Clinical & Experimental Cardiology

Clinical & Experimental Cardiology

Gorokhova et al., J Clin Exp Cardiolog 2014, 5:6 http://dx.doi.org/10.4172/2155-9880.1000317

Research Article

Open Access

Different Association of CRY1 and CLOCK Circadian Genes with Coronary Atherosclerosis Gorokhova SG1,2*, Generozov EV3, Atkov OYu2,4, Muraseeva EV2, Naumov VA3, Babikova EA3, Zaharczevskaya NB3 and Prigorovskaya TS2 1I.M.

Sechenov First Moscow State Medical University, Moscow, Russia

2Clinical

Research Centre JSC Russian Railways, Moscow, Russia

3Research 4N.I.

Institute of Physical-Chemical Medicine, Moscow, Russia

Pirogov Russian State Medical University, Moscow, Russia

*Corresponding author: Svetlana Gorokhova, Research Clinical Center of the Russian Railways, Moscow, Russia, I.M. Sechenov First Moscow State Medical University, Moscow, Russia; 20, Chasovaya str., Moscow, Russia 125315, Tel: +7-499-151-12-06; E-mail: [email protected] Rec date: May27, 2014, Acc date: Jun 23, 2014, Pub date: Jun30, 2014 Copyright: © 2014 Gorokhova SG, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Abstract There is strong evidence that coronary artery disease (CAD) is associated with polymorphisms in several genes connected with dyslipidaemia, impaired blood coagulation, inflammation and other factors of the CAD. This suggests the existence of genes that coordinate the activity of risk alleles. Circadian genes are of special interest in this respect; however, the extent of their relationship with coronary atherosclerosis is not known. Our study on polymorphisms of CRY1 and CLOCK circadian genes in patients with CAD revealed the connection between CRY1 gene and coronary atherosclerosis, and CLOCK gene and risk factors of CAD. Qualitative and quantitative analysis showed that Т allele of variant rs8192440 in CRY1 is linked to a higher risk of coronary artery involvement. CLOCK gene rs1801260 is associated with cholesterol, increased BMI, diabetes mellitus. Because circadian genes are also responsible for synchronization of metabolic processes including lipid metabolism, they may be involved into CAD development in a direct (biorhythmicity disturbances such as time shifts or disruption in cycles of atherogenic mechanisms) and indirect way (by affecting various components of atherosclerotic process).

Keywords: Coronary artery disease, Coronary atherosclerosis, Circadian genes

Introduction Cardiovascular diseases remain one of the leading causes of mortality and one of the central problems of medicine. Much attention is paid to the coronary artery disease (CAD), which is requires costly and time-consuming treatment and may lead to loss of working capacity and death, including sudden death [1]. Intensive study of CAD in various populations demonstrated that its development is connected with genetic factors. Genome-wide association studies (GWAS) provided strong evidence that the disease is associated with polymorphisms of several dozens of genes, some of which are connected to dyslipidaemia, arterial hypertension, impaired blood coagulation, inflammation etc [2-6]. There is a high probability that every single case of CAD, characterized by a range of clinical forms, is influenced by several genetic factors. At the same time, the existence of genes that orchestrate these risk alleles should be assumed. Circadian genes are of interest in this respect. Circadian rhythmicity is typical for physiology and pathophysiology of cardiovascular system (e.g. blood pressure, coagulation, metabolism etc.) [7-9]. For example, sympathoadrenal system, autonomic nervous system, blood pressure and heart rate have a clear cyclic fluctuations within normal 23-28 h independent of external factors. Cardiovascular events such as myocardial infarction, strokes and sudden death more often occur in certain time of a day (the risk is raised in early morning hours) [7,10].

J Clin Exp Cardiolog

Internal regulation of circadian rhythms of the cardiovascular system is mediated by the supra-chiasmatic nucleus of hypothalamus that contains self-oscillating centres of diurnal activity, and melatoninreleasing pineal gland; most cells of heart and vessels contain peripheral oscillators [9,10]. This biological rhythmicity is caused by certain genes that induce and maintain the rhythm of circadian clock. Genes directly and indirectly connected with circadian rhythms were found in humans and other mammals. The key role among today-known human circadian genes belongs to PER, CRY, CLOCK and BMAL1. They encode proteins that take part in positive (CLOCK and BMAL1) and negative (PER and CRY) transcription–translation circadian feedback loops. The aggregation of the threshold level of BMAL1/CLOCK proteins synthesized in nocturnal hours causes a morning activation of PER/CRY genes; when a certain level of PER/CRY proteins is reached, it activates BMAL1/CLOCK genes in evening [9,11-13]. Animal experiments demonstrated that these genes are involved in the regulation of enzymes, transporters, prohormones, signal and other molecules that regulate diurnal functional periodicity of vascular endothelium, myocardium, components of blood clotting etc. [9,13-15]. However, the connection of circadian genes with the development of the coronary atherosclerosis in humans has not been studied yet. The aim of the present work was to study the association of CLOCK и CRY1 genes with the coronary atherosclerosis in patients with CAD.

Atherosclerosis Vascular disease-2nd Edition

ISSN:2155-9880 JCEC, an open access journal

Citation:

Gorokhova SG, Generozov EV, Atkov O, Muraseeva EV, Naumov VA, et al. (2014) Different Association of CRY1 and CLOCK Circadian Genes with Coronary Atherosclerosis. J Clin Exp Cardiolog 5: 317. doi:10.4172/2155-9880.1000317

Page 2 of 7

Materials and Methods

seq

The study included 340 Russian patients (302 men, 38 women, mean age 54.43 ± 8.9) hospitalized in the cardiology division of the N. A. Semashko Central Clinical Hospital no. 2 of the Russian Railways in order to confirm the diagnosis of CAD. A standard protocol of examination included laboratory tests (haemoglobin, lipid profile, glucose, creatinine etc.), ECG, Holter monitoring, ECG stress tests, echocardiography, coronary angiography and genotyping. The analysed risk factors of cardiovascular diseases included dyslipidaemia, arterial hypertension, increased body mass index (BMI), diabetes mellitus and smoking. Clinical and angiographic data were considered before establishing the diagnosis. The presence of coronary artery stenosis revealed by coronary angiography was considered as a proof of coronary atherosclerosis. The degree of coronary atherosclerosis was evaluated by a set of angiography evidences based on the conclusions made by two independent cardiologists. Patients were divided into 5 groups depending on the severity of coronary bed lesion: 0-normal (absence of plaques), I-mild stenosis, II-moderate stenosis, III-severe stenosis, IV-critical stenosis (occlusion of arteries). Intervening gradation considered the number of arteries involved, the extent and the degree of stenosis (I< 50%, II50-75%, III>75%).

Patient Informed Consent After the purpose and nature of all of the procedures were fully explained, written consent was obtained from all patients. The study protocol was approved by the institutional review board at the Research Institute of Physical Chemical Medicine in Moscow, Russia.

Genotyping of CLOCK (rs1801260) and CRY1 (rs8192440) Genes polymorphisms were performed by an allele-specific primer extension of amplified products and detection with a matrix-assisted laser desorption/ionization time-of-flight mass spectroscopy on an Auto Phlex II MALDI-TOF MS (Bruker Daltonics). Genomic DNA was extracted from venous blood samples using the Promega Wizard® Genomic DNA Purification Kit (Promega, USA), as described by the manufacturer. Oligonucleotide primers for polymerase chain reaction (PCR) and mini sequencing were designed using the Primer Express 2.0 software (Applied Biosystems, USA). The standard PCR protocol was carried out in 10 μL of reaction mixture containing 66 mM of Tris–HCl (pH 9.0),16.6 mM of (NH4)2SO4, 2.5 mM of MgCl2, 250 μM of each dNTP, 1 U of Taq DNA polymerase (Promega, Madison WI,USA) and 5 pmol of each primer (Table 1). Initial heating step was at 94°C for 5 min, followed by 37 cycles of 94°C for 30 s, 59°C for 20 s and 72°C for 20s. Gene

CLOCK

CRY1

SNP

rs1801260

Oligonucleotide*

DNA sequence 5’-3’

for

acgttggatgtaaataccagccagcaggag

rev

acgttggatgcaggcacctaaaacactgtc

seq

cagcaggaggtgatcataggggca

for

acgttggatgacagatggcttatcctctgc

rev

acgttggatgtccaaatgcctttccaaacg

rs8192440

tcctctgcagtgtggccagg

Table 1: Primers and probes for genotyping *Forward and reverse oligonucleotide primers for amplification are denoted as «for» and «rev», oligonucleotide probe for minisequencing as «seq». Dephosphorylation of the 5′-end phosphate groups of deoxynucleoside triphosphate in the post-amplification reaction mixture was carried out during incubation with 0.5 U of shrimp alkaline phosphatase (Fermentas, Lithuania) for 20 min at 37°C, followed by inactivation of the enzyme by heating for 10 min at 85°C. The thermocyclic minisequencing reaction was carried out in the reaction mixture of 66 mMTris-HCl, pH 9.0; 16.6 mM (NH4)2SO4; 2.5 mM MgCl2; 0.2 mM dATP; 0.2 mM dTTP; 0.2 mM dCTP; 0.2 mM ddGTP; 20 pmol each probes; and 2 units Termi Pol DNA polymerase (Solis Biodyne, Estonia), using PCR amplified fragments as the matrix. The minisequencing products were obtained according to the following procedure: 94°C for 20 s, 58°C for 20s, and 72°C for 15s, in 70 cycles. The minisequencing products were purified by means of the Spectro CLEAN kit (Sequenom) according to the manufacturer’s instructions. The sample’s aliquot (0.2 to 1 μl) was applied to the matrix dried on the target Anchor Chip (400 μm, Bruker Daltonic, Germany), prepared from the saturated solution of 3-hydroxypicolinic acid (Fluka, Germany) in 50% acetonitrile (Merck, Germany), adding 10 g/ litre dibasic ammonium citrate (Fluka, Germany) and air dried. The mass spectra were obtained on the Auto Flex (Bruker Daltonics, Germany) MALDI-TOF MS in the linear mode using a nitrogen laser with a wavelength of 337 nm and pulse frequency of 9 Hz in the mode of positive ions. Registration and analysis of spectra were executed using Geno Tools v. 2.0 and Flex Analysis v.2.4 (Bruker Daltonics, Germany) software.

Statistical Analysis Statistical analyses were performed using SNP assoc package in R (version 2.10.1). Hardy-Weinberg equilibrium was tested for all SNPs separately in each patients group. Departure from Hardy–Weinberg equilibrium (HWE) for each SNP was assessed by χ2 test. Being a study including only cases, SNPs found outside HWE were analyzed because HWE could be informative for SNPs that confer risk rather than genotyping error. The association between genotype and coronary artery disease stages was estimated using logistic regression and analysed under co-dominant, dominant, recessive and logadditive models. Significance was defined as P< 0.05. The best inheritance model was selected using the Akaike criteria. The reported ORs and 95% CI were adjusted for age and gender. Significant associations between SNPs and artery disease stages were also tested by the Bonferroni test. The PLINK 1.9 software was used for calculation of association SNPs with quantitative traits.

Results Clinical and Pathological Characteristics of Patients The total of 340 patients was examined. Their clinical characteristics are presented in the Table 2; as it can be seen; men prevailed in the general group (88.7%). Risk factors of CAD were




Citation:


Page 3 of 7 observed with various frequencies. The most prevalent conditions, arterial hypertension and increased BMI, were diagnosed in 289 (85.0%) and 245 (72.1%) of patients, respectively. 38.2% patients were tobacco smokers. In 58 patients (17.1%) type II diabetes mellitus was found. Hypercholesterolemia was diagnosed in 183 (53.8%) of patients, and increased LDL and triglycerides in 142 (41.8%) and 101 (29.7%) of patients, respectively. 193 (57.76%) of patients had a myocardial infarction in their medical history. Coronary angiography revealed atherosclerosis of coronary arteries in 277 (81.5%) of patients. 17.0% of them had a mild form of the condition, 22.4% moderate, 22.9%severe and 31.8%a critical stenosis. Variables Total, n

340

Men / women, n

302/38

Age

54.43 ± 8.9

Smokers, n (%)

130 (38.24)

BMI, kg/m2

27.6 ± 4.2

Arterial hypertension, n (%)

289 (85.0)

Diabetes mellitus, n (%)

58 (17.06)

Glucose, mmol/dm3

6.11 ± 0.08

Cholesterol, mmol/dm3

5.57 ± 0.07

HDL, mmol/dm3

1.2 ± 0.025

LDL, mmol/dm3

3.46 ± 0.06

VLDL, mmol/dm3

0.94 ± 0.03

Triglycerids,

mmol/dm3

2.06 ± 0.06

Association of Circadian Genes and Coronary Artery Involvement CRY1 gene The performed analysis revealed a statistically significant association of the rs8192440 polymorphism of CRY1 gene with atherosclerotic lesion of coronary arteries (Table 3). Coronary atherosclerosis was more often found in persons with a recessive T allele; when comparing groups 0 and I–IV, the difference in frequency of artery involvement was statistically significant. The analysis of the groups by the severity of coronary atherosclerosis showed significant differences between group’s I–II and III–IV that is mild and moderate vs. severe and critical. This means that allele T is linked to a higher risk of coronary atherosclerosis according to quantitative and qualitative versions of the test. Genotype

Coronary artery involvement

p value

0

I

II

III

IV

0 – (I–IV)

(I–II) – (III–IV)

CC

46

35

43

37

48

< 0.05

< 0.05

CT+TT

17

12

19

43

40

CC+CT

62

42

57

68

80

< 0.05

> 0.05

TT

1

5

5

12

8

Dominant

Recessive

Table 3: Association of coronary artery involvement and rs8192440 polymorphism of CRY1 gene

Statins, n (%)

96 (28.24)

CLOCK Gene

Creatinine, mmol/dm3

106.7 ± 1.15

LV EF, %

56.88 ± 0.55

No significant association of rs1801260 polymorphism of CLOCK gene with coronary atherosclerosis was found both in quantitative and qualitative tests (Table 4).

Miocardial infarction, n (%)

193 (57.76)

Coronary artery involvement, n (%)

63 (18.53)

Genotype

Coronary artery involvement

p-value

0

I

0

I

0

0 – (I–IV)

0 – (I–IV)

TT

23

18

35

36

41

>0.05

> 0.05

CT+ CC

40

29

27

44

47

TT+CT

55

42

56

69

79

> 0.05

> 0.05

CC

8

5

6

11

9

No (group 0) Dominant

Yes including: I

47 (16.97)

II

62 (22.38)

III

80 (28.88)

IV

88 (31.77)

Table 2: Main clinical characteristics of patients


Recessive

Table 4: Association of coronary arteries involvement and rs1801260 polymorphisms of CLOCK gene



Citation:


Page 4 of 7

Association of CRY1 and CLOCK Genes with Main Traditional Risk Factors of CAD We performed an analysis of the association of CRY1 and CLOCK genes with risk factors that are traditionally linked to the development

of CAD and coronary atherosclerosis, such as tobacco smoking, arterial hypertension, diabetes mellitus, as well as the increase of BMI value and lipid profile abnormalities (Tables 5-7).

CRY1 (rs8192440) genotypes

P-value Dominant

P-value Recessive

Variables СС (1)

СТ (2)

ТТ (3)

Patients, n (%)

209 (61.47)

100 (29.41)

31 (9.12)

Smoking, n (%)

82 (39.61)

36 (35.29)

12 (38.71)

1

0.72

Arterial hypertension, n 179 (86.47) (%)

86 (84.31)

24 (77.42)

0.32

0.79


23 (22.55)

5 (16.13)

0.83

0.48

P-value Dominant

P-value Recessive

37 (17.87)

CLOCK (rs1801260) genotypes TT (1)

СТ (2)

СС (3)

Patients, n(%)

153 (45.0)

148 (43.53)

39 (11.47)

Smoking, n (%)

60 (39.22)

57 (38.51)

13 (33.33)

0.62

0.82

Hypertension, n (%)

124 (81.05)

130 (87.84)

35 (89.74)

0.52

0.09


18 (11.77)

40 (27.03)

7 (17.95)

1

0.003

Table 5: Characteristics of qualitative risk factors in subgroups of patients with different CRY1 (rs8192440) and CLOCK (rs1801260) genotype There were no significant associations of rs8192440 polymorphism of CRY1 gene in the studied groups both with quantitative and qualitative risk factors (Tables 5 and 6). At the same time, rs1801260 polymorphism of CLOCK gene was associated with several risk factors of CAD. Diabetes mellitus was diagnosed more frequently in patients with CT genotype (p=0.003; Table 5). Increased BMI more often occurred in subgroups with CT genotype (27.96, CI ± 4.26) compared with subgroups of other genotype (p=0.07782) (Table 7). Total cholesterol was significantly higher in CC genotype then in TT or TC genotype (6.28 ± 1.33 vs. 5.55 ± 1.28 and 5.41 ± 1.36, respectively, p=0.002904). LDL level was also significantly higher in CC genotype (4.07 ± 1.43 vs. 3.43 ± 1.13 and 3.30 ± 1.27, p=0.000572). Variables

2.08 ± 1.11

2.01 ± 1.19

1.98 ± 1.15

0.4871

Table 6: Characteristics of risk factors in subgroups of patients with different CRY1 genotype (rs8192440) Variables

TT (1)

СТ (2)

СС (3)

P-value

Total, n (%)

153 (45.0%)

148 (43.53%)

39 (11.47%)

BMI

27.58 ± 4.08

27.96 ± 4.26

26.40 ± 4.37

0.07782

Glucose, mmol/dm3

6.07 ± 1.43

6.09 ± 1.46

6.35 ± 2.14

0.1722


5.55 ± 1.28

5.41 ± 1.36

6.28 ± 1.33

0.002904

HDL, mmol/dm3

1.17 ± 0.48

1.23 ± 0.46

1.25 ± 0.32

0.3404

LDL, mmol/dm3

3.43 ± 1.13

3.30 ± 1.27

4.07 ± 1.43

0.000572

VLDL, mmol/dm3

0.96 ± 0.55

0.92 ± 0.49

1.42 ± 0.77

0.7869

Triglycerides, mmol/dm3

2.12 ± 1.26

1.99 ± 1.04

2.06 ± 0.93

0.719

CRY1 СС

CRY1 СТ

CRY1 ТТ

(1)

(2)

(3)

Total, n (%)

209 (61.47)

100 (29.41)

31 (9.12)

BMI

27.68 ± 4.14

27.02 ± 3.87

27.64 ± 4.44

0.5334

Glucose, mmol/dm3

6.13 ± 1.64

6.07 ± 1.25

6.14 ± 1.7

0.9925


5.73 ± 1.79

5.17 ± 1.36

5.85 ± 1.38

0.2507

HDL, mmol/dm3

1.22 ± 0.4

1.10 ± 0.26

1.4 ± 1.18

0.6166

LDL, mmol/dm3

3.60 ± 1.22

3.11 ± 1.25

3.60 ± 1.19

0.2104

Discussion

VLDL, mmol/dm3

0.97 ± 0.50

0.90 ± 0.51

0.91 ± 0. 52

0.3349

Circadian genes are involved in the regulation of all basic physiological processes in the human body. They control expression of many genes localized in heart, vessels and other organs and tissues and ensure coherent and rhythmic protein synthesis, which is critical for a


P-value

Triglycerides, mmol/dm3

Table 7: Characteristics of risk factors in groups of patients with different CLOCK genotype (rs1801260)



Citation:


Page 5 of 7 normal functioning of cardiovascular system and synchronization of external and internal biological clock. Circadian disruption and loss of such synchronization is accompanied by the decrease of the adaptation capacity and inability to maintain usual rhythms of processes that ensure adequate coagulation, vascular tone etc. A possible result of this may be emergence and progressive development of cardiovascular diseases. Arterial hypertension and coronary artery disease is naturally more frequent in night shift workers [16]. However, until now there have been no data on the association of circadian genes with coronary atherosclerosis, which is a morphological basis of CAD. The possibility of such association cannot be excluded. Considering that circadian genes are a complex of several continually interacting genes, it is important to find out, which of them may be involved in the development of coronary atherosclerosis. In our case-control study we have initially examined CRY1 (rs8192440) and CLOCK (rs1801260) genes. They were chosen because of their involvement in the regulation of 24 h diurnal rhythm and because they are the key component of the central molecular clock, and at the same time function in different links of this chain: CLOCK in a positive feedback loop, and CRY1 in a negative one. Both genes are expressed in different organs including the heart [14]. The important fact is that these polymorphisms have been evaluated from the point of their prevalence in various populations and in various pathologic conditions. It was established that certain polymorphisms of CRY1 and CLOCK genes are associated with the loss of diurnal rhythmicity, decrease of adaptation capacity to shift schedules, sleep disturbances, and with changes in psychological activity. In particular, CLOCK (rs374947) was associated with depression, and CRY1 (rs8192440) with bipolar disorders and sensitivity to therapy, e.g. lithium [17,18]. In respect of association of the cardiovascular diseases, our experiment showed the importance of CRY1 in the genesis of saltsensitive arterial hypertension [19]. It was noted that cry1/2 null mice had much higher aldosterone production. Kolomeichuk SN et al. [20] demonstrated an association of CLOCK gene (rs1801260, rs34789226, rs4865010) with the arterial hypertension and coronary heart disease in human. However, the association of circadian genes with coronary atherosclerosis have not yet been studied. Our results were first to establish a statistically significant association of CRY1 (rs8192440) gene with coronary atherosclerosis. Presence of T allele is associated with a higher risk of atherosclerotic damage of coronary arteries. While no such link between coronary artery involvement and CLOCK (rs374947) gene was found. It should be noted that we have found no connection of rs8192440 and blood pressure level. An article by Masuki demonstrates a loss of circadian blood pressure variability without change of its mean level in cry1/cry2- mice [21]. We have found no association of alleles of CRY1 rs8192440 gene with changes of blood lipid values. Analysis of other studies provides controversial results. Some works did not notice any difference in lipid profile between cry1−/− and wild type mice at the end of 16-week period of high lipid diet; cry1 mice had a lower fat tissue content [22,23]. Another study showed an increase of fat tissue in cry1−/ −cry2−/− mice with hyper-insulinemia and feeding behaviour disturbances after transition to a high-lipid diet [24]. They notice that CRY gene indirectly controls lipid exchange by participation in the regulation of hepatic gluconeogenesis [25-27].


CLOCK gene has a more definite role in regulation of lipid exchange [28]. Our work demonstrated a link between CC rs1801260 genotype with dyslipidemia (hypercholesterolemia, increase of LDL level). Experimental models proved its connection to dyslipidemia: hypertriglyceridemia and hypercholesterolemia occurred in clock19/19 mice [29]. The development of atherosclerosis in ldlr-/- as well as in apoE-/ mice with normal diet was accelerated because of the rise of plasma cholesterol [30]. It is important that rs1801260 polymorphism of CLOCK gene is also associated with other risk factors of CAD, i.e. increased BMI and diabetes mellitus. It should be taken into account that CLOCK gene is more thoroughly studied compared to CRY gene, and a range of studies shows similar data. An association of several polymorphisms of CLOCK genes with metabolic syndrome (rs 4864548, rs 3736544), obesity, especially abdominal obesity (rs11932595, rs1554483G, rs1554483G и rs4864548A), hypertension (rs1801260), and diabetes mellitus was found [31-33]. Although no direct association of rs1801260 with quantitative or qualitative signs of coronary atherosclerosis was noted, this type of polymorphism should be considered as connected with important risk factors of atherosclerosis. It should me mentioned that our data somewhat disagree with the results of Kolomeichuk et al. on the association of polymorphisms of CLOCK gene (rs1801260, rs34789226, rs4865010) with CAD that revealed significantly higher risk of CAD in men homozygous in C allele rs1801260 [20]. A possible reason of this discrepancy is the lack of coronarographic control in CAD diagnosis. Another cause may be a different ethnic composition of patients, because this study included Karelians (Baltic-Finnic people), while Eastern Slavic persons absolutely prevailed among our patients. Today it is difficult to detect the exact mechanisms of participation of circadian genes in the genesis of coronary atherosclerosis. Nevertheless, some experimental results were collected concerning the involvement of these gens in processes in vascular bed and vascular wall, and in lipid exchange. It was established that catechol-dependant vasoconstriction mediated by alpha-adrenergic receptors was disturbed, and sensitivity of baroreceptors of peripheral vessels was increased in mice with cry1/ cry2-deficiency [15,21]. Along with this, it was found that cry1deficient mice had an impaired activity of the autonomous nervous system with the raise of sympathetic tone in daylight hours accompanied by activation of brown fat tissue [22]. These mice also showed a higher expression of PAI-1 in blood plasma (a risk factor of CAD) compared with wild species [32]. The expression of circadian genes, including cry1 and clock, in apoE-deficient mice induces expression of genes that encode ICAM-1, VCAM1 and other adhesive molecules. These molecules play an important role in early pathogenesis of atherosclerosis. A higher level of ICAM-1 in blood plasma is associated with atherosclerosis [33]. If we extrapolate these facts to humans, the established link between CRY1 and coronary atherosclerosis seems to be proved. The obtained data and literature allows us to suggest that potential association of CRY1 gene with the involvement coronary arteries can be caused by direct activation of sympathetic nervous system, regulation of vascular tone through alpha adrenoceptors, and indirectly by the expression of genes of proteins responsible for the formation of atherosclerotic plaque and hypercoagulation. At the same time, rs1801260 polymorphism of CLOCK gene is associated with many risk factors of CAD, including dyslipidemia, diabetes and



Citation:


Page 6 of 7 obesity. Further studies should be performed for more detailed examination of the involvement of circadian genes in atherogenesis.

14.

Conclusion

15.

Our study on CRY1 and CLOCK circadian genes in patients with CAD revealed the connection between rs8192440 polymorphism of CRY1 gene and coronary atherosclerosis, and between rs1801260 polymorphism of CLOCK gene and risk factors of CAD. In particular, CLOCK gene is associated with cholesterol, increased BMI, diabetes mellitus. Because circadian genes are also responsible for synchronization of metabolic processes including lipid metabolism, they may be involved into CAD development in a direct (biorhythmicity disturbances such as time shifts or disruption in cycles of atherogenic mechanisms) and indirect way (by affecting various components of atherosclerotic process).

16.

Study Limitations The study considered only one polymorphism of CRY1 gene (rs8192440) and CLOCK gene (rs1801260). There are data on the link between other polymorphisms of these genes and other circadian genes Per2, Bmal1 with risk factors of cardiovascular disease, signalling disturbances eNOS and endothelial function which requires further work in this field [34-36].

2.

3. 4. 5.

6. 7. 8. 9. 10. 11. 12. 13.

Go AS, Mozaffarian D, Roger VL, Emelia JB, Jarett DB, et al. (2013) Heart disease and stroke statistics-2013 update: a report from the American Heart Association. Circulation 127: e6-e245. Larson MG, Atwood LD, Benjamin EJ, Cupples LA, D'Agostino RB Sr, et al. (2007) Framingham Heart Study 100K project: genome-wide associations for cardiovascular disease outcomes. BMC Med Genet 8 Suppl 1: S5. Roberts R, Stewart AF (2012) Genes and coronary artery disease: where are we? J Am Coll Cardiol 60: 1715-1721. Arking DE, Chakravarti A (2009) Understanding cardiovascular disease through the lens of genome-wide association studies. Trends Genet 25: 387-394. Hernesniemi JA, Seppa I, Lyytikainen LP, Mononen N, Oksala N, et al. (2012) Genetic Profiling Using Genome-Wide Significant Coronary Artery Disease Risk Variants Does Not Improve the Prediction of Subclinical Atherosclerosis: The Cardiovascular Risk in Young Finns Study, the Bogalusa Heart Study and the Health 2000 Survey – A MetaAnalysis of Three Independent Studies. PLoS One 7: e28931. Roberts R, Stewart AF (2012) Genetics of coronary artery disease in the 21st century. Clin Cardiol 35: 536-540. Guo YF, Stein PK (2003) Circadian rhythm in the cardiovascular system: chronocardiology. Am Heart J 145: 779-786. Portaluppi F, Tiseo R, Smolensky MH, Hermida RC, Ayala DE, et al. (2012) Circadian rhythms and cardiovascular health. Sleep Med Rev 16: 151-166. Takeda N, Maemura K (2011) Circadian clock and cardiovascular disease. J Cardiol 57: 249-256. Dominguez-Rodriguez A, Abreu-Gonzalez P, Kaski JC (2009) Disruption of normal circadian rhythms and cardiovascular events. Heart Metab 44: 11-15. Partch CL, Green CB2, Takahashi JS3 (2014) Molecular architecture of the mammalian circadian clock. Trends Cell Biol 24: 90-99. Lowrey PL, Takahashi JS (2004) Mammalian circadian biology: elucidating genome-wide levels of temporal organization. Annu Rev Genomics Hum Genet 5: 407-441. Dunlap JC (1999) Molecular bases for circadian clocks. Cell 96: 271-290.


18.

19. 20.

21. 22.

References 1.

17.

23. 24.

25. 26. 27. 28. 29. 30. 31. 32. 33.

Young ME (2006) The circadian clock within the heart: potential influence on myocardial gene expression, metabolism, and function. Am J Physiol Heart Circ Physiol 290: H1-16. Paschos GK, FitzGerald GA (2010) Circadian clocks and vascular function. Circ Res 106: 833-841. At'kov OIu (2012) [Blood pressure in night shift workers: circadian rhythms and levels, and their seasonal variation]. Fiziol Cheloveka 38: 88-91. Reszka E, Peplonska B, Wieczorek E, Sobala W, Bukowska A, et al. (2013) Rotating night shift work and polymorphism of genes important for the regulation of circadian rhythm. Scand J Work Environ Health 39: 178-186. McCarthy MJ, Nievergelt CM, Shekhtman T, Kripke DF, Welsh DK, et al. (2011) Functional genetic variation in the Rev-ErbÎ ± pathway and lithium response in the treatment of bipolar disorder. Genes Brain Behav 10: 852-861. Doi M, Takahashi Y, Komatsu R, Yamazaki F, Yamada H, et al. (2010) Salt-sensitive hypertension in circadian clock-deficient Cry-null mice involves dysregulated adrenal Hsd3b6. Nat Med 16: 67-74. Kolomeichuk SN, Makeeva IV, Topchieva LV, Korneva VA, Nemova NN (2011) Association of T3111C polymorphism in 3'-untranslated region of the CLOCK gene with the risk of essential arterial hypertension and coronary artery disease in the Russian population Karelia. Genetika 47: 1411-1415. Masuki S, Todo T, Nakano Y, Okamura H, Nose H (2005) Reduced alpha-adrenoceptor responsiveness and enhanced baroreflex sensitivity in Cry-deficient mice lacking a biological clock. J Physiol 566: 213-224. Griebel G, Ravinet-Trillou C2, Beeské S1, Avenet P1, Pichat P1 (2014) Mice deficient in cryptochrome 1 (cry1 (-/-)) exhibit resistance to obesity induced by a high-fat diet. Front Endocrinol (Lausanne) 5: 49. Ikeda H, Yong Q, Kurose T, Todo T, Mizunoya W, et al. (2007) Clock gene defect disrupts light-dependency of autonomic nerve activity. Biochem Biophys Res Commun 364: 457-463. Barclay JL, Shostak A, Leliavski A, Tsang AH, Jöhren O, et al. (2013) High-fat diet-induced hyperinsulinemia and tissue-specific insulin resistance in Cry-deficient mice. Am J Physiol Endocrinol Metab 304: E1053-1063. Hirota T, Lee JW, St John PC, Sawa M, Iwaisako K, et al. (2012) Identification of small molecule activators of cryptochrome. Science 337: 1094-1097. Lamia KA, Papp SJ, Yu RT, Barish GD, Uhlenhaut NH, et al. (2011) Cryptochromes mediate rhythmic repression of the glucocorticoid receptor. Nature 480: 552-556. Zhang EE, Liu Y, Dentin R, Pongsawakul PY, Liu AC, et al. (2010) Cryptochrome mediates circadian regulation of cAMP signaling and hepatic gluconeogenesis. Nat Med 16: 1152-1156. Hou L, Lu C, Huang Y, Chen S, Hua L, et al. (2009) Effect of hyperlipidemia on the expression of circadian genes in apolipoprotein E knock-out atherosclerotic mice. Lipids Health Dis 8: 60. Turek FW, Joshu C, Kohsaka A, Lin E, Ivanova G, et al. (2005) Obesity and metabolic syndrome in circadian Clock mutant mice. Science 308: 1043-1045. Pan X, Jiang XC, Hussain MM (2013) Impaired cholesterol metabolism and enhanced atherosclerosis in clock mutant mice. Circulation 128: 1758-1769. Sookoian S, Gemma C, Gianotti TF, Burgueño A, Castaño G, et al. (2008) Genetic variants of Clock transcription factor are associated with individual susceptibility to obesity. Am J Clin Nutr 87: 1606-1615. Masuda Y, Emoto N, Nonaka H, Yagita K, Todo T, et al. (2009) Role of angiotensin and the clock system in the circadian regulation of plasminogen activator inhibitor-1. Kobe J Med Sci 54: E264-271. Gao Y, Meng D, Sun N, Zhu Z, Zhao R, et al. (2014) Clock upregulates intercellular adhesion molecule-1 expression and promotes mononuclear cells adhesion to endothelial cells. Biochem Biophys Res Commun 443: 586-591.



Citation:


Page 7 of 7 34.

35.

Dashti HS, Smith CE, Lee YC et al. (2014) CRY1 circadian gene variant interacts with carbohydrate intake for insulin resistance in two independent populations: Mediterranean and North American. Chronobiol Int 31: 660-667. Anea CB, Zhang M, Stepp DW, Simkins GB, Reed G, et al. (2009) Vascular disease in mice with a dysfunctional circadian clock. Circulation 119: 1510-1517.

36.

Wang CY, Wen MS, Wang HW, Hsieh IC, Li Y, et al. (2008) Increased vascular senescence and impaired endothelial progenitor cell function mediated by mutation of circadian gene Per2. Circulation 118: 2166-2173.

This article was originally published in a special issue, entitled: "Atherosclerosis Vascular disease-2nd Edition", Edited by Zhonghua Sun, Department of Imaging and Applied Physics Curtin, University, Australia


