated at the top and GST alone were incubated with the in vitro translated and radiolabeled StiCC1, Pav, and Feo polypeptides indicated at the right, and then pulled down using glutathione beads. (D) The GST::Pav proteins indicated at the top and GST alone were incubated with in vitro translated and radiolabeled StiCC1, Neb1–740, and Feo polypeptides and then pulled down using glutathione beads. (E) GST::StiCC1 and GST alone were incubated with a mixture containing both Neb741–1121 and Pav461–685 translated and radiolabeled in vitro and then pulled down using glutathione beads. (F) GST::StiCC1 was incubated with an in vitro translated and radiolabeled Pav461–685 polypeptide and increasing concentrations of GST:: Neb741–1121. The mixtures were then pulled down using glutathione beads. In all panels, the Ponceau staining of the protein loading is shown in the lower part and the numbers on the left indicate the sizes, in kilodaltons, of the molecular mass marker.
Bassi et al.
Neb in vitro. First, GST::StiCC1 could simultaneously pull down both Neb741–1121 and Pav461–685 (Fig. 1E). Second, the binding of GST::StiCC1 to radiolabeled Pav461–685 was unaffected by the presence of increasing concentrations of GST-Neb741–1121, which binds to StiCC1 but not to Pav461–685 (Fig. 1F). Thus, Pav and Neb do not seem to compete for their binding to StiCC1. In sum, our findings indicate that Sti, Neb, Pav, and Feo form a complex in vivo in which the StiCC1 region binds to Pav and Neb, and in turn these two kinesins interact directly with each other and with Feo. Sti and Neb Colocalize to the Cleavage Furrow. We then analyzed the localization of Sti, Neb, and Pav during cytokinesis. We used a cell line stably expressing a myelocytomatosis viral oncogene homolog (myc)-tagged Sti transgene (Sti::myc) that showed the same localization pattern as endogenous Sti and could fully rescue the cytokinesis defects caused by sti RNAi (17). Sti::myc and Neb colocalized to the cleavage furrow throughout cytokinesis, although fluorescence intensity profiles indicated that Neb was distributed closer to the inside edge of the furrow (Fig. 2 A and B). Sti::myc only partially colocalized with Pav at the interface between the central spindle and the contractile ring in mid- and late telophase, but then the two proteins colocalized to the MB ring after intercellular bridge formation (Fig. 2C). We noticed that Neb localization differs from KIF14, which was described as accumulating at the central spindle in HeLa cells (9). Importantly, the Neb antibody is specific because its signal disappeared after neb RNAi (Fig. S3) and Neb tagged with green fluorescent protein (GFP::Neb) displayed identical localization PNAS | June 11, 2013 | vol. 110 | no. 24 | 9783
CELL BIOLOGY
although only in the presence of a cyclin-dependent kinase 1 (Cdk1) inhibitor (Fig. S1), thus suggesting that this ternary complex assembled preferentially after anaphase onset. Consistent with these findings, we found that Neb depletion prevented accumulation of StiCC1 at the midzone (Fig. S2). We could not test whether Pav was necessary for StiCC1 localization to the midzone because Pav depletion inhibits furrow ingression (24). To assess whether StiCC1 could directly bind to Pav and Neb, we purified a StiCC1 fragment tagged with glutathione S-transferase (GST) from bacteria and tested its ability to pull down various radiolabeled Pav and Neb polypeptides synthesized by in vitro translation (Fig. 1B). These experiments indicated that StiCC1 interacted with the Neb C-terminal domain (Neb741–1121) and the Pav stalk domain (Pav461–685; Fig. 1 A and B). MKLP1 and KIF14 are known to interact with another MAP, PRC1, in human cells (9, 25), but we found that StiCC1 could not pull down the Drosophila PRC1 ortholog, Feo (Fig. 1B), indicating that StiCC1 interacts specifically with Pav and Neb. Reciprocal pull-down experiments using GST::Neb fragments confirmed that Neb741–1121 interacted with StiCC1, whereas its most N-terminal fragment, Neb1–118, was able to pull down both Feo and Pav461–887 (Fig. 1C). Moreover, GST::Pav 461–685 could pull down StiCC1, and Pav461–887 interacted with both Feo and the N terminus of Neb (Fig. 1D). These results are consistent with our previous study, in which both Sti and Neb were identified as Feo-associated proteins in Drosophila cells (26). Two lines of evidence indicated that StiCC1 could form a ternary complex with Pav and
Fig. 2. Sti colocalizes with Neb at the cleavage furrow, and both proteins partially colocalize with Pav. (A) Drosophila Schneider 2 (S2) cells stably expressing Myc-tagged Sti were fixed and stained to detect Myc, Neb, and tubulin. The dotted lines were used to generate the intensity profiles of the red, green, and blue channels shown in B. (C) Drosophila S2 cells expressing Myc-tagged Sti were fixed and stained to detect Myc, Pav, and tubulin. (D) Drosophila S2 cells stably expressing GFP-tagged Neb1–1121 (full length), Neb1–740, Neb1–118, and Neb741–1121 were fixed and stained to detect GFP, tubulin (red), and DNA (blue). (E) Drosophila S2 cells stably expressing GFP-tagged full-length Neb were fixed and stained to detect GFP, Pav, and tubulin. (F) Drosophila S2 cells stably expressing GFP-tagged full-length Neb were fixed and stained to detect GFP, Feo, and tubulin. The insets show a 2× magnification of the MB. (Scale bars, 10 μm.)
(Fig. 2D). Consistent with our in vitro binding results, the Neb fragment that interacts with Sti (Neb741–1121) localized to the cleavage furrow, whereas the two Neb fragments that bind to Pav and Feo and lack the Sti-interacting region (Neb1–740 and Neb1–118) localized to the central spindle (Fig. 2D). Similar to Sti, GFP::Neb also appeared to only partially colocalize with Pav at the interface between the central spindle and the contractile ring in mid- and late telophase, whereas after formation of the intercellular bridge, Neb formed a buttonhole that completely encircled Pav (Fig. 2E). GFP::Neb also colocalized with Feo at the interface between the cleavage furrow and the central spindle, but Feo showed a wider distribution and disappeared after bridge formation (Fig. 2F). Sti Recruits Neb to the Cleavage Furrow and Is Necessary for Proper MB Formation. It is unlikely that the interaction of StiCC1 with
Neb and Pav might be important for Sti localization because this 9784 | www.pnas.org/cgi/doi/10.1073/pnas.1301328110
region is not required for cleavage furrow accumulation (17). Therefore, we analyzed MB formation and localization of Neb, Pav, and Feo after Sti depletion. In late cytokinesis, MBs stained for tubulin display a dark central region, which corresponds to tightly bundled midzone microtubules that are inaccessible to antitubulin antibodies because they are covered by MB ring proteins. This dark region was either completely absent or very thin and oblique in a significant number of Sti-depleted cells (34% vs. 10% in control cells), indicating that MBs did not form properly in the absence of Sti (Fig. 3 A-E). Ultrastructural analysis by electron microscopy (EM) confirmed that the electron-dense MB matrix was scarce, disorganized, and fragmented in Sti-depleted cells (Fig. 3D). Interestingly, Neb failed to localize to the cleavage furrow in all sti RNAi cells (Fig. 3A), and Pav and Feo localization appeared diffuse in Sti-depleted cells with abnormal MBs (Fig. 3 B and C). To investigate whether Sti kinase activity was necessary Bassi et al.
routinely observed after sti RNAi (45–59%) (12, 17), suggesting that Sti exerts additional functions in addition to recruiting Neb. Sti was able to accumulate at the cleavage furrow after neb RNAi (Fig. 4A), although sometimes its distribution appeared slightly asymmetric (Fig. 4A, Bottom), probably because of MB disorganization. These results indicate that Sti is necessary for Neb recruitment to the cleavage site, but not vice versa. Pav and Feo localization also appeared diffuse after Neb depletion (Fig. 4 B and C), and in some extreme cases, neb RNAi cells displayed very long and thin central spindles (Fig. 4B, Bottom), reminiscent of the phenotype observed after Feo inactivation (22). EM analysis confirmed that neb RNAi caused fragmentation, disorganization, and mispositioning of the MB matrix (Fig. 4D). Together, these data indicate that Sti recruits Neb to the cleavage site and then both proteins cooperate to regulate MB formation and proper localization of Pav and Feo to the spindle midzone. We cannot exclude that the improper localization of these two MAPs could simply be a consequence of general MB disorganization, but the
for MB formation, we rescued depletion of endogenous Sti by expression of Myc-tagged wild-type Sti (StiWT), Myc-tagged kinase-dead Sti (StiKD), or Myc alone, as described (17). MB defects were rescued only by expression of StiWT (Fig. 3F). neb RNAi phenocopied Sti depletion, although the frequency of abnormal MBs (47%) was slightly higher than in Sti-depleted cells (Fig. 4 A-E). Notably, the level of cytokinesis failure (i.e., increase in multinucleate cells) after neb RNAi, although significant (12.6% vs. 5% in controls; Fig. 4E), was considerably less than what was Bassi et al.
Fig. 4. Neb depletion phenocopies sti RNAi. (A–C) Drosophila S2 cells were treated with dsRNAs directed against kanamycin (control) or neb for 96 h and then fixed and stained to detect tubulin, DNA (blue), and Sti, Pav, or Feo. The insets show a 2× magnification of the MB. (Scale bars, 10 μm.) (D) EM images of MBs from cells treated as described earlier. Arrowheads mark the MB matrix. Note in the right panel that the MB matrix is mispositioned inside the cell body. (Scale bars, 1 μm.) (E) Quantification of multinucleate cells and MB defects from the experiments shown in A–C. More than 600 and 200 cells were counted (n = 4) for the quantification of multinucleate cells and central spindle defects, respectively. Bars indicate SEs. *P < 0.05 (Mann–Whitney U test).
PNAS | June 11, 2013 | vol. 110 | no. 24 | 9785
CELL BIOLOGY
Fig. 3. Sti is required for MB formation and proper localization of Pav and Feo. (A–C) Drosophila S2 cells were treated with dsRNAs directed against kanamycin (control) or sti for 72 h and then fixed and stained to detect tubulin, DNA (blue), and Neb, Pav, or Feo. The insets show a 2× magnification of the MB. (Scale bars, 10 μm.) (D) EM images of MBs from cells treated as described earlier. Arrowheads mark the MB matrix. (Scale bars, 1 μm.) (E) Quantification of MB defects from the experiments shown in A–C. More than 200 mid-late telophase cells were counted in each experiment (n = 4). Bars indicate SEs. *P < 0.05 (Mann–Whitney U test). (F) Drosophila S2 cells stably expressing Myc, StiWT::Myc, or StiKD::Myc were treated with dsRNAs directed against either kanamycin (control) or the 3′ UTR of sti for 72 h. The number of cells showing MB defects was then counted and plotted. Only Myc-positive cells were counted, and more than 200 mid-late telophase cells were counted in each experiment (n = 4). Bars indicate SEs. *P < 0.05 (Mann–Whitney U test). Note that sti 3′UTR RNAi is less efficient than RNAi targeting Sti ORF (17).
evidence that these proteins form a complex in vivo with Sti and Neb makes this hypothesis less likely. Citron Kinase Is Necessary for MB Formation in Human Cells. In human cells, CIT-K associates with KIF14, although it is not known whether this interaction is direct, and the two proteins are interdependent for their localization during cytokinesis (9). In turn, both KIF14 and MKLP1 are known to interact with PRC1 (9, 25). Thus, we investigated whether CIT-K could also directly interact with MKLP1. In vitro pull-down assays confirmed that the CIT-K region corresponding to StiCC1 interacted directly with the C-terminal region of MKLP1, but unlike in Drosophila, CIT-K bound to the MKLP1 tail region (aa 590–856; Fig. 5A). We then analyzed localization of CIT-K, KIF14, and MKLP1 in HeLa cells during cytokinesis. Consistent with previous findings (9), we found that KIF14 localized to the spindle midzone, but we also observed a clear KIF14 signal at the cortex, where this kinesin colocalized with CIT-K throughout cytokinesis (Fig. S4A). CIT-K also colocalized with MKLP1 at the interface between the cleavage furrow and the central spindle in mid- and late telophase (Fig. S4B), as already described for Pav and Sti (Fig. 2C). CIT-K depletion affected MB organization and localization of both MKLP1 and PRC1 (Fig. 5B) similarly to the phenotypes observed in fly cells. These defects were less frequent than in Drosophila but were nonetheless very significant (8.8% vs. 0.6% in controls; Fig. 5C) and represented about one third of the total number of multinucleate cells (27.2%; Fig. 5C). Thus, CIT-K’s role in MB formation is conserved in human cells.
Discussion Although it was proposed more than a decade ago that cytokinesis requires the coordinated action of contractile ring and central spindle proteins (2, 3), it is still unclear which contractile ring component or components might play a key role in this process. The results presented here, together with previous evidence that Sti/CIT-K associates with and controls the distribution of the contractile ring components actin, myosin, anillin, and RhoA (12, 14, 17), clearly establish that this kinase links contractile ring and central spindle components and that this role is important for MB formation in late cytokinesis (Fig. 6). Consistent with this model, we previously reported that Sti-depleted cells present cortical blebs at the cleavage site, which are likely to be caused by detachment of the contractile ring from the central spindle (12). Sti/CIT-K appears to play both structural and regulatory roles in MB formation. First, it can directly bind to Neb/ KIF14 and Pav/MKLP1 and is required for their proper distribution during cytokinesis. Furthermore, our rescue experiments indicate that at least in flies, Sti kinase activity is necessary for its role in MB formation. Thus, we propose that Sti could phosphorylate one or more MAPs required for central spindle and MB assembly; the most obvious candidates are the three MAPs that form a complex with CIT-K: Neb/KIF14, Pav/MKLP1, and Feo/ PRC1. Unfortunately, our various attempts to establish a kinase assay using Sti purified from Drosophila cells proved inconclusive. Mass spectrometry revealed that Sti is phosphorylated at multiple residues in its kinase domain, and it is likely that these posttranslational modifications could regulate its kinase activity during cell division. Drosophila cells cannot be synchronized, preventing the purification of Sti specifically from cells in telophase, when this kinase should be fully active. Perhaps future attempts using CIT-K purified from telophase-synchronized human HeLa cells could lead to the identification of its targets during cytokinesis. The multiprotein complex formed by Sti/CIT-K, Neb/KIF14, Pav/MKLP1, and Feo/PRC1 has been conserved during evolution, but the localizations of Neb and KIF14 are different: Neb localizes to the cleavage furrow, whereas KIF14 accumulates at both the cortex and spindle midzone (Fig. S4A). Furthermore, although CIT-K and KIF14 are interdependent for their localization during cytokinesis (9), in Drosophila Sti is necessary for Neb 9786 | www.pnas.org/cgi/doi/10.1073/pnas.1301328110
Fig. 5. CIT-K is necessary for proper MB formation in HeLa cells. (A) In vitro pull-down assay using the GST::MKLP1 proteins indicated at the top or GST alone and in vitro translated and radiolabeled CIT-K CC1 fragment. (B) HeLa cells were treated with siRNAs directed against scrambled sequences (control) or CIT-K for 48 h and then fixed and stained to detect tubulin, DNA (blue), and either MKLP1 or PRC1. The insets show a 2.5× magnification of the MB. (Scale bars, 20 μm.) (C) Quantification of MB defects and multinucleate cells from the experiments shown in B. More than 120 cells were counted in each experiment (n = 4). Bars indicate SEs. *P < 0.05 (Mann–Whitney U test).
accumulation at the cleavage furrow, but not vice versa. These differences between human and fly cytokinesis proteins are not new. For example, the Drosophila RhoGEF Pebble, which is responsible for RhoA activation at the cleavage site, localizes to the equatorial cortex and cleavage furrow (27), whereas its human homolog ECT2 accumulates at both the equatorial cortex and spindle midzone (28, 29). Why and when these differences originated during evolution is not known, but importantly, all these proteins have conserved similar functions in cytokinesis. In conclusion, our results shed light on an important role of CIT-K indicating that in both Drosophila and human cells, this kinase controls a molecular network of MAPs involved in MB formation. This function of CIT-K could act in parallel and/or in concert with other proteins such as anillin to establish a robust Bassi et al.
Fig. 6. Model depicting the role of Sti in MB formation. Cartoon illustrating Sti interactions during MB formation. Anillin and Rho1 are not included.
supplemented with 10% (vol/vol) FCS and antibiotics. CIT-K RNAi knockdown was performed using the siRNAs described in ref. 9. Gateway technology (Invitrogen) was used in all cloning procedures, as described (24). For in vitro binding assays, [35S]methionine-labeled fragments were transcribed and translated in vitro using the TnT T7 Quick Coupled Transcription/Translation System (Promega), and GST-tagged proteins were expressed in bacteria, using the pDEST15 vector (Invitrogen). More detailed description of expression vectors, immunostaining procedures, and transmission electron microscopy can be found in SI Materials and Methods.
Drosophila cells were grown in serum-free medium supplemented with antibiotics. dsRNA production and RNAi treatments were performed as described (24). HeLa Kyoto cells were maintained in DMEM (Invitrogen)
ACKNOWLEDGMENTS. We thank D. M. Glover for generously sharing his microscopes. We thank F. Barr, D. M. Glover, M. Mishima, and H. Okhura for reagents and C. Lindon and T. Takeda for critical reading of the manuscript. This work was supported by Cancer Research United Kingdom Project Grant C12296/A12541 (to P.P.D.). Z.I.B. is supported by a Gwynaeth Pretty doctoral fellowship from the Department of Pathology, University of Cambridge.
1. D’Avino PP, Savoian MS, Glover DM (2005) Cleavage furrow formation and ingression during animal cytokinesis: A microtubule legacy. J Cell Sci 118(Pt 8):1549–1558. 2. Cimini D, Fioravanti D, Tanzarella C, Degrassi F (1998) Simultaneous inhibition of contractile ring and central spindle formation in mammalian cells treated with cytochalasin B. Chromosoma 107(6-7):479–485. 3. Giansanti MG, et al. (1998) Cooperative interactions between the central spindle and the contractile ring during Drosophila cytokinesis. Genes Dev 12(3):396–410. 4. D’Avino PP, et al. (2008) Interaction between Anillin and RacGAP50C connects the actomyosin contractile ring with spindle microtubules at the cell division site. J Cell Sci 121(Pt 8):1151–1158. 5. Frenette P, et al. (2012) An anillin-Ect2 complex stabilizes central spindle microtubules at the cortex during cytokinesis. PLoS ONE 7(4):e34888. 6. Gregory SL, et al. (2008) Cell division requires a direct link between microtubulebound RacGAP and Anillin in the contractile ring. Curr Biol 18(1):25–29. 7. Douglas ME, Mishima M (2010) Still entangled: Assembly of the central spindle by multiple microtubule modulators. Semin Cell Dev Biol 21(9):899–908. 8. D’Avino PP (2009) How to scaffold the contractile ring for a safe cytokinesis - lessons from Anillin-related proteins. J Cell Sci 122(Pt 8):1071–1079. 9. Gruneberg U, et al. (2006) KIF14 and citron kinase act together to promote efficient cytokinesis. J Cell Biol 172(3):363–372. 10. Madaule P, et al. (1998) Role of citron kinase as a target of the small GTPase Rho in cytokinesis. Nature 394(6692):491–494. 11. Yamashiro S, et al. (2003) Citron kinase, a Rho-dependent kinase, induces di-phosphorylation of regulatory light chain of myosin II. Mol Biol Cell 14(5):1745–1756. 12. D’Avino PP, Savoian MS, Glover DM (2004) Mutations in sticky lead to defective organization of the contractile ring during cytokinesis and are enhanced by Rho and suppressed by Rac. J Cell Biol 166(1):61–71. 13. Echard A, Hickson GR, Foley E, O’Farrell PH (2004) Terminal cytokinesis events uncovered after an RNAi screen. Curr Biol 14(18):1685–1693. 14. Gai M, et al. (2011) Citron kinase controls abscission through RhoA and anillin. Mol Biol Cell 22(20):3768–3778. 15. Naim V, Imarisio S, Di Cunto F, Gatti M, Bonaccorsi S (2004) Drosophila citron kinase is required for the final steps of cytokinesis. Mol Biol Cell 15(11):5053–5063.
16. Shandala T, Gregory SL, Dalton HE, Smallhorn M, Saint R (2004) Citron kinase is an essential effector of the Pbl-activated Rho signalling pathway in Drosophila melanogaster. Development 131(20):5053–5063. 17. Bassi ZI, et al. (2011) Sticky/Citron kinase maintains proper RhoA localization at the cleavage site during cytokinesis. J Cell Biol 195(4):595–603. 18. Adams RR, Tavares AA, Salzberg A, Bellen HJ, Glover DM (1998) pavarotti encodes a kinesin-like protein required to organize the central spindle and contractile ring for cytokinesis. Genes Dev 12(10):1483–1494. 19. Alphey L, et al. (1997) KLP38B: A mitotic kinesin-related protein that binds PP1. J Cell Biol 138(2):395–409. 20. Ohkura H, et al. (1997) Mutation of a gene for a Drosophila kinesin-like protein, Klp38B, leads to failure of cytokinesis. J Cell Sci 110(Pt 8):945–954. 21. Ruden DM, Cui W, Sollars V, Alterman M (1997) A Drosophila kinesin-like protein, Klp38B, functions during meiosis, mitosis, and segmentation. Dev Biol 191(2):284–296. 22. Vernì F, et al. (2004) Feo, the Drosophila homolog of PRC1, is required for centralspindle formation and cytokinesis. Curr Biol 14(17):1569–1575. 23. D’Avino PP, et al. (2009) Isolation of protein complexes involved in mitosis and cytokinesis from Drosophila cultured cells. Methods Mol Biol 545:99–112. 24. D’Avino PP, Savoian MS, Capalbo L, Glover DM (2006) RacGAP50C is sufficient to signal cleavage furrow formation during cytokinesis. J Cell Sci 119(Pt 21):4402–4408. 25. Kurasawa Y, Earnshaw WC, Mochizuki Y, Dohmae N, Todokoro K (2004) Essential roles of KIF4 and its binding partner PRC1 in organized central spindle midzone formation. EMBO J 23(16):3237–3248. 26. D’Avino PP, et al. (2007) Recruitment of Polo kinase to the spindle midzone during cytokinesis requires the Feo/Klp3A complex. PLoS ONE 2(6):e572. 27. Prokopenko SN, et al. (1999) A putative exchange factor for Rho1 GTPase is required for initiation of cytokinesis in Drosophila. Genes Dev 13(17):2301–2314. 28. Chalamalasetty RB, Hümmer S, Nigg EA, Silljé HH (2006) Influence of human Ect2 depletion and overexpression on cleavage furrow formation and abscission. J Cell Sci 119(Pt 14):3008–3019. 29. Su KC, Takaki T, Petronczki M (2011) Targeting of the RhoGEF Ect2 to the equatorial membrane controls cleavage furrow formation during cytokinesis. Dev Cell 21(6): 1104–1115.
Materials and Methods
Bassi et al.
PNAS | June 11, 2013 | vol. 110 | no. 24 | 9787
CELL BIOLOGY
and cooperative interaction between contractile ring and central spindle components that is essential for MB formation and successful completion of cytokinesis. However, CIT-K is the only contractile ring component so far described to control MB localization of central spindle components, suggesting that this kinase could act at the top of the hierarchy controlling MB formation. Finally, as CIT-K, KIF14, MKLP1, and PRC1 have all been found mutated in various cancers [catalogue of somatic mutations in cancer (COSMIC) database, www.sanger.ac.uk], our findings might have implications for the development of cancer therapies.
Supporting Information Bassi et al. 10.1073/pnas.1301328110 SI Materials and Methods Affinity Purification and Mass Spectrometry. For protein A (PtA)
purifications, ∼109 cells were harvested by centrifugation and frozen in liquid nitrogen. The cell pellet was then resuspended in 5 mL extraction buffer [50 mM Hepes at pH 7.5, 100 mM KAc, 50 mM KCl, 2 mM MgCl2, 2 mM EGTA, 0.1% (vol/vol) Nonidet P-40, 5 mM DTT, 5% (vol/vol) glycerol, and Roche Complete Protease Inhibitors] and homogenized using a high-performance disperser (Fisher). Homogenates were agitated at 4°C for 30 min and clarified by centrifugation at 6,000 rpm in an SS34 rotor (Sorvall, Thermo Scientific). Next, 200 μL Dynabeads (Invitrogen) conjugated to rabbit IgG (Sigma) were added to the supernatants and incubated for 4 h under continuous agitation at 4°C. Beads were then washed five times for 10 min in 10 mL extraction buffer. Proteins were then eluted from beads with 0.5 M NH4OH and 0.5 mM EDTA, concentrated, and analyzed by liquid chromatography-mass spectrometry (LC-MS)/MS. The MS/MS fragmentation data achieved were used to search the National Center for Biotechnology Information and Flybase databases, using the MASCOT search engine (www.matrixscience.com). Probabilitybased MASCOT scores were used to evaluate identifications. Only matches with P < 0.05 for random occurrence were considered significant. In Vivo Pull-Down Assays. Six million cells stably expressing either PtA::StiCC1 (the N-terminal region of the Sti coiled-coil domain is dubbed “StiCC1”) or PtA alone were transfected with plasmids encoding GFP::Neb [Neb stands for Nebbish, the fly counterpart of human kinesin family member 14 (KIF14)] and Pav::Myc [Pav stands for Pavarotti, the Drosophila ortholog of human mitotic kinesin-like protein 1 (MKLP1), and Myc stands for myelocytomatosis viral oncogene homolog] transgenes, using the FuGene HD transfection reagent (Promega) and incubated at 25°C for 48 h. The proteasome inhibitor MG132 (Sigma) was added to the medium at a concentration of 25 μM 5 h before harvesting the cells, whereas the cyclin-dependent kinase 1 (Cdk1) inhibitor RO-3306 (Calbiochem) was added 2 h before collection at a final concentration of 10 μM. Cells were then collected, washed in PBS, and stored at −80°C. The cell pellet was resuspended in 0.5 mL of extraction buffer [50 mM Hepes at pH 7.5, 100 mM KAc, 50 mM KCl, 2 mM MgCl2, 2 mM EGTA, 0.1% (vol/vol) Nonidet P-40, 5 mM DTT, 5% (vol/vol) glycerol, and Roche Complete Protease Inhibitors] and homogenized using a highperformance disperser (Fisher). Homogenates were centrifuged at 2,000 rpm at 4°C in an Eppendorf 5417R centrifuge for 15 min, and supernatants were transferred into new tubes. Next, 30 μL Dynabeads (Invitrogen) conjugated to rabbit IgG (Sigma) were added to the supernatants and incubated for 2 h on a rotating wheel at 4°C. Beads were then washed five times for 5 min in 1 mL extraction buffer, resuspended in 30 μL Laemmli buffer, boiled for 10 min, and stored at −20°C. Proteins were separated on a SDS PAGE gel, transferred onto PVDF membrane, and probed to detect the antigens shown in Fig. S1. Molecular Biology, Cell Culture, DNA, dsRNA, and siRNA Transfections.
Gateway technology (Invitrogen) was used in all cloning procedures as described (1). The destination vectors used for expression in Drosophila cultured cells were described (1–3). The pDEST15 vector (Invitrogen) was used for bacterial expression of GST-tagged proteins. Drosophila cDNAs were obtained from the Drosophila Genomics Resource Center. The MKLP1 cDNA was a gift of M. Mishima (University of Warwick, Warwick, Bassi et al. www.pnas.org/cgi/content/short/1301328110
United Kingdom). The CIT-K region corresponding to StiCC1, CIT-K420–785, was amplified by PCR, using total RNA from HeLa Kyoto cells, the SuperScript First-Strand Synthesis System for RT-PCR (Invitrogen), and the following primers: forward, TACAGCAAGGCACTGGGGATT, and reverse, CTCCAGTGTCTCCTTGTCAGC. The Dmel strain of Schneider 2 (S2) cells (Invitrogen) was grown in serum-free medium supplemented with antibiotics. dsRNA production and RNAi treatments were performed as described previously (1). Primers used to generate sti dsRNAs were described (4); the primers used to generate the neb dsRNA were, forward, GCAGCCTGATATTGTACTGGATGG, and reverse, ATCTTCATGCCTTAGCGGAGTGTG. DNA transfections and generation of fly stable cell lines were described (3). HeLa Kyoto cells were maintained in DMEM (Invitrogen) supplemented with 10% FCS and antibiotics. CIT-K RNAi knockdown was performed using the siRNAs described in Gruneberg et al. (4) and Lipofectamine RNAiMAX (Invitrogen), following the manufacturer’s instructions. In Vitro Binding Assay. DNA fragments coding for Sti, Neb, Pav, and MKLP1 were generated by PCR and cloned into pDEST15 (Invitrogen) to express N-terminal GST-tagged polypeptides in Escherichia coli. The GST-tagged products were then purified using Glutathione Sepharose 4B (GE Healthcare), according to the manufacturer’s instructions. [35S]Methionine-labeled Sti, Neb, Pav, Fascetto, and CIT-K fragments were prepared from corresponding PCR products amplified using primers harboring a T7 promoter, and then transcribed and translated in vitro, using the TnT T7 Quick Coupled Transcription/Translation System (Promega) in the presence of [35S]methionine (Perkin-Elmer). GST pull-down assays were carried out as described (5). Antibodies and Fluorescence Microscopy. The following antibodies were used in this study: mouse monoclonal anti α-tubulin (clone DM1A, Sigma), chicken polyclonal anti-α-tubulin (Abcam, ab89984), mouse monoclonal anti-Myc (clone 9E10, Santa Cruz Biotechnology), rabbit polyclonal anti-Myc (Abcam, ab9106), rabbit polyclonal anti-Sticky (6), rabbit polyclonal anti-Pav (7), rabbit polyclonal anti-Neb (a kind gift of D. M. Glover and H. Okhura, University of Cambridge, Cambridge, United Kingdom), mouse monoclonal anti-CIT-K (BD Laboratories), rabbit polyclonal anti-KIF14 (Bethyl Laboratories), rabbit polyclonal anti-MKLP1 (clone sc-867, Santa Cruz Biotechnology), rabbit polyclonal anti-PRC1 (a kind gift of F. Barr, University of Oxford, Oxford, United Kingdom) (4). Peroxidase and Alexa-fluor conjugated secondary antibodies were purchased from Jackson Laboratories and Invitrogen. Dmel cells were grown on 22 × 22-mm coverslips (MenzelGläser) and fixed in PHEM [1,4 piperazinediethanesulfonic acid (PIPES), Hepes, EGTA, and MgCl] buffer (60 mM PIPES, 25 mM Hepes at pH 7, 10 mM EGTA, 4 mM MgCl2, 3.7% formaldehyde) for 12 min. HeLa cells were also plated on coverslips but fixed in ice-cold methanol for 10 min. All cell types were then processed and visualized as described (5). ImageJ software was used to generate RGB fluorescence profiles. Transmission Electron Microscopy. Cells were plated on coverslips and fixed overnight at 4°C in 2.5% glutaraldehyde in PBS, postfixed for 1 h in 1% OsO4 in PBS, dehydrated in a graded series of alcohols embedded in Epon, and polymerized for 2 d at 60°C. Glass slides were separated from the resin after a short 1 of 3
immersion in liquid nitrogen. Sections were obtained with a LKB ultratome, stained with uranyl acetate and lead citrate, and ob-
served and photographed with a Philips CM10 electron microscope at 80 kV.
1. D’Avino PP, Savoian MS, Capalbo L, Glover DM (2006) RacGAP50C is sufficient to signal cleavage furrow formation during cytokinesis. J Cell Sci 119(Pt 21):4402–4408. 2. D’Avino PP, et al. (2008) Interaction between Anillin and RacGAP50C connects the actomyosin contractile ring with spindle microtubules at the cell division site. J Cell Sci 121(Pt 8):1151–1158. 3. D’Avino PP, et al. (2009) Isolation of protein complexes involved in mitosis and cytokinesis from Drosophila cultured cells. Methods Mol Biol 545:99–112. 4. Gruneberg U, et al. (2006) KIF14 and citron kinase act together to promote efficient cytokinesis. J Cell Biol 172(3):363–372.
5. Bassi ZI, et al. (2011) Sticky/Citron kinase maintains proper RhoA localization at the cleavage site during cytokinesis. J Cell Biol 195(4):595–603. 6. D’Avino PP, Savoian MS, Glover DM (2004) Mutations in sticky lead to defective organization of the contractile ring during cytokinesis and are enhanced by Rho and suppressed by Rac. J Cell Biol 166(1):61–71. 7. Minestrini G, Máthé E, Glover DM (2002) Domains of the Pavarotti kinesin-like protein that direct its subcellular distribution: Effects of mislocalisation on the tubulin and actin cytoskeleton during Drosophila oogenesis. J Cell Sci 115(Pt 4): 725–736.
Fig. S1. StiCC1 forms a complex with Neb and Pav in vivo. S2 cells stably expressing either the StiCC1 fragment tagged with PtA or PtA alone were cotransfected with plasmids expressing GFP::Neb and Pav::Myc for 48 h and treated with the Cdk1 inhibitor RO-3306 2 h before collection, and then proteins were extracted and used in PtA pull-down assay. The extracts and pull downs were analyzed by Western blot to detect GFP, Myc, and PtA. The numbers on the left indicate the sizes, in kilodaltons, of the molecular mass marker.
Fig. S2. StiCC1 localization to the midzone requires Neb. Drosophila S2 cells stably expressing GFP::StiCC1 were treated with dsRNAs directed against kanamycin (control) or neb for 96 h and then fixed and stained to detect GFP, tubulin, and DNA (blue). Arrowhead marks GFP::StiCC1 localization to the spindle midzone. (Scale bars, 10 μm.)
Bassi et al. www.pnas.org/cgi/content/short/1301328110
2 of 3
Fig. S3. Analysis of Neb depletion in Drosophila S2 cells. (A) Western blot analysis of Neb protein levels in Drosophila S2 cells treated for 96 h with either kanamycin (kana, control) or neb dsRNAs. The arrows mark the bands corresponding to Neb and a nonspecific band used as loading control. The numbers on the left indicate the sizes in kilodaltons of the molecular mass marker. (B) Drosophila S2 cells were treated with dsRNAs directed against kanamycin (control) or neb for 96 h and then fixed and stained to detect Neb, tubulin, and DNA (blue). (Scale bars, 10 μm.)
Fig. S4. Localization patterns of CIT-K, KIF14, and MKLP1 during cytokinesis in HeLa cells. (A) HeLa (Kyoto) cells were fixed and stained to detect CIT-K, KIF14, and tubulin. (B) HeLa (Kyoto) cells were fixed and stained to detect CIT-K, MKLP1, and tubulin. The insets show a 2.5× magnification of the midbody. (Scale bars, 10 μm.)
Table S1. Identification of Neb and Pav by affinity purification and mass spectrometry Bait and interactors StiFL::PtA Pav Tumbleweed/RacGAP50C PtA::StiCC1 Neb
Score
Peptides
364 122
7 3
143
4
The two kinesins, Pav and Neb, identified from the PtA affinity purification assays are listed along with their respective MASCOT scores and number of peptides. Tumbleweed/RacGAP50C is the RacGAP centralspindlin component in Drosophila. The baits are indicated in bold font.
Bassi et al. www.pnas.org/cgi/content/short/1301328110
3 of 3
