ANTICANCER RESEARCH 27: 3645-3650 (2007)
Clinical Significance of BRAF (V600E) Mutation and Ki-67 Labeling Index in Papillary Thyroid Carcinomas HIROTAKA NAKAYAMA1, AKIRA YOSHIDA2, YOSHIYASU NAKAMURA3, HIROYUKI HAYASHI3, YOUHEI MIYAGI4, NOBUYUKI WADA1, YASUSHI RINO1, MUNETAKA MASUDA1 and TOSHIO IMADA1 1Department
of General Surgery, Yokohama City University Hospital, 3-9 Fukuura, Kanazawa-ku, Yokohama 236-0004; Departments of 2Surgery and 3Pathology, and 4Research Institute, Kanagawa Cancer Center, 1-1-2 Nakao, Asahi-ku, Yokohama 241-0815, Japan
Abstract. Background: Activating mutations of the BRAF gene have recently been reported in thyroid carcinomas. In particular, V600E mutation is highly prevalent in papillary thyroid carcinoma (PTC). Patients and Methods: In this study, the BRAF (V600E) mutation in 54 PTCs was investigated and the relationship between the BRAF mutation and clinicopathological features such as age, gender, tumor size, extrathyroid extension, lymph node metastasis, and distant metastasis was analyzed. Additionally, Ki-67 labeling index (LI) was determined to evaluate tumor cell proliferative activity. Results: The BRAF mutation was detected in 26 (65%) of 40 primary and 12 (85.7%) of 14 recurrent PTCs. The BRAF mutation was significantly related to older age (57.4 vs. 43.1 years, p=0.012), extrathyroid extension (76.9% vs. 35.7%, p=0.026), and lymph node metastasis (88.5% vs. 57.1%, p=0.044). Moreover, the mean Ki-67 LI was significantly higher in BRAF-positive patients than in BRAFnegative patients (1.01% vs. 0.135%, p=0.014). The BRAF mutation was common in PTCs classified as advanced TNM stage. Eighteen of 20 (90%) patients in TNM stages III and IV were positive for this gene mutation. Similarly, the BRAF mutation was investigated in 14 recurrent PTCs and was detected in 85.7% (12 of 14). The BRAF mutation was also common in patients with regional lymph node recurrence. Conclusion: These results suggest that PTCs with BRAF (V600E) mutation are more aggressive than those with wildtype BRAF. This mutation may be important for predicting a worse prognosis in patients with PTC.
Papillary thyroid carcinoma (PTC) is the most common malignant tumor of the thyroid (1). Several genetic events involved in the initiation of PTC have been investigated (2, 3). Recently, an activating point mutation of the BRAF gene has been identified as a common genetic event in PTC (29%-83%) (4-14). BRAF mutations are unique to PTC, because BRAF mutation has not been observed in other thyroid neoplasms such as follicular, Hürthle cell, and medullary carcinoma, or in benign thyroid tumors (4, 5). The BRAF gene codes a cytoplasmic serine/threonine kinase that plays an initial role in the enzymatic cascade of the MAP kinase pathway (15), which is a classic signal pathway known to mediate cellular proliferation in various cell types. Almost all cases of BRAF mutation in thyroid carcinomas involve the same missense thymine (T) to adenine (A) transversion at nucleotide 1799 in exon 15, resulting in the substitution of a valine by glutamate at residue 600 (V600E) (4, 8). This mutation is considered to mimic the phosphorylation in the activation segment by insertion of an acidic residue close to a site of regulated phosphorylation at serine 599 (16). In this study, the BRAF (V600E) mutation in 40 primary and 14 recurrent PTCs and the relationship between the BRAF mutation and clinicopathological features were investigated. Moreover, the Ki-67 labeling index (LI), which expresses the proliferative activity (17-19), was compared between the BRAF mutation-positive and -negative patients.
Patients and Methods Correspondence to: Hirotaka Nakayama, Department of General Surgery, Yokohama City University Hospital, 3-9 Fukuura, Kanazawa-ku, Yokohama 236-0004, Japan. Tel: +81 45 7872645, Fax: +81 45 7860226, e-mail:
[email protected] Key Words: BRAF mutation, Ki-67 labeling index, papillary thyroid carcinoma.
0250-7005/2007 $2.00+.40
Tumor samples. Snap-frozen tumor samples from 54 PTCs (40 primary and 14 recurrent tumors) were used in this study. Recurrent tumors consisted of regional node recurrences, recurrences in the residual thyroid gland, and other sites. The tissues were obtained surgically at the Department of Thyroid Surgery, Kanagawa Cancer Center. All patients signed an informed
3645
ANTICANCER RESEARCH 27: 3645-3650 (2007) consent form in which they approved the collection of fresh thyroid samples to be used for genetic studies. Detection of BRAF (V600E) mutation. Mutation in the BRAF (V600E) gene was detected by direct sequencing. Genomic DNA was extracted from the tissues using a QIAamp DNA mini kit (QIAGEN, Hilden, Germany) and BRAF exon 15 was amplified by polymerase chain reaction (PCR). The following PCR primers were designed to amplify the target exon: forward: GGAAAGCATCTCACCTCATCC, reverse: GTAACTCAGC AGCATCTCAGGGC. Amplifications were carried out for 35 cycles (95ÆC for 30 s, 60ÆC for 30 s, 72ÆC for 60 s). PCR products were purified using a Wizard SV Gel and PCR Clean-up System kit (Promega, WI, USA), and sequenced using a DTCS Kit (Beckman Coulter, CA,USA); the forward primer was used as the sequencing primer. Sequencing products were purified using ethanol precipitation and analyzed using a CEQ 2000XL (Beckman Coulter). Analysis of Ki-67 labeling index (LI). Ki-67 LI as a measure of proliferative activity was investigated by immunohistochemical staining using the monoclonal antibody for Ki-67 antigen (MIB-1; Immunotech, Marseille, France) (20). Immunohistochemistry was performed on paraffin-embedded sections (4-Ìm thick) after microwave pretreatment using the common avidin-biotinperoxidase complex method (Vectastain ABC Kit; Vector Laboratories, Burlingame, CA, USA). MIB-1 was used at 1:100 dilution. The reaction products were developed by incubating the sections with 3,3’-diaminobenzidine tetrahydrochloride (DAB), and then the slides were counterstained with hematoxylin. The Ki-67 LI was calculated as the percentage of Ki-67-positive cells (those having brown nuclei) by counting more than 2000 tumor cells in clearly stained fields. Ki-67 LI was analyzed only in primary PTCs. Evaluation of clinicopathological features. Clinicopathological features were extracted from the chart review, including pathological reports. Tumor-node-metastasis (TNM) staging was determined based on the 6th edition of the American Joint Committee on Cancer (AJCC)/International Union Against Cancer (UICC) TNM classification system (21). Age, gender, tumor size, extrathyroid extension (tumor stage), lymph node metastasis and distant metastasis were evaluated as clinicopathological features. Statistical analysis. Clinicopathological features and Ki-67 LI were compared between BRAF-negative (wild-type) and BRAF-positive (V600E mutation) patient groups. Results are expressed as means ± standard deviation (SD). Statistical analysis was performed with the use of Student’s t-test or the Mann-Whitney test, as appropriate. Frequencies were compared with the Chi-square test and Fisher’s exact probability test. Differences were considered significant when p-values were less than 0.05. Statistical analyses were performed with the Statistical Package for Social Sciences for Windows (SPSS, Inc., Chicago, IL, USA).
Table I. Relationship between the BRAF mutation and clinicopathological features in primary PTCs (n=40). BRAF mutation
Age (yr) [mean±SD] Gender (M:F) Tumor size (mm) [mean±SD] Extrathyroid extension None (T1 or T2) (n=15) Minimal (T3) (n=16) Extensive (T4a) (n=9) Lymph node metastasis Distant metastases TNM stage I + II (n=20) III + IV (n=20) Ki-67 labeling index (%) [mean±SD]
Positive (n=26)
Negative (n=14)
57.4±16.2 10:16 28.4±17.2 20 (76.9%) 6/15 12/16 8/9 23 (88.5%) 3 (11.5%)
43.1±16.6 1:13 20.6±9.26 5 (35.7%) 9/15 4/16 1/9 8 (57.1%) 0 (0%)
8 (30.8%) 12 (85.7%) 18 (69.2%) 2 (14.3%) 1.01±1.25 0.135±0.201
P-value
0.012 0.061 0.130 0.026 0.029
0.044 0.539 0.002 0.014
shown in Table I, which summarizes the relationship between the BRAF mutation and clinicopathological features in 40 primary PTCs. The BRAF-positive patients were significantly older than the BRAF-negative patients (57.4 vs. 43.1 years, p=0.012). There were no significant differences concerning gender or tumor size. Extrathyroid extension was found at a significantly higher rate in BRAFpositive patients compared to BRAF-negative patients (76.9% vs. 35.7%, p=0.026). The frequency of BRAFpositive patients was related to advanced tumor stage. Lymph node metastasis was more common in the BRAFpositive patients (88.5% vs. 57.1%, p=0.044). Distant metastases were found only in BRAF-positive patients, although there was no significant difference between the BRAF-positive and -negative groups. Advanced TNM stages were found in a significantly higher fraction of BRAFpositive patients (69.2% vs. 14.3% for TNM stages III and IV, p=0.002). The mean Ki-67 LI was significantly higher in BRAF-positive patients than in BRAF-negative patients (1.01% vs. 0.135%, p=0.014). Immunohistochemical staining for Ki-67 LI analysis is shown in Figure 2. Similarly, BRAF mutation was investigated in 14 recurrent PTCs and was detected in 85.7% of them (12 of 14), as shown in Table II. The BRAF mutation was common in patients with regional lymph node recurrence.
Discussion Results As shown in Figure 1, BRAF mutation was investigated by direct sequencing analysis. The V600E BRAF mutation was detected in 26 (65%) of 40 primary PTCs. The results are
3646
We analyzed the BRAF (V600E) mutation in primary and recurrent PTCs. Our results revealed the high prevalence of the BRAF mutation in both primary and recurrent PTCs, consistent with the findings of previous investigations (4-14).
Nakayama et al: BRAF Mutation in Papillary Thyroid Carcinoma
The BRAF mutation found in thyroid carcinoma is almost exclusively the T1799A transversion mutation in exon 15. This study focused on the T1799A BRAF mutation. This particular BRAF mutation has only been found in papillary and anaplastic thyroid carcinoma (ATC). The coexistence of papillary and anaplastic components in the same tumor has been found and both harbored the BRAF mutation (4, 22, 23). This finding suggests that ATC with the BRAF mutation might be transformed from PTC with the BRAF mutation. On the other hand, BRAF mutation has never been found in follicular or medullary thyroid carcinomas, or in benign thyroid tumors (4-6, 8, 9, 12). Moreover, Knauf et al. reported that the formation of PTC could be induced in transgenic mice in which expression of the BRAF (V600E) mutant was targeted to thyroid cells (24). Thus, the BRAF mutation in PTCs is considered to be a specific genetic event and may play a fundamental role in the initiation or progression of tumorigenesis of PTC. Previous investigations found the BRAF mutation to be associated with adverse clinicopathological features. In the current study, the BRAF mutation was also associated with older age, extrathyroid extension, lymph node metastasis, and advanced TNM staging. The BRAF mutation was detected in 18 of 20 (90%) patients in stages III and IV. Nikiforova et al. found that the BRAF mutation was significantly related to older age, extrathyroid extension and advanced TNM stages (4). Namba et al. concluded that the BRAF mutation was significantly related to distant metastasis and advanced TNM stages (8). Kim et al. found the BRAF mutation to be significantly associated with lymph node metastasis (11). On the other hand, the BRAF mutation was not significantly related to tumor size in previous reports. Our results were in accordance with these findings. These findings suggest that the BRAF (V600E) mutation may have relevance to biological aggressiveness, including tumor invasion and metastasis to distant sites. Moreover, we analyzed the relationship between the BRAF mutation and Ki-67 LI. The Ki-67 antigen is expressed in the nucleus of proliferating cells (25). Assessment of the tumor cell proliferative activity by Ki-67 staining has been performed in various types of human neoplasms. It is known that the Ki-67 LI in PTCs is lower than that in breast, lung, stomach and colon adenocarcinomas (17). As expected, the mean Ki-67 LI was low, but was significantly higher in the BRAF-positive patients than in the BRAF-negative patients. These findings suggest that the BRAF mutation may activate the MAP kinase pathway, resulting in activated tumor cell proliferation. Activation of the MAP kinase pathway by the BRAF (V600E) mutation may play an important role in thyroid carcinogenesis and tumor progression. Therapeutic agents targeting this pathway are considered to be a promising novel treatment modality for thyroid carcinomas, and a specific inhibitor targeting the Raf kinase has been
reported (26, 27). It is hoped that this inhibitor will be therapeutically useful for patients with the BRAF mutation, particularly for those who have incurable disease. We also found high prevalence of the BRAF (V600E) mutation in recurrent PTCs. Of these, 85.7% (12 of 14) had the BRAF mutation. This finding indicates that the BRAF mutation may have an effect on tumor aggressiveness in PTCs. In particular, BRAF mutation was common in patients with regional lymph node recurrence. Vasko et al. reported the high prevalence of BRAF mutation in lymph node metastasis from BRAF mutation-positive primary tumors (28). They proposed that the local milieu of lymph nodes may specially favor the selection and survival of thyroid cancer cells that harbor BRAF mutation. This may be a reason why the BRAF mutation was common in regional lymph node recurrence in our series. The frequency of lymph node metastasis was significantly higher in BRAF mutation-positive patients than in BRAF mutation-negative patients. These findings suggest that the BRAF mutation may have a significant relationship to nodal status at initial treatment or during the follow-up period for patients with PTC. In summary, we found that the BRAF (V600E) mutation was common in both primary and recurrent PTCs and was significantly related to adverse clinicopathological features such as extrathyroid extension, lymph node metastasis, and advanced TNM staging. These results suggest that PTCs with the BRAF (V600E) mutation are more aggressive than those with wild-type BRAF. This mutation may be important for predicting a worse prognosis in patients with PTC.
References 1 Hundahl SA, Cady B, Cunningham MP, Mazzaferri E, McKee RF, Rosai J, Shah JP, Fremgen AM, Stewart AK and Holzer S: Initial results from a prospective cohort study of 5583 cases of thyroid carcinoma treated in the united states during 1996. U.S. and German Thyroid Cancer Study Group. An American College of Surgeons Commission on Cancer Patient Care Evaluation study. Cancer 89: 202-217, 2000. 2 Zhu Z, Gandhi M, Nikiforova MN, Fischer AH and Nikiforov YE: Molecular profile and clinical-pathologic features of the follicular variant of papillary thyroid carcinoma: an unusually high prevalence of RAS mutations. Am J Clin Pathol 120: 7177, 2003. 3 Santoro M, Carlomagno F, Hay ID, Herrmann MA, Grieco M, Melillo R, Pierotti MA, Bongarzone I, Della Porta G, Berger N, Peix JL, Paulin C, Fabien N, Vecchio G, Jenkins RB and Fusco A: RET oncogene activation in human thyroid neoplasms is restricted to the papillary cancer subtype. J Clin Invest 89: 1517-1522, 1992. 4 Nikiforova MN, Kimura ET, Gandhi M, Biddinger PW, Knauf JA, Basolo F, Zhu Z, Giannini R, Salvatore G, Fusco A, Santoro M, Fagin JA and Nikiforov YE: BRAF mutations in thyroid tumors are restricted to papillary carcinomas and anaplastic or poorly differentiated carcinomas arising from papillary carcinomas. J Clin Endocrinol Metab 88: 5399-5404, 2003.
3647
ANTICANCER RESEARCH 27: 3645-3650 (2007)
Figure 1. Sequence chromatograms of PCR products from primary PTC samples. The mutation (T → A) appeared as a double peak at position 1799 (arrow) in BRAF exon 15 (mutant-type), in contrast to the single peak of the wild-type sample.
Figure 2. A representative example of immunohistochemical staining of PTC with monoclonal antibody MIB-1 directed against the Ki-67 antigen present in proliferating cells. The cells with brown nuclei are regarded as MIB-1 positive. This case was BRAF-positive PTC and the Ki-67 LI was 5.11% (the highest rate in this study). (Magnification x200)
3648
Nakayama et al: BRAF Mutation in Papillary Thyroid Carcinoma
Table II. BRAF (V600E) mutation in primary and recurrent PTCs. Primary PTC (n=40)
26 (65.0%)
Recurrent PTC (n=14) Regional lymph node (n=8) Residual thyroid gland (n=2) Other (n=4)
12 (85.7%) 8 (100%) 1 (50.0%) 3 (75.0%)
5 Kimura ET, Nikiforova MN, Zhu Z, Knauf JA, Nikiforov YE and Fagin JA: High prevalence of BRAF mutations in thyroid cancer: genetic evidence for constitutive activation of the RET/PTC-RAS-BRAF signaling pathway in papillary thyroid carcinoma. Cancer Res 63: 1454-1457, 2003. 6 Puxeddu E, Moretti S, Elisei R, Romei C, Pascucci R, Martinelli M, Marino C, Avenia N, Rossi ED, Fadda G, Cavaliere A, Ribacchi R, Falorni A, Pontecorvi A, Pacini F, Pinchera A and Santeusanio F: BRAFV599E mutation is the leading genetic event in adult sporadic papillary thyroid carcinomas. J Clin Endocrinol Metab 89: 2414-2420, 2004. 7 Trovisco V, Soares P, Preto A, Vieira dC I, Lima J, Castro P, Maximo V, Botelho T, Moreira S, Meireles AM, Magalhaes J, Abrosimov A, Cameselle-Teijeiro J and Sobrinho-Simoes M: Type and prevalence of BRAF mutation are closely associated with papillary thyroid carcinoma histotype and patients’ age but not with tumour aggressiveness. Virchows Arch 446: 589-595, 2005. 8 Namba H, Nakashima M, Hayashi T, Hayashida N, Maeda S, Rogounovitch TI, Ohtsuru A, Saenko VA, Kanematsu T and Yamashita S: Clinical implication of hot spot BRAF mutation, V599E, in papillary thyroid cancers. J Clin Endocrinol Metab 88: 4393-4397, 2003. 9 Fukushima T, Suzuki S, Mashiko M, Ohtake T, Endo Y, Takebayashi Y, Sekikawa K, Hagiwara K and Takenoshita S: BRAF mutations in papillary carcinomas of the thyroid. Oncogene 22: 6455-6457, 2003. 10 Trovisco V, Vieira dC I, Soares P, Maximo V, Silva P, Magalhaes J, Abrosimov A, Guiu XM and Sobrinho-Simoes M: BRAF mutations are associated with some histological types of papillary thyroid carcinoma. J Pathol 202: 247-251, 2004. 11 Kim KH, Kang DW, Kim SH, Seong IO and Kang DY: Mutation of the BRAF gene in papillary thyroid carcinoma in a Korean population. Yonsei Med J 45: 818-821, 2004. 12 Cohen Y, Xing M, Mambo E, Guo Z, Wu G, Trink B, Beller U, Westa WH, Ladenson PW and Sidransky D: BRAF mutation in papillary thyroid carcinoma. J Natl Cancer Inst 95: 625-627, 2003. 13 Soares P, Trovisco V, Rocha AS, Lima J, Castro P, Preto A, Maximo V, Botelho T, Seruca R and Sobrinho-Simoes M: BRAF mutations and RET/PTC rearrangements are alternative events in the etiopathogenesis of PTC. Oncogene 22: 4578-4780, 2003. 14 Xu X, Quiros RM, Gattuso P, Ain KB and Prinz RA: High prevalencer of BRAF gene mutation in papillary thyroid carcinomas and thyroid tumor cell lines. Cancer Res 63: 45614567, 2003. 15 Peyssonnaux C and Eychene A: The Raf/MEK/ERK pathway: new concepts of activation. Biol Cell 93: 53-62, 2001.
16 Davies H, Bignell GR, Cox C, Stephens P, Edkins S, Clegg S, Teague J, Woffendin H, Garnett MJ, Bottomley W, Davis N, Dicks E, Ewing R, Floyd Y, Gray K, Hall S, Hawes R, Hughes J, Kosmidou V, Menzies A, Mould C, Parker A, Stevens C, Watt S, Hooper S, Wilson R, Jayatilake H, Gusterson BA, Cooper C, Shipley J, Hargrave D, Pritchard-Jones K, Maitland N, ChenevixTrench G, Riggins GJ, Bigner DD, Palmieri G, Cossu A, Flanagan A, Nicholson A, Ho JW, Leung SY, Yuen ST, Weber BL, Seigler HF, Darrow TL, Paterson H, Marais R, Marshall CJ, Wooster R, Stratton MR and Futreal PA: Mutations of the BRAF gene in human cancer. Nature 417: 949-954, 2002. 17 Katoh R, Bray CE, Suzuki K, Komiyama A, Hemmi A, Kawaoi A, Oyama T, Sugai T and Sasou S: Growth activity in hyperplastic and neoplastic human thyroid determined by an immunohistochemical staining procedure using monoclonal antibody MIB-1. Human Pathology 26: 139-146, 1995. 18 Kjellman P, Wallin G, Hoog A, Auer G, Larsson C and Zedenius J: MIB-1 index in thyroid tumors: a predictor of the clinical course in papillary thyroid carcinoma? Thyroid 13: 371-380, 2003. 19 Siironen P, Nordling S, Louhimo J, Haapiainen R and Haglund C: Immunohistochemical expression of Bcl-2, Ki-67, and p21 in patients with papillary thyroid cancer. Tumor Biol 26: 50-56, 2005. 20 Cattoretti G, Becker MH, Key G, Duchrow M, Schluter C, Galle J and Gerdes J: Monoclonal antibodies against recombinant parts of the Ki-67 antigen (MIB-1 and MIB-3) detect proliferating cells in microwave-processed formalin-fixed paraffin sections. J Pathol 168: 357-363, 1992. 21 AJCC Cancer staging manual. 6th ed. New York: SpringerVerlag, 2002 22 Begum S, Rosenbaum E, Henrique R, Cohen Y, Sidransky D and Westra WH: BRAF mutations in anaplastic thyroid carcinoma: implications for tumor origin, diagnosis and treatment. Mod Pathol 17: 1359-1363, 2004. 23 Quiros RM, Ding HG, Gattuso P, Prinz RA and Xu X: Evidence that one subset of anaplastic thyroid carcinomas are derived from papillary carcinomas due to BRAF and p53 mutations. Cancer 103: 2261-2268, 2005. 24 Knauf JA, Ma X, Smith EP, Zhang L, Mitsutake N, Liao XH, Refetoff S, Nikiforov YE and Fagin JA: Targeted expression of BRAFV600E in thyroid cells of transgenic mice results in papillary thyroid cancers that undergo dedifferentiation. Cancer Res 65: 4238-4245, 2005. 25 Gerdes J, Lemke H, Baisch H, Wacker HH, Schwab U and Stein H: Cell cycle analysis of a cell proliferation-associated human nuclear antigen defined by the monoclonal antibody Ki-67. J Immunol 133: 1710-1715, 1984. 26 Bollag G, Freeman S, Lyons JF and Post LE: Raf pathway inhibitors in oncology. Curr Opin Investig Drugs 4: 1436-1441, 2003. 27 Karasarides M, Chiloeches A, Hayward R, Niculescu-Duvaz D, Scanlon I, Friedlos F, Ogilvie L, Hedley D, Martin J, Marshall CJ, Springer CJ and Marais R: B-Raf is a therapeutic target in melanoma. Oncogene 23: 6292-6298, 2004. 28 Vasko V, Hu S, Wu G, Xing JC, Larin A, Savchenko V, Trink B and Xing M: High prevalence and possible de novo formation of BRAF mutation in metastasized papillary thyroid cancer in lymph nodes. J Clin Endocrinol Metab 90: 5265-5269, 2005.
Received March 15, 2007 Revised June 14, 2007 Accepted June 20, 2007
3649
