Cleavage of metastasis suppressor gene product KiSS-1 ... - Nature

2 downloads 14 Views 376KB Size Report
Vanderwinden JM, Le Poul E, Brezillon S, Tyldesley R,. Suarez-Huerta N, Vandeput F, Blanpain C, Schiffmann SN,. Vassart G and Parmentier M. (2001). J. Biol.

Oncogene (2003) 22, 4617–4626

& 2003 Nature Publishing Group All rights reserved 0950-9232/03 $25.00 www.nature.com/onc

ORIGINAL PAPERS

Cleavage of metastasis suppressor gene product KiSS-1 protein/metastin by matrix metalloproteinases Takahisa Takino1, Naohiko Koshikawa2, Hisashi Miyamori1, Motohiro Tanaka3, Takuma Sasaki3,4, Yasunori Okada5, Motoharu Seiki2 and Hiroshi Sato*,1,4 1

Department of Molecular Virology and Oncology, Cancer Research Institute, Kanazawa University, Kanazawa 920-0934, Japan; Department of Cancer Cell Research, Institute of Medical Science, University of Tokyo, Tokyo 108-8639, Japan; 3Department of Chemotherapy, Cancer Research Institute, Kanazawa University, Kanazawa 920-0934, Japan; 4Center for the Development of Molecular Target Drugs, Cancer Research Institute, Kanazawa University, Kanazawa 920-0934, Japan; 5Department of Pathology, Medical School, Keio University, Tokyo 160-8582, Japan 2

A human placenta cDNA library was screened by the expression cloning method for gene products that interact with matrix metalloproteinases (MMPs), and we isolated a cDNA whose product formed a stable complex with proMMP-2 and pro-MMP-9. The cDNA encoded the metastasis suppressor gene KiSS-1. KiSS-1 protein was shown to form a complex with pro-MMP. KiSS-1 protein is known to be processed to peptide ligand of a G-proteincoupled receptor (hOT7T175) named metastin, and suppresses metastasis of tumors expressing the receptor. Active MMP-2, MMP-9, MT1-MMP, MT3-MMP and MT5MMP cleaved the Gly118-Leu119 peptide bond of not only full-length KiSS-1 protein but also metastin decapeptide. Metastin decapeptide induced formation of focal adhesion and actin stress fibers in cells expressing the receptor, and digestion of metastin decapeptide by MMP abolished its ligand activity. Migration of HT1080 cells expressing hOT7T175 that harbor a high-level MMP activity was only slightly suppressed by either metastin decapeptide or MMP inhibitor BB-94 alone, but the combination of metastin decapeptide and BB-94 showed a synergistic effect in blocking cell migration. We propose that metastin could be used as an antimetastatic agent in combination with MMP inhibitor, or MMP-resistant forms of metastin could be developed and may also be efficacious. Oncogene (2003) 22, 4617–4626. doi:10.1038/sj.onc.1206542 Keywords: MMP; KiSS-1; cleavage

Introduction Matrix metalloproteinases (MMPs) are a family of Zn2 þ -dependent enzymes that are known to cleave *Correspondence: H Sato, Department of Molecular Virology and Oncology, Cancer Research Institute, Kanazawa University, 13-1 Takara-machi, Kanazawa 920-0934, Japan; E-mail: [email protected] Received 20 November 2002; revised 24 February 2003; accepted 24 February 2003

extracellular matrix (ECM) proteins in normal and pathological conditions (Woessner and Gunja, 1991; Birkedal et al., 1993; Stetler-Stevenson et al., 1993). To date, 21 mammalian MMPs have been identified by cDNA cloning and they can be subgrouped into 15 soluble-type and six membrane-type MMPs (MTMMPs) (Nagase and Woessner, 1999; Seiki, 1999). MMPs are overexpressed in various human malignancies and have been thought to contribute to tumor invasion and metastasis by degrading ECM components (Birkedal et al., 1993; Stetler-Stevenson et al., 1993). Thus, the level of MMP expression correlates with the invasiveness or malignancy of tumors (Nomura et al., 1995; Ueno et al., 1997). Particularly, MT1-MMP, MMP-2, MMP-7 and MMP-9 have been reported to be most closely associated with tumor invasion and metastasis. While degradation of ECM is an important aspect of MMP biology, growing evidence demonstrated specific processing/activation or degradation of cell surface receptors and ligands. Fas ligand (Powell et al., 1999), TNF-a (Gearing et al., 1994), the ectodomain of the fibroblast growth factor receptor-1 (Levi et al., 1996), the heparin-binding epidermal growth factor (Suzuki et al., 1997) and IL-8 (Van den Steen et al., 2000) were reported to be released or activated by MMPs. And MMPs cleave and inactivate IL-1b (Ito et al., 1996), insulin-like growth factor binding proteins (Fowlkes et al., 1994), fibrinogen and factor XII (Hiller et al., 2000), the CC chemokine MCP-3 (McQuibban et al., 2000), and the CXC chemokines stromal-cellderived factor (SDF)-1a and -b (McQuibban et al., 2001, 2002). The KiSS-1 gene was identified originally as being differentially upregulated in C8161 melanoma cells that have lost the potential to metastasize after microcellmediated transfer of human chromosome 6 (Lee et al., 1996; Lee and Welch, 1997). The exogenous expression of KiSS-1 in breast carcinoma cells also prevents these cells from metastasizing (Lee et al., 1997). Stable transfection of KiSS-1 into HT1080 cells was reported to downregulate the expression of MMP-9 (Yan et al., 2001). It was also demonstrated that loss of KiSS-1 mRNA expression correlates with progression of human

Cleavage of KiSS-1 by MMP T Takino et al

4618

melanoma in vivo (Shirasaki et al., 2001). A C-terminally amidated peptide with 54 amino-acid residues corresponding to residues 68–121 of the full-length KiSS-1 protein was isolated from human placenta as the endogenous ligand of an orphan G-protein-coupled receptor (hOT7T175/AXOR12/human GPR54) (Kotani et al., 2001; Muir et al., 2001; Ohtaki et al., 2001), and was named metastin, because it suppressed metastasis of B16-BL6 melanoma cells expressing hOT7T175 in mouse spontaneous pulmonary metastasis assays (Ohtaki et al., 2001). Previously, we have developed an expression cloning method to screen genes, which not only modulate proMMP-2 activation mediated by MT1-MMP but also interact with pro-MMP-2 and pro-MMP-9 (Miyamori et al., 2001; Nakada et al., 2001). In this study, we have identified that the product of the KiSS-1 gene forms a stable complex with pro-MMP using an expression cloning strategy, and demonstrated that active MMPs digest KiSS-1 protein and metastin peptide between Gly118 and Leu119. This inactivates the ligand activity of metastin.

Results

Figure 1 Expression cloning. Single clones of plasmid DNA indicated by the first screening of human placenta cDNA library were cotransfected again with MMP-9, MMP-2 and MT5-MMP plasmids into 293 T cells cultured in 96-well microplates as described in Materials and methods, and cell lysates were subjected to gelatin zymography at 48 h post-transfection. Note that 110 kDa gelatinolytic band is observed in lane 2

Screening of human placenta cDNA library Plasmid DNA from the human placenta cDNA library was cotransfected with MMP-2, MMP-9 and MT5MMP cDNA into 293 T cells, and cell lysates were analysed by gelatin zymography. Transfection with MMP-2, MMP-9 and MT5-MMP cDNA generated a 92 kDa gelatinolytic band of latent pro-MMP-9 and 68 kDa band of latent pro-MMP-2. Cotransfection of one of the pools of cDNA generated another faint gelatinolytic band of 110 kDa in the first screening (data not shown). A single cDNA clone, the expression of which generated a clear 110 kDa gelatinolytic band (Figure 1, lane 2), was obtained by a second screening, and the nucleotide sequence of the 650 bp cDNA fragment was determined. Homology search analysis revealed that this clone is derived from the metastasis suppressor gene KiSS-1 (GeneBankt Accession number NM_002256). KiSS-1 protein forms a stable complex with MMP The KiSS-1 gene encodes a 145-amino-acid protein with N-terminal leader sequence of 19-amino-acid residues, and thus the secreted protein has 126-amino-acid residues (Kotani et al., 2001; Muir et al., 2001; Ohtaki et al., 2001). To examine whether the 110 kDa gelatinolytic band detected as above is derived from a complex between KiSS-1 protein and MMP-9, KiSS-1 protein tagged with FLAG epitope was coexpressed with MMP-9, and KiSS-1-FLAG protein collected from the culture supernatant using anti-FLAG antibody beads was analysed by gelatin zymography (Figure 2). A gelatinolytic activity of 110 kDa was co-precipitated with KiSS-1-FLAG from the culture supernatant of cells Oncogene

transfected with MMP-9 and KiSS-1-FLAG plasmids, but not from conditioned medium of cells transfected with MMP-9 or KiSS-1-FLAG plasmid alone. MMP-2 and MMP-2 mutant lacking the C-terminal fibronectinand hemopexin-like domains (DMMP-2) were also tested for the complex formation with KiSS-1-FLAG. Although coexpression of KiSS-1-FLAG with MMP-2 or DMMP-2 did not generate an apparent new retarded band in gelatin zymography, MMP-2 and DMMP-2 were coprecipitated with KiSS-1-FLAG as 88 and 68 kDa bands, respectively. These results suggest that pro-MMP forms a stable complex with KiSS-1 protein. Next, to confirm complex formation between proMMP and KiSS-1 protein in vitro, recombinant KiSS-1 protein and KiSS-1 mutant proteins lacking C-terminal 24-amino-acid residues (D122–145) and N-terminal 48amino-acid residues (D20–67) were synthesized (Figure 3a). Pro-MMP-9, pro-MMP-2 or pro-DMMP2 was incubated with the recombinant KiSS-1 proteins, which were subsequently subjected to gelatin zymography (Figure 3b). Incubation of pro-MMP-9, pro-MMP2 or pro-DMMP-2 with recombinant KiSS-1 protein generated retarded bands of 110, 88 or 68 kDa bands, respectively. The intensity of each retarded band reached plateau at 2 ng KiSS-1 protein per 10 ml reaction volume (1.3  108 m), and was not increased even with higher doses of 1.3  106 m (data not shown). KiSS-1 mutant protein D122–145 also formed a complex with each pro-MMP, which migrated slightly faster than the complex with KiSS-1 protein. However, the D20–67 mutant KiSS-1 protein failed to generate the retarded band. Furthermore, active MMP-2 did not generate the

Cleavage of KiSS-1 by MMP T Takino et al

4619

Figure 2 In vivo complex formation between pro-MMP and KiSS-1 protein. Expression plasmids for MMP-9, MMP-2 or DMMP-2, respectively, were transfected into 293 T cells either alone (lanes ) or with KiSS-1-FLAG plasmid (lanes þ ). Culture supernatants were subjected to gelatin zymography (lanes Sup.). KiSS-1-FLAG protein was collected from the supernatants of transfected cells with anti-FLAG antibody beads, and coprecipitated MMP was analysed by gelatin zymography (lanes aFLAG)

retarded band with KiSS-1 protein, even in the presence of MMP inhibitor BB-94. These results suggest that Nterminal 48-amino-acid region of KiSS-1 protein (amino-acid residues 20–67 of the full-length KiSS-1 protein) and propeptide domain of MMP are essential for the complex formation. The complex between pro-MMP and KiSS-1 protein was stable even in SDS–PAGE sample buffer, which suggested the possibility that Cys53of KiSS-1 protein and cysteine residue in propeptide domain of MMP may form a disulfide bond. To examine this possibility, KiSS-1 mutant protein with an amino-acid substitution at Cys53 with Ser was prepared, and analyzed for the complex formation (Figure 3c). Mutation of Cys53 abolished complex formation with pro-MMP. However, the complex was shown to be dissociated partially at 561C and completely by boiling, indicating that disulfide bond is not formed in the complex (data not shown). These results suggest that the N-terminal 48-amino-acid region of KiSS-1 protein (amino-acid residues 20–67 of the full-length KiSS-1 protein), particularly Cys53, and the propeptide domain of MMP are essential for the complex formation. In order to confirm the association between the N-terminal 48-amino-acid region of KiSS-1 protein and pro-MMP, KiSS-1-D66-145-FLAG protein (amino-acid residues 20–65) was coexpressed with pro-MMP-9, and the complex collected by anti-FLAG antibody beads was examined by gelatin zymography (Figure 3d). The complex was detected as a gelatinolytic band which migrated slightly slower than that of pro-MMP-9. Cleavage of KiSS-1 protein by MMP Recombinant KiSS-1 protein was tested as to whether it was digested by active MMP. Incubation of recombinant KiSS-1 protein (16 kDa) with recombinant MT1-

MMP resulted in two fragments of 6 and 10 kDa (Figure 4a). The N-terminal amino-acid sequence of the 6 kDa fragment showed that the Gly118-Leu119 peptide bond of KiSS-1 protein was cleaved. KiSS-1 mutant proteins D122–145 and D22–67 were both cleaved at the same site. Substitution of Gly118 with Leu (D22– 67G118L) abolished susceptibility to MT1-MMP. Cleavage of KiSS-1 protein was also demonstrated with MT3-MMP, MT5-MMP, MMP-2 and MMP-9 to give the same cleavage pattern (data not shown). The kinetic parameters of these MMPs on KiSS-1 protein are shown in Table 1. Metastin peptide, which was identified as the ligand of a G-protein-coupled receptor (hOT7T175), is the C-terminally amidated peptide derived from aminoacid residues 68 to 121 of the full-length KiSS-1 protein. The synthetic decapeptide with the common C-terminal motif (metastin 112–121) has an equipotent ligand activity (Ohtaki et al., 2001; Kotani et al., 2001; Muir et al., 2001). Metastin 112–121 peptide was also incubated with recombinant MT1-MMP, and the cleavage products were analysed by HPLC. MT1MMP completely cleaved metastin decapeptide to two fragments (Figure 4b). Other MMPs also showed the same cleavage pattern (data not shown). Inactivation of ligand activity of metastin by MMPs HeLa cells mock transfected or transfected with hOT7T175 gene were either untreated or treated with metastin 112–121 peptide, and then formation of actin stress fibers and focal adhesions were monitored (Figure 5). Treatment with metastin 112–121 peptide had no effect on mock-transfected cells (panel Control). Formation of actin stress fibers by treatment with metastin 112–121 peptide was induced at a moderate level in approximately 45% and at a high level in Oncogene

Cleavage of KiSS-1 by MMP T Takino et al

4620

Figure 3 In vitro complex formation between pro-MMP and KiSS-1 protein. (a) KiSS-1 gene product (full-length KiSS-1), secreted form (KiSS-1), its deletion mutants (D20–67 and D122–145) and metastin peptide (metastin 68–121) are schematically shown (left panel). Recombinant KiSS-1 and its deletion mutant proteins (20 ng each) separated on Tricine–SDS–PAGE were stained with Coomassie Brilliant Blue R-250 (right panel). (b) Pro-MMP-9, pro-MMP-2, pro-DMMP-2 or active MMP-2 incubated with 10 ng of each of the recombinant KiSS-1 proteins on ice for 1 h was subjected to gelatin zymography (panels pro-MMP-9, pro-MMP-2, proDMMP-2 and active MMP-2, respectively). MMP inhibitor BB-94 (107 m final concentration) was added to the reaction mixture of active MMP-2/KiSS-1 (lane KiSS-1 þ BB94). (c) KiSS-1 mutant protein with amino-acid substitution of Cys56 with Ser (lane C56S) was compared with wild-type KiSS-1 protein (lane KiSS-1) for the complex formation with pro-DMMP-2 as described above. (d) An expression plasmid for MMP-9 was cotransfected with KiSS-1-D66–145-FLAG plasmid, and culture supernatants (lanes Sup.) and materials collected from the supernatants with anti-FLAG antibody beads (lanes aFLAG) were subjected to gelatin zymography

Oncogene

Cleavage of KiSS-1 by MMP T Takino et al

4621

Figure 4 Cleavage of KiSS-1 protein and metastin peptide by MMP. (a) Recombinant KiSS-1 or its mutant protein (50 ng) was incubated with recombinant MT1-MMP (5 ng) for 2 h, and was separated on Tricine–SDS–PAGE. Note that 11 kDa band of KiSS-1 protein may be derived from autoprocessing at Arg66Arg67. (b) Metastin 112–121 peptide (10 mm in 50 ml TNC buffer) (upper panel) was incubated with 50 ng recombinant MT1-MMP for 5 h (lower panel), and was analyzed by HPLC as described in Materials and methods

Table 1 Kinetic parameters of MMPs on KiSS-1 protein MMP MT1-MMP MT3-MMP MT5-MMP MMP-2 MMP-9

Km (mm)

kcat (h1)

kcat/Km (mm1 h1)

1.1 1.6 4.5 3.2 6.5

122 105 78 101 84

111 65.6 17.3 31.6 12.9

TIMP-2 significantly interfered with cell migration in the presence of metastin 112–121. Migration of mocktranfected cells was not affected by metastin 112–121 peptide even in combination with BB-94 (data not shown). Treatment of cells with 100 nm metastin 112– 121 inhibited migration of cells expressing hOT7T175 gene even in the absence of BB-94 (data not shown).

Discussion approximately 35% of cells transfected with hOT7T175 gene (panels GPCR; metastin a and b, respectively). Approximately the rest of 20% cells showed round morphology (panel c). Formation of focal adhesions was also apparent in cells with high level of actin stress fibers. These morphological changes are comparable with those reported in the previous report (Ohtaki et al., 2001). However, metastin 112–121 peptide cleaved by MT1-MMP did not show any effect on either mock- or hOT7T175 gene-transfected cells. Metastin was reported to suppress motility of cells expressing the receptor hOT7T175 (Kotani et al., 2001; Ohtaki et al., 2001). To study the effects of MMP on metastin-induced suppression of cell motility, HT1080 cells, which express high MMP activity, were stably transfected with the hOT7T175 cDNA (Figure 6). RT– PCR analysis showed that HT1080 cells do not express detectable levels of endogenous hOT7T175 gene, and cells transfected with hOT7T175 cDNA expressed high levels of the gene. The effect of metastin 112–121 peptide on motility of HT1080 cells transfected with hOT7T175 gene was examined by wound-induced migration assay. Treatment of cells with 10 nm metastin 112–121 peptide alone showed only a slight effect, and MMP inhibitor BB-94 alone had a negligible effect on cell migration. Treatment of cells with metastin 112–121 in combination with BB-94 clearly suppressed migration. Recombinant tissue inhibitors of MMPs (TIMP)-1 and TIMP2 were also tested for their inhibitory effect on cell migration. TIMP-1 did not show an apparent effect on migration of cells expressing hOT7T175 gene; however,

Recently, various substrates for MMPs other than ECM components have been discovered such as adherence molecules, cytokines/growth factors and cell surface receptors (Powell et al., 1999; Gearing et al., 1994; Levi et al., 1996; Suzuki et al., 1997; Van den Steen et al., 2000; Ito et al., 1996; Fowlkes et al., 1994; Hiller et al., 2000; McQuibban et al., 2000, 2001, 2002). While the physiological significance of these activities of MMPs still remains to be explored, MMPs appear to be involved in the regulation of various events taking place at the cell–ECM interface. The human metastasis suppressor gene KiSS-1 encodes a 145-amino-acid protein with a 19-amino-acid signal peptide (Kotani et al., 2001; Ohtaki et al., 2001). The secreted KiSS-1 protein is processed at potential dibasic processing site (Arg66Arg67) and cleavage/amidation site (Gly122 Les123 Arg124) to generate the amidated 54-amino-acid peptide termed metastin (Ohtaki et al., 2001). The 13- and 14-amino-acid peptides, each with a common C-terminal amidated motif, were also isolated from human placenta as the ligand of G-protein-coupled receptor hOT7T175 (Muir et al., 2001), and these peptides and a synthetic decapeptide (metastin 112– 121) showed an equipotent ligand activity (Kotani et al., 2001; Muir et al., 2001; Ohtaki et al., 2001). Metastin induces an increase in intracellular calcium ion concentration and excessive formation of focal adhesion by phosphorylating focal adhesion kinase (FAK) and paxillin in cells expressing hOT7T175, which may contribute to attenuation of cellular motility and Oncogene

Cleavage of KiSS-1 by MMP T Takino et al

4622

Figure 5 Inactivation of metastin by MMP. HeLa cells cotransfected with GFP and control plasmids (panels Control) or hOT7T175 cDNA (GPCR) were treated with vehicle (), 100 nm metastin 112–121 peptide (metastin) or metastin 112–121 peptide preincubated with MT1-MMP (metastin/MT1-MMP) at 48 h after transfection for 1 h, and then stained with rhodamine-phalloidin. Rhodaminephalloidin staining of GFP-positive cells was photographed. Three types of morphological changes are shown for hOT7T175expressing cells treated with metastin peptide (panels a, b and c, respectively)

invasion (Kotani et al., 2001; Ohtaki et al., 2001). Metastin also stimulated arachidonic acid release, ERK1/2 and p38 MAP kinase phosphorylation (Kotani et al., 2001). Despite activation of the ERK pathway, metastin inhibited the proliferation rate of the cells expressing hOT7T175 (Kotani et al., 2001). Metastin may block tumor metastasis by functioning at multiple steps of metastasis. In the present study, we found the KiSS-1 gene product to form a stable complex with pro-MMP-2 and pro-MMP-9 through the propeptide domain of MMP and the N-terminal 48-amino-acid region including Cys53 of KiSS-1 protein. The N-terminal 48-amino-acid fragment would be generated by the cleavage of secreted KiSS-1 protein at the dibasic processing site Arg66Arg67. The binding of KiSS-1 protein with the propeptide domain of MMP suggested a possible association with pro-MMP activation; however, neither KiSS-1 protein nor N-terminal 48-amino-acid fragment could be shown to affect pro-MMP-2 or pro-MMP-9 processing by 4aminophenylmercuric acetate, trypsin or MT1-MMP (unpublished data). The affinity of KiSS-1 protein with pro-MMP is high, and the complex is stable even at 561C in the presence of 1% SDS; however, the complex is formed with only 20% of the available pro-MMP at the most even at higher KiSS-1 protein concentrations. KiSS-1 protein may bind to pro-MMP in which binding of propeptide domain to the catalytic domain is rather Oncogene

loose. The physiological significance of complex formation between pro-MMP and KiSS-1 protein still remains to be explored. The complex between KiSS-1 protein and pro-MMP is so stable that processing of KiSS-1 protein to form an active metastin peptide may be interfered by the complex formation. The present study also demonstrated that active MMPs cleave the Gly118-Leu119 peptide bond of KiSS-1 protein located 3-amino-acid residues upstream of the C-terminus of metastin peptide. MMPs also cleaved metastin decapeptide and inactivated its ligand activity. These results indicate that MMPs can cleave to inactivate all metastin peptides in placenta with 54-, 14- and 13-amino-acid residues. KiSS-1 mRNA is extremely abundant in the placenta, and low levels of message are also found in the brain and more specifically in the hypothalamus and basal ganglia (Muir et al., 2001). This distribution pattern is almost consistent with the mRNA localization of the receptor hOT7T175 (Muir et al., 2001; Ohtaki et al., 2001). Expression of MMPs including MT1-MMP is also quite high in placenta (Sato et al., 1994), and expression of some of MMPs, for example, MT3-MMP, MT5-MMP and MT6-MMP is specific for the brain (Takino et al., 1995; Llano et al., 1999; Pei, 1999; Jaworski, 2000; Velasco et al., 2000). Thus, MMPs should play a central role in the metabolism of KiSS-1 protein/metastin peptide in placenta and the central nervous system.

Cleavage of KiSS-1 by MMP T Takino et al

4623

Figure 6 Synergistic effect of Metastin and MMP inhibitor. (a) Total RNA from mock- (lane Mock) or hOT7T175 gene-transfected HT1080 cells (lane GPCR) were analysed by RT–PCR for the expression of hOT7T175 (panel GPCR) and GAPDH gene (panel GAPDH). (b) Wound-induced migration assay of cells expressing hOT7T175 gene was performed in a medium containing vehicle (–), 1 mm BB-94 (BB-94), 10 nm metastin 112–121 peptide (metastin), BB-94 plus metastin 112-121 peptide (BB-94 þ metastin), 1 mg/ml recombinant TIMP-1 (TIMP-1), recombinant TIMP-1 plus metastin 112–121 (TIMP-1 þ metastin), 1 mg/ml recombinant TIMP-2 (TIMP-2) and recombinant TIMP-2 plus metastin 112–121 (TIMP-2 þ metastin). Cells were photographed 12 h after scraping. (c) Migration distance was presented as the average of 10 points for each culture

The metastin/hOT7T175 system may have important physiological roles both in the central nervous system and in tumor biology, and MMPs may be involved in the spatial and temporal regulation of metastin activity

by degrading metastin/KiSS-1 protein. The placenta is an invasive tissue, and there are similarities in the behavior of invading placenta cells and that of invading cancer cells (Murray and Lessey, 1999). Invasive and Oncogene

Cleavage of KiSS-1 by MMP T Takino et al

4624

metastatic tumors often express higher MMP activity, and thus it is possible to assume that metastin peptide may be degraded by MMPs in these tumor tissues. Indeed motility of HT1080 cells expressing hOT7T175, which synthesize high levels of MMPs including MT1MMP, was suppressed by metastin peptide only in the presence of MMP inhibitor BB-94. Selective inhibition by TIMP-2 but not by TIMP-1 suggested that MT1MMP plays a major role in the inactivation of metastin peptide in HT1080 cells expressing hOT7T175. Some human cancers express hOT7T175 but are deficient in metastin (Ohtaki et al., 2001). We propose that a combination of metastin with MMP inhibitor or MMPresistant metastin peptide would show a more potent antimetastatic effect.

Materials and methods Materials Dulbecco’s modified Eagles’s medium (DMEM) was from Nissui Pharmaceutical Co., Ltd (Tokyo, Japan). Primers were synthesized by Genset (Kyoto, Japan). A human placenta cDNA library constructed in pEAK8 expression vector was obtained from EdgeBio Systems (Gaithersburg, MD, USA). Expression plasmids for MMP-2, C-terminally truncated MMP-2 (DMMP-2), MMP-9, MT1-MMP and MT5-MMP were as described previously (Miyamori et al., 2001). Recombinant MT1-MMP and MT3-MMP catalytic domains tagged with FLAG epitope at the C terminus were prepared as described previously (Kinoshita et al., 1998; Shimada et al., 1999). Active MMP-2 and MMP-9 were purchased from Yagai Co. Ltd (Yamagata, Japan). Recombinant TIMP-1 and TIMP-2 were from Daiichi Fine Chemical Co. Ltd (Takaoka, Japan). Monoclonal antibodies against FLAG and 6His epitope were purchased from Sigma (St Louis, MO, USA) and Santa Cruz Biotech. (Santa Cruz, CA, USA), respectively. C-terminally amidated Metastin decapeptide corresponding to residues 112–121 of the full-length KiSS-1 protein was purchased from Wako Chemicals Co. Ltd (Kyoto, Japan). Cell culture Human embryonic kidney 293 T, fibrosarcoma HT1080 and HeLa cells were obtained from ATCC, and cultured in DMEM supplemented with 5% fetal calf serum. Expression cloning Expression cloning to identify genes, the products of which interact with MMP-2, MMP-9 or MT5-MMP, was performed as described previously except that MT5-MMP plasmid was used in place of MT1-MMP plasmid (Miyamori et al., 2001). Construction of an expression plasmid for KiSS-1 tagged with FLAG FLAG epitope-tagged KiSS-1 (KiSS-1-FLAG) expression plasmid was constructed to collect KiSS-1 protein by antiFLAG M2 antibody conjugated with Sepharose beads (Sigma). A KiSS-1 cDNA fragment that has a Bgl II restriction site in place of the stop codon was generated by PCR using KiSS-1 cDNA cloned in pEAK8 plasmid as a template and pEAK8 forward primer/flanking reverse primer with an extra Bgl II site (underlined) starting at nucleotide 492 of KiSS-1 Oncogene

gene (GeneBankt Accession number NM_002256) (ATAGATCTGCCCCGCCCAGCGCTTCTGCCG). The amplified fragment was digested with Hind III and Bgl II, and was inserted into the Hind III and Bgl II sites of pSG-FLAG vector as described previously (Miyamori et al., 2001). KiSS-1-D66145-FLAG plasmid was constructed as above using pEAK8 forward primer and flanking reverse primer with an extra Bgl II site (underlined) starting at nucleotide 492 of the KiSS-1 gene (CCAGATCTGCTCAGCCTGGCAGTAGCAGCT). Detection of complex between KiSS-1 protein and pro-MMP An expression plasmid for KiSS-1-FLAG (400 ng) was cotransfected with either MMP-2, DMMP-2 or MMP-9 plasmid (100 ng) into 293 T cells cultured in 24-well microplates using TransIT LT1 transfection reagent according to the manufacturer’s instructions (Mirus, Madison, WI, USA). At 48 h after transfection, culture supernatants were harvested and KiSS-1-FLAG protein was collected with anti-FLAG M2 antibody beads. The beads were washed five times with phosphate-buffered saline (PBS) by centrifugation, incubated in 20 ml sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) sample buffer (50 mm Tris-HCl, 2% SDS, 10% glycerol, 0.1% bromophenol blue; pH 6.8) at 371C for 30 min, and subjected to gelatin zymography. Synthesis of recombinant KiSS-1 protein A DNA fragment encoding 6His plus stop codon was created by inserting annealed oligo DNAs (plus strand, GATCTCATCATCATCATCATCATTGAG; minus strand, GAT CCATGATGATGATGATGATGATGA) at the Bgl II site of the FLAG-CTC plasmid (IBI FLAG Biosystems, NY, USA) (designated as 6His-CTC). KiSS-1 cDNA fragments encoding amino-acid 20–145 (KiSS-1) and 68–145 (D20–67) were generated by PCR using flanking forward primers with an extra Xho I site (underlined) starting at nucleotide 136 and 279 (ACCTCGAGGAGCCATTAGAAAAGGTGGCCT and GAG CCTCGAGGGGACCGCTCTGTCCCCGCC, respectively) and reverse primer starting at nucleotide 492 as described above. A KiSS-1 cDNA fragment encoding aminoacids 20–121 (D122–145) was PCR amplified using a flanking forward primer starting at nucleotide 136 as described above and a reverse primer with an extra Bgl II site (underlined) starting at nucleotide 441 (CGAGATCTGAAGCGCAGGCCGAAGGAG TTC). A cDNA fragment encoding a KiSS-1 mutant protein in which Leu119 was substituted with Gly was generated by PCR amplification of KiSS-1 cDNA using mutagenesis primers (antisense, GGAACTCCTTCGGCGGGCGCTTCGGCAAGC; sense, GCTTGCCGAAGCGCCCGCCGAAGGAGTTCC), which contain mutated nucleotides (underlined). Each amplified DNA fragment was digested with Xho I and Bgl II, and inserted into the Xho I and Bgl II sites of 6His-CTC vector. The BL20 E. coli strain was transformed with these plasmids, and the protein expression was induced by 0.5 mm isopropyl-bthiogalactopyranoside. Cells were collected, and then sonicated in PBS containing 0.5% Triton X-100. Proteins tagged with 6His were purified from the supernatant by an Ni2 þ chelating Sepharose (Amerhsam Pharmacia Biotech., Piscataway, NJ, USA), and dialyzed against TNC buffer (50 mm Tris-HCl, 150 mm NaCl, 10 mm CaCl2, 0.02% NaN3). Expression of recombinant MT5-MMP An MT5-MMP cDNA fragment encoding the catalytic domain (amino acids 154–327) was PCR amplified using a flanking forward primer with an extra Hind III restriction site

Cleavage of KiSS-1 by MMP T Takino et al

4625 (underlined) starting at nucleotide 472 (GeneBankt accession number AB021227) (TCAAGAAGCTTGCCCTGACTGGACAGAAGT) and a reverse primer with an extra Sal I site (underlined) starting at nucleotide 984 (TCGGCGTCGACTCCATAGATCT TCTGGATG). The amplified fragment was digested with Hind III and Sal I, and was inserted into the Hind III/Sal I site of the FLAG-CTC vector. Recombinant protein was expressed in the BL20 E. coli strain, and purified as described previously (Kinoshita et al., 1998; Shimada et al., 1999).

were autoradiographed using the Bioimage Analyzer BAS 1000 (Fuji Photo Film, Tokyo, Japan) to calculate the initial velocity of cleavage of KiSS-1 protein. Visualization of focal adhesions and stress fibers

MMP concentrations were determined by titration of their activities against recombinant TIMP-2 in an assay using McaPro-Leu-Gly-Leu-Dpa-Ala-Arg-NH2 (Wako Chemicals Co. Ltd) at 371C for 1 h (Knight et al., 1992). Residual enzyme activities were measured and plotted versus TIMP-2 concentrations. A linear plot of activity against the inhibitor molarity was extrapolated to be of zero activity at the molarity of the enzyme solution.

A cDNA enconding metastin receptor (hOT7T175) was obtained by RT–PCR with human placenta cDNA as a template using 50 -primer (GCGAATTCATGCACACCGTG GCTACGTCCG) and 30 -primer (CAGATCTGAGAGGGGCGTTGTCCTCCCCCA), which have restriction site for Eco RI and Bgl II, respectively (underlined), and was cloned into the pSG5 (Stratagene) or pCEP4 (Invitrogen) expression vector. HeLa cells cotransfected with 0.5 mg green fluorescence protein (GFP) and 1.5 mg hOT7T175 cDNA were cultured on glass cover slips for 48 h, treated with 10 nm metastin for 1 h, and then stained with rhodamine–phalloidin (Molecular Probes, Eugene, OR, USA). Approximately 30 GFP-positive cells for each culture were observed for rhodamine-phalloidin staining under Zeiss confocal laser microscopy (Carl Zeiss, Inc.).

Determination of the cleavage site of KiSS-1 protein

Wound-induced migration assay

Recombinant KiSS-1 protein (200 ng) was incubated with recombinant MT1-MMP catalytic domain (20 ng) in 50 ml TNC buffer at 371C for 3 h, and generated fragments were separated on Tricine–SDS–PAGE (16.5% total acrylamide) and blotted to PVDF membrane (Millipore, Bedford, MA, USA). The N-terminal amino-acid sequences of each fragment were determined using the Beckman Coulter LF300 aminoacid sequencer. The cleavage products of metastin decapeptide by recombinant MT1-MMP were analysed by high-pressure liquid chromatography (HPLC)-mass spectrometer M-8000 (Hitachi Ltd, Tokyo, Japan) using hydroxyapatite C18MG column (Shiseido Fine Chemicals, Tokyo, Japan).

HT1080 fibrosarcoma cells were transfected with hOT7T175 cDNA cloned in pCEP4, and transfected cells were selected under 400 mg/ml hygromycin B (Gibco-BRL) and pooled. RT– PCR was performed to confirm hOT7T175 gene mRNA expression as described above using glyceraldehydes-3-phosphate dehydrogenase (GAPDH, Accession number BC029618) mRNA as a control gene with flanking forward primer CCACCCATGGCAAATTCCATGGCA starting at nucleotide 206 and flanking reverse primer TCTAGACGGCAGGTCAGGTCCACC starting at nucleotide 803. The woundinduced migration assay was performed as follows. Semiconfluent monolayers of HT1080 cells expressing hOT7T175 gene were scraped with a plastic tip (about 100 nm wide), rinsed in the medium to avoid cells from resetting and cultured in fresh medium for further 12 h. Migrating cells were photographed under microscopy before and after incubation at 10 points for each culture.

Determination of MMP concentrations

Determination of Km and kcat Recombinant KiSS-1 protein was 125I-labeled as described previously (Shimada et al., 1999). Km and Vmax of KiSS-1 cleavage by MMPs were determined using the methods described previously (Shimada et al., 1999). Briefly, 3000 c.p.m. of 125I-labeled KiSS-1 protein was adjusted to the indicated concentrations (20, 25, 33, 50, 100, 200 and 400 ng/ 10 ml) with unlabeled KiSS-1 protein, and was incubated with 2 ng of MMP for 1 h at 371C. The reaction was terminated with SDS–PAGE sample buffer, and was subjected to Tricine– SDS–PAGE. After electrophoresis, the gels were dried, and

Acknowledgements We thank EW Thompson (St Vincent’s Institute of Medical Research) for critical reading of the manuscript. This work was supported in part by Grant-in-Aid for Scientific Research on Priority Areas (HS and TT) from the Ministry of Education, Culture, Sports, Science and Technology of Japan.

References Birkedal HH, Moore WG, Bodden MK, Windsor LJ, Birkedal HB, DeCarlo A and Engler JA. (1993). Crit. Rev. Oral Biol. Med., 4, 197–250. Fowlkes JL, Enghild JJ, Suzuki K and Nagase H. (1994). J. Biol. Chem., 269, 25742–25746. Gearing AJ, Beckett P, Christodoulou M, Churchill M, Clements J, Davidson AH, Drummond AH, Galloway WA, Gilbert R and Gordon JL. (1994). Nature, 370, 555–557. Hiller O, Lichte A, Oberpichler A, Kocourek A and Tschesche H. (2000). J. Biol. Chem., 275, 33008–33013. Ito A, Mukaiyama A, Itoh Y, Nagase H, Thogersen IB, Enghild JJ, Sasaguri Y and Mori Y. (1996). J. Biol. Chem., 271, 14657–14660. Jaworski DM. (2000). Brain Res., 860, 174–177.

Kinoshita T, Sato H, Okada A, Ohuchi E, Imai K, Okada Y and Seiki M. (1998). J. Biol. Chem., 273, 16098–16103. Knight CG, Willenbrock F and Murphy G. (1992). FEBS Lett., 296, 263–266. Kotani M, Detheux M, Vandenbogaerde A, Communi D, Vanderwinden JM, Le Poul E, Brezillon S, Tyldesley R, Suarez-Huerta N, Vandeput F, Blanpain C, Schiffmann SN, Vassart G and Parmentier M. (2001). J. Biol. Chem., 276, 34631–34636. Lee JH, Miele ME, Hicks DJ, Phillips KK, Trent JM, Weissman BE and Welch DR. (1996). J. Natl. Cancer Inst., 88, 1731–1737. Lee JH and Welch DR. (1997). Int. J. Cancer, 71, 1035–1044. Lee JH, Welch DR and Patt WC. (1997). Cancer Res., 57, 2384–2387. Oncogene

Cleavage of KiSS-1 by MMP T Takino et al

4626 Levi E, Fridman R, Miao HQ, Ma YS, Yayon A and Vlodavsky I. (1996). Proc. Natl. Acad. Sci. USA, 93, 7069–7074. Llano E, Pendas AM, Freije JP, Nakano A, Knauper V, Murphy G and Lopez-Otin C. (1999). Cancer Res., 59, 2570–2576. McQuibban GA, Butler GS, Gong JH, Bendall L, Power C, Clark-Lewis I and Overall CM. (2001). J. Biol. Chem., 276, 43503–43508. McQuibban GA, Gong JH, Tam EM, McCulloch CA, ClarkLewis I and Overall CM. (2000). Science, 289, 1202–1206. McQuibban GA, Gong JH, Wong JP, Wallace JL, ClarkLewis I and Overall CM. (2002). Blood, 100, 1160–1167. Miyamori H, Takino T, Kobayashi Y, Tokai H, Itoh Y, Seiki M and Sato H. (2001). J. Biol. Chem., 276, 28204–28211. Muir AI, Chamberlain L, Elshourbagy NA, Michalovich D, Moore DJ, Calamari A, Szekeres PG, Sarau HM, Chambers JK, Murdock P, Steplewski K, Shabon U, Miller JE, Middleton SE, Darker JG, Larminie CG, Wilson S, Bergsma DJ, Emson P, Faull R, Philpott KL and Harrison DC. (2001). J. Biol. Chem., 276, 28969–28975. Murray MJ and Lessey BA. (1999). Semin. Reproductive Endocrinol., 17, 275–290. Nagase H and Woessner Jr JF. (1999). J. Biol. Chem., 274, 21491–21494. Nakada M, Yamada A, Takino T, Miyamori H, Takahashi T, Yamashita J and Sato H. (2001). Cancer Res., 61, 8896–8902. Nomura H, Sato H, Seiki M, Mai M and Okada Y. (1995). Cancer Res., 55, 3263–3266. Ohtaki T, Shintani Y, Honda S, Matsumoto H, Hori A, Kanehashi K, Terao Y, Kumano S, Takatsu Y, Masuda Y,

Oncogene

Ishibashi Y, Watanabe T, Asada M, Yamada T, Suenaga M, Kitada C, Usuki S, Kurokawa T, Onda H, Nishimura O and Fujino M. (2001). Nature, 411, 613–617. Pei D. (1999). J. Biol. Chem., 274, 8925–8932. Powell WC, Fingleton B, Wilson CL, Boothby M and Matrisian LM. (1999). Curr. Biol., 9, 1441–1447. Sato H, Takino T, Okada Y, Cao J, Shinagawa A, Yamamoto E and Seiki M. (1994). Nature, 370, 61–65. Seiki M. (1999). Apmis, 107, 137–143. Shimada T, Nakamura H, Ohuchi E, Fujii Y, Murakami Y, Sato H, Seiki M and Okada Y. (1999). Eur. J. Biochem., 262, 907–914. Shirasaki F, Takata M, Hatta N and Takehara K. (2001). Cancer Res., 61, 7422–7425. Stetler-Stevenson WG, Aznavoorian S and Liotta LA. (1993). Annu. Rev. Cell Biol., 9, 541–573. Suzuki M, Raab G, Moses MA, Fernandez CA and Klagsbrun M. (1997). J. Biol. Chem., 272, 31730–31737. Takino T, Sato H, Shinagawa A and Seiki M. (1995). J. Biol. Chem., 270, 23013–23020. Ueno H, Nakamura H, Inoue M, Imai K, Noguchi M, Sato H, Seiki M and Okada Y. (1997). Cancer Res., 57, 2055–2060. Van den Steen PE, Proost P, Wuyts A, Van Damme J and Opdenakker G. (2000). Blood, 96, 2673–2681. Velasco G, Cal S, Merlos-Suarez A, Ferrando AA, Alvarez S, Nakano A, Arribas J and Lopez-Otin C. (2000). Cancer Res., 60, 877–882. Woessner JJ and Gunja SZ. (1991). J. Rheumatol Suppl., 27, 99–101. Yan C, Wang H and Boyd DD. (2001). J. Biol. Chem., 276, 1164–1172.

Suggest Documents