Mol Biol Rep (2010) 37:3283–3289 DOI 10.1007/s11033-009-9913-8
Cloning and characterization of a functional flavanone-3ß-hydroxylase gene from Medicago truncatula Xiaoye Shen • Stefan Martens • Mingliang Chen Daofeng Li • Jiangli Dong • Tao Wang
•
Received: 25 March 2009 / Accepted: 20 October 2009 / Published online: 4 November 2009 Ó Springer Science+Business Media B.V. 2009
Abstract As a key enzyme in the biosynthesis of flavonols, anthocyanidins and proanthocyanidins, flavanone-3ßhydroxylase (F3H) plays very important roles in plant stress response. A putative flavanone-3ß-hydroxylase gene from Medicago truncatula (MtF3H), a model legume species, was identified from a bio-data analysis platform. It was speculated to be induced by salt stress based on the outcomes of the analysis platform. The complementary DNA (cDNA) consists of 1499 bp with an open reading frame (ORF) of 1098 bp, which encodes a putative protein of 365 amino acids with a molecular weight of about 41.36 kDa and an isoelectric point of 5.60. To measure the catalytic activity of the protein, the MtF3H gene was ligated to pYES2 vector and heterologously expressed in yeast. The recombinant protein converted naringen into dihydrokaempferol and displayed different enzymatic efficiencies with other flavanones, confirming that MtF3H coding a functional flavanone-3ß-hydroxylase. The expression pattern of the MtF3H gene was analyzed by comparative quantitative RT-PCR and a higher level of expression was observed in the roots than was observed in stems and leaves. Furthermore, the expression was induced by salt stress in the roots, and to a greater extent in the stems, but the response of the gene activity to salt stress in X. Shen M. Chen D. Li J. Dong (&) T. Wang State Key Laboratory for Agro-biotechnology, College of Biological Sciences, China Agricultural University, Beijing 100193, People’s Republic of China e-mail:
[email protected] X. Shen e-mail:
[email protected] S. Martens Philipps-Universita¨t Marburg, Institut fu¨r Pharmazeutische Biologie, Deutschhausstr. 17A, 35037 Marburg/Lahn, Germany
the stems was slower in the first 12 h following treatment when compared to the roots. Keywords Flavanone-3ß-hydroxylase (F3H, FHT) Medicago truncatula (barrel medic) Salt stress
Introduction Flavonoids, which are among the major secondary metabolites, play very important roles in many higher plants. There are over 10,000 known and diverse flavonoid compounds [1]. Flavonoids are involved in different biological activities including ultraviolet radiation protection, flower coloration, antimicrobial activity, interspecies interactions, plant defense and medicinal properties [2–4]. Flavanone-3ß-hydroxylase (F3H, also FHT; EC 1.14.11.9) belongs to a family of 2-oxoglutarate-dependent dioxygenases (2-ODDs) [5], which also contains flavone synthase I (FNSI; EC 1.14.11.22), flavonol synthase (FLS; EC 1.14.11.23), and anthocyanidin synthase (ANS; EC 1.14.11.19) [6]. The enzymatic activity of F3H is Fe2? and oxoglutarate dependent and this enzyme may convert (2S)flavanones such as naringenin to (2R,3R)-dihydroflavonols such as dihydrokaempferol, which are crucial intermediates in the biosynthesis of flavonols, anthocyanidins, and proanthocyanidins [5]. Since the isolation of the F3H gene from Petunia hybrida [7], it has been cloned from many other species, including Malus pumila [8], Oryza sativa [9], Arabidopsis thaliana [10], Saussurea medusa [11], Ginkgo biloba [12], Medicago sativa [13], and Rubus spp.[14]. Several of these genes have been functionally expressed in yeast or Escherichia coli [7, 9, 15, 16]. Notably, the F3H gene isolated from P. hybrida was investigated extensively [6, 7, 17–21].
123
3284
Mol Biol Rep (2010) 37:3283–3289
M. truncatula is a valuable model legume species. It has a small diploid genome, which is mostly sequenced. It is relatively easy to transform and it is autogamous [22, 23]. There are many useful genetic, proteomic and genomic resources for data mining and metabolic engineering [24–28]. Salinity has adverse effects on arable land, greatly limiting the productivity and quality of agricultural crops [29–31]. Plants have different adaptive mechanisms to reduce oxidative damage resulting from salt stress, which include the flavonoid biosynthetic pathway. Flavonoids, proanthocyanidins and anthocyanins all play important roles in stress tolerance. Anthocyanin accumulation has been known as a hallmark of plant stress response, which was stimulated by increasing NaCl concentrations in higher plants [32]. The salt overly sensitive3-1 (sos3-1) mutant of A. thaliana accumulated anthocyanins highly under high levels of NaCl (120 mM). In a screen of second site suppressors of sos3-1, the anthocyanin-impaired-response-1 (air-1) mutant showed a defect in anthocyanin (flavinoid) production, specifically in response to salt stress. The air-1 mutant accumulated anthocyanins normally, when exposed to other stresses such as high light, low phosphorous, Paraquat, temperature or drought stress [33]. A F3H gene, from M. truncatula was functionally characterized, and its induction by salt stress was analyzed in this report.
Materials and methods Plant materials and salt treatments Seeds of M. truncatula Gaertn ‘Jemalong’ A17 were dipped into concentrated sulfuric acid for approximately 8 min to scarify the seed coat. The seeds were rinsed with sterile water three times and kept in a filter-paper-lined flask to germinate. After 4 days, seedlings were moved into square boxes containing liquid culture medium HY [34] to grow for 3 weeks. All plants were grown in a greenhouse
Table 1 Primers used for amplification of the MtF3H gene
Primer name P1
that was kept on a light schedule of 16 h light: 8 h dark and the temperature was maintained at 24°C with a relative humidity of 50–60%. Nutrient solutions were replaced once a week to strengthen the growth of plants. Plants were then challenged with salt stress by adding 200 mM NaCl to the HY culture. Roots, stems, and leaves were separately sampled 12 and 24 h after salt treatment. Gene cloning and sequence alignment The sequence of flavanone-3ß-hydroxylase was obtained by aligning data from the expressed sequence tags (ESTs) and tentative consensus sequences (TCs) databases of The Institute for Genomic Research (TIGR). The process was carried out by the analysis of an M. truncatula bio-data analysis platform in our laboratory [35]. Total RNA was isolated from the roots of M. truncatula by using the RNeasy Plant Mini Kit (Qiagen). After purifying the RNA with RNase-free DNaseI (Takara, Japan), RNA was converted into cDNA using M-MLV Reverse Transcriptase (Promega, USA). The specific primer pair P1 (as shown in Table 1) was used to clone the full length cDNA of the putative MtF3H gene. A high fidelity polymerase (Takara, Japan) was used for PCR, and the program was as follows: 95°C for 5 min, then 35 cycles of 95°C for 50 s, 55°C for 50 s, and 72°C for 90 s; followed by elongation at 72°C for 10 min. The PCR product was separated by agarose gel electrophoresis and detected by UV luminosity of ethidium bromide stained gels. The agarose gel slice containing the DNA fragment of interest was purified and recovered by AxyPrep DNA Gel Extraction Kit (Axygen, USA) according to manufacture’s instructions. Then the DNA fragment of interest was ligated into the pMD18 vector (Takara, Japan) for sequencing. The isoelectric point of F3H was predicted by Compute pI/MW from ExPASy (http://www.expasy.ch/tools/). The homologous genes from various species were compared using a BLAST search in NCBI (www.ncbi.nlm.nih.gov). DNAMAN5.2 software was used to analyze the multiple
Primer sequence (50 -30 )
Annealing temperature (°C)
Size (bp)
F: GATTCTCTTACCATCCATCCTTC
55.0
1,499
58.0
1,114
60.0
139
60.0
227
R: GCTAAACAAG TAATTGACAATATAT P2
F: GCGGTACCATGGCACCAGCTCAA R: ATCTCGAGTTAAGCAAGAATCTC
P3
F: AGCATGCAAGTTATTGGAAGTG R: GCCAAGAGTTAGGTCTGGTTG
MtActin11
123
F: AGCTACGAATTGCCTGATGG R: CTCATTCTATCAGCAATGCCTG
Mol Biol Rep (2010) 37:3283–3289
sequence alignments, and the PhyML program (http:// www.phylogeny.fr) was used to construct a molecular evolutionary tree of F3H proteins. In vitro enzyme activity of F3H Primer P2 (shown in Table 1) of the coding region, which contained a KpnI site and an XhoI site, was designed to amplify the ORF of the MtF3H from the DNA fragment of interest, which had been ligated into the pMD18 vector. The product of the PCR reaction was ligated to pMD18; then the corresponding PCR product, excised with KpnI and XhoI, was subcloned into the pYES2 vector, and over-expressed in yeast (Saccharomyces cerevisiae) strain INV Sc1 (Invitrogen, USA). As a control, INV Sc1 cells transformed with an empty pYES2 vector were assayed. Alternatively, enzyme crude extracts were heated to 95°C for 10 min prior to the enzyme assay. For analysis of the putative F3H activities in vitro, enzyme assays with recombinant protein extracts were performed using 14C-labeled flavonoids as substrates together with known cofactors. The resulting products were analyzed by co-chromatography on cellulose thin-layer plates (Merck, Darmstadt, Germany) in solvent system CAW (chloroform acetic acid:water; 10:9:1) or 15% aqueous acetic acid with authentic standards [15]. Flavanones and dihydroflavonols were obtained from TransMIT Flavonoid forschung (Giessen, Germany). Study of F3H expression pattern Total RNA was isolated from stems, leaves, and roots of different unchallenged individuals or different individuals under salt stress as described above. The quality of the RNA preparations was verified by RNA-agarose gel electrophoresis showing intact 18 and 28 S RNA and by UV spectrophotometry showing an optimal A260:A280 ratio (1.8–2.0). Total RNA of each sample was normalized to 3 lg and converted to cDNA in a volume of 20 lL, and 1 lL of reverse transcribed (RT) product was used for realtime PCR. The primer P3 (Table 1) was used to amplify a fragment of 139 bp. The Actin11 gene of M. truncatula was used as an internal standard [36–38], and the primer of MtActin11 (see Table 1) produces a 227 bp segment. The PCR reactions (25 lL volume) were visualized with EvaGreen (Biotium, USA). The results of the PCR reaction were evaluated with the SLAN real-time quantitative PCR detection system (Huongshi, USA). All experiments were performed with three biological replicates and three technical replicates. Three biological replicates were employed for three sets of plant sample, each of which contained more than 5 plants. Triplicate technical reactions were on three independent syntheses of cDNA derived from the same RNA sample.
3285
The Ct values for MtF3H and MtActin11 were determined for each sample. Differences in the Ct between MtF3H and MtActin11 were referred to as DCt. The roots from unchallenged individuals were used as the reference sample, serving as a control. The DCt for each sample was subtracted from the DCt of the control, and the difference was called DDCt value. The relative expression level of MtF3H could be calculated by 2-DDCt, and the value stands for an n-fold difference relative to the control [39]. Statistical analysis Data obtained from real-time PCR were analyzed by ANOVA (SAS system version 9.0, SAS Institute Inc., Cary, NC, USA) for significant differences. Student-Newman-Keuls test (SAS system version 9.0) was used to compare expressed levels of MtF3H. P values \0.05 were considered to be significant. Data are presented as the mean ± standard deviation (SD). Sequence data for MtF3H have been deposited at the NCBI under accession number FJ529406.
Results Isolation of a F3H gene from Medicago truncatula A tentative consensus sequence (TC94828) related to salt stress was isolated from M. truncatula, including an ORF, that possesses 74% homology with the known F3H gene sequence from A. thaliana, AT3G51240 [10]. RNA from seedlings of M. truncatula was isolated and reverse transcribed to obtain the full length cDNA (1499 bp) by RTPCR. The sequence has an ORF of 1098 bp, translated into a putative protein that contains 365 amino acids. The putative protein has a calculated molecular weight of 41.36 kDa and is predicted to have an isoelectric point of 5.60. A conserved domain (CD) search was carried out using the NCBI CD search program [40]. The 2OG-FeII_Oxy domain, which is found in other F3H proteins, is also found in the deduced amino acid sequence of MtF3H. There are conserved regions of four residues (His76, His218, Asp220, and His276) that bind to Fe2? and an oxoglutarate binding motif (Arg286-X-Ser288) in MtF3H, the same as those found in other known 2-oxoglutarate-dependent dioxygenases. Molecular anagenesis of F3H displayed by a phylogenic tree A phylogenic tree was built using PhyML program at Phylogeny.fr server to compare MtF3H to other F3Hs from various plant species at the amino acid level (Fig. 1). From an examination of the molecular evolutionary tree, it is
123
3286
Fig. 1 Phylogenetic tree of flavanone-30 -hydroxylases from various species. Maximum likelihood analysis was performed using PhyML program on the Phylogeny.fr server (http://www.phylogeny.fr). The amino acid sequences of plant F3Hs were obtained from GenBank. The numbers at the nodes are percentage and indicate the bootstrap values obtained from 500 bootstrap replicates. The proteins included for analysis are as follows: MtF3H for Medicago truncatula (FJ529406), GmF3H for Glycine max (AAT94365), MsF3H for Medicago sativa (CAA55628) [13], GhF3H for Gossypium hirsutum (ABM64799), CsF3H for Citrus sinesis (BAA36553), PhF3H for Petunia hybrida (AAC49929), EgF3H for Eustoma grandiflorum (BAD34459), MdF3H for Malus domestica (AAX89397), OsF3H for Oryza sativa (AAL58118), SmF3H for Saussurea medusa (AAT44124), GbF3H for Ginkgo biloba (AAU93347), ZmF3H for Zea mays (NP_001105695), AtF3H for Arabidopsis thaliana (NP_190692), BnF3H for Brassica napus (ABB91635), PcF3H for Petroselinum crispum (AAP57394), RsF3H for Rubus sp. (ABX74780) [14], CmFNSI for Conium maculatum (ABG78795), AaFNSI for Angelica archangelica (ABG78793), AcFNSI for Aethusa cynapium (ABG78791)
evident that the sequence of the putative MtF3H protein showed more similarities to the F3H proteins from soybean (Glycine max) and alfalfa (M. sativa) [13] than to Brassica napus and A. thaliana. These results followed conventional taxonomy, since the former species belong to the Leguminosae and the latter to the Cruciferae. The hypothetical protein MtF3H has a high identity (75%) with the most similar FNSI from Poison hemlock and Conium maculatum. Using BLASTp (NCBI), the isolated sequence was found to be the most likely sequence to code for flavonone3ß-hydroxylase. Heterologous expression of MtF3H in yeast and functional characterization Because the amino acid sequence of F3H was very similar to other closely related enzymes, the catalytic activity of MtF3H was determined. The ORF of MtF3H cDNA was subcloned into pYES 2 vector, which was used to transform
123
Mol Biol Rep (2010) 37:3283–3289
the yeast strain INV Sc1. (2S) naringenin (NAR), a substrate labeled with 14C, was converted to dihydrokaempferol (DHK) by the crude extracts in the presence of 2-ODD cofactors (Fig. 2a). Yeast cells transformed with the empty vector and denatured protein extract did not exhibit F3H activity. Additionally, biotransformation approaches gave the same product, which was identified by co-chromatography with authentic standards and the product of parsley F3H reaction by thin layer chromatography (TLC) and highperformance liquid chromatography (HPLC). Formation of apigenin, the product of FNSI reaction was not detectable, therefore no FNSI enzyme activity. Therefore, the putative MtF3H codes for a functional flavanone-3ß-hydroxylase. Furthermore, as shown in Fig. 2b, the recombinant F3H accepted various flavanones as substrates in different manners and exhibited diverse enzymatic properties. The affinity of MtF3H for various substrates is in the order of naringenin (NAR) [ eriodictyol (ERI) [ homoeriodictyol (HOMO) [ hesperetin (HESP). Isosakuranetin (ISOSAK) seemed to be toxic to the cells at the concentration examined, since no cell growth and no conversion was observed. Differential transcript levels of MtF3H in different organs Comparative quantitative RT-PCR was used to characterize the expression patterns of MtF3H in leaves, stems, and roots. The amount of template cDNA was normalized by the parallel reactions, amplification of MtActin11. As control plants during the analysis of salt response, the normalized expression levels of MtF3H in different tissues of M. truncatula were displayed in Fig. 3. High transcript levels of MtF3H were found in the roots. However, the expression of MtF3H from stems and leaves was not as high as the level found in the roots. Particularly in leaves, there was relatively little expression compared to roots (6%) (P \ 0.05) while the expression in stems was only 20% (P \ 0.05) of the activity found in the roots. MtF3H showed distinct tissue-specific responses to salt stress To examine tissue-specific expression during salt stress experiments, roots, stems and leaves were separately sampled 12 and 24 h after the salt treatment (200 mM NaCl) and the results are shown in Fig. 3. The MtF3H expression in roots increased (P \ 0.05) 12 h after salt stress treatment and reached a three-fold increase (P \ 0.05) in activity after 24 h. In contrast to the roots, there were no significant differences (P \ 0.05) in transcript from the stems within 12 h; however, the gene was significantly activated in the following 12 h (P \ 0.05). High expression levels of [12fold (P \ 0.05) were observed, in contrast to the low levels
Mol Biol Rep (2010) 37:3283–3289
Fig. 2 Enzymatic conversion of flavanones in biotransformation assays with yeast cells expressing MtF3H. Standard F3H assay was as reported formerly [15]. Flavonoids were detected by UV-light on silica thin-layer plates developed in toluol–acetic acid (2:1). a Standards: dihydrokaempferol DHK; naringenin NAR. Assay: naringenin as substrate b Substrate: various flavanones (naringenin— NAR; eriodictyol—ERI; Hesperetin—HESP; Homoeriodictyol—
3287
HOMO; isosakuranetin—ISOSAK; Standards: dihydrokaempferol— DHK; dihydroquercetin—DHQ, dihydrotamarixetin—DHT. The recombinant F3H accepted various flavanones in different manners and exhibited diverse enzymatic properties. The arrows point to the different reaction products, which are compared to the different substrates
Fig. 3 Distinct tissue-specific responses to salt stress of MtF3H. Comparative expression patterns were measured by relative real-time RT-PCR and normalized to that of MtActin11. Total RNA was extracted from roots, stems and leaves under different conditions. Columns represent the mean ratio value, error bars indicate standard deviations of three technical replicates and numbers on the y axis display the fold of gene expression. Means with different letter superscripts are significantly different (P \ 0.05)
observed in unstressed stems. The expression in leaves was maintained at low levels, regardless of salt treatment(Fig. 3) (P \ 0.05).
Discussion A bio-data analysis platform was constructed by our group [35] to utilize more efficiently the Medicago truncatula
expressed sequence tags data and other public resources. MtF3H gene was found from this platform, which may play an important role in salt stress response. The nucleotide sequence of full-length cDNA clone of MtF3H gene was obtained and it displayed high similarity with F3H from A. thaliana [10]. All the sequences of 2-oxoglutarate-dependent dioxygenases contained seven conserved residues, which were divided into two groups: His-His-Asp-His and Arg-X-Ser [20]. The two motifs bind
123
3288
to Fe2? and oxoglutarate, separately. The sequence of MtF3H also possessed the same conserved residues. The F3H proteins from different species are highly conserved. Furthermore, they share high identity with other 2oxoglutarate-dependent dioxygenases. MtF3H shares 75% homology with FNSI from P. hemlock and C. maculatum (Fig. 1). Moreover, site-directed mutagenesis of F3H in P. crispum conferred flavone synthase I activity [41]. It is not enough to conclude that the MtF3H gene codes a classical flavanone-3ß-hydroxylase, just from the structural features of the MtF3H protein and investigations of molecular evolution. Only after the enzymatic proof of heterologous expression in yeast MtF3H was identified to encode a functional flavavonone-3ß-hydroxylase, which could catalyze the hydroxylation of flavanones into dihydroflavonols [5]. The precise enzymatic activity of MtF3H was defined by determining its substrate specificity in yeast. This enzyme showed a substrate preference towards naringenin whereas the G. max F3H expressed in yeast showed a substrate preference towards eriodictyol [42]. Flavonoids are a diverse group of secondary metabolites with a wide array of biological functions, including roles in stress protection. Although the ubiquitous flavonoid biosynthetic pathway has been one of the most thoroughly investigated pathways in higher plants and it has been closely implicated in stress response [43], not much is known about the salt stress responsive expression of the flavonoid biosynthetic genes. Two rice genes, OsDfr and OsAns, involved in flavonoid biosynthetic pathway were induced by high salt [44]; Several genes encoding important enzymes involved in the flavonoid biosynthetic pathway were induced in the salt-sensitive genotype IR29 of O. sativa under salinity stress [45]. In this study, we found that the expression of MtF3H was greatly induced by salt stress in the stems and roots with distinct temporal and spatial patterns in response to the 200 mM NaCl treatment. Although at the beginning, the transcription level was much higher in the roots than in the stems, the expression of MtF3H in the stems increased markedly and was just slightly lower than in the roots after 24 h of salt treatment (Fig. 3). The time of activation in the stems appeared to be in the latter 12 h, and this delay may be related to the transportation of secondary metabolites as biological signals in plant. But there is little data for secondary metabolite movement in plants. Several decades ago, grafting experiments displayed that alkaloids moved from roots to the aerial tissue [46]. In recent years, some flavonols have been shown to move in A. thaliana by substrate addition and by grafting [47, 48]. The transcripts of MtF3H were weakly detected in leaves, after both 12 and 24 h of salt stress treatment,which demonstrates that the MtF3H transcript levels in leaves is not directly modulated during salt stress response.
123
Mol Biol Rep (2010) 37:3283–3289
F3H has been also reported to take part in protecting plants from UV-irradiation [42] and blight disease [49]. In this study, we cloned and characterized the F3H gene from M. truncatula for the first time, and investigated the expression pattern of MtF3H under salt stress. Acknowledgments This work was supported by the Hi-Tech Research and Development (863) Program of China (2006AA10Z105, 2006AA100109). We thank Dr. Dasharath Lohar for providing seeds of M. truncatula Gaertn ‘Jemalong’ A17. We also sincerely thank Dr. shuizhang Fei (Iowa state University, Ames, USA) for his help.
References 1. Tahara S (2007) A journey of twenty-five years through the ecological biochemistry of flavonoids. Biosci Biotech Bioch 71:1387–1404. doi:10.1271/bbb.70028 2. Dixon RA, Steele CL (1999) Flavonoids and isoflavonoids—a gold mine for metabolic engineering. Trends Plant Sci 4:394– 400. doi:10.1016/S1360-1385(99)01471-5 3. Harborne JB, Williams CA (2000) Advances in flavonoid research since 1992. Phytochemistry 55:481–504. doi:10.1016/ S0031-9422(00)00235-1 4. Martens S, Mitho¨fer A (2005) Flavones and flavone synthases. Phytochemistry 66:2399–2407. doi:10.1016/j.phytochem.2005. 07.013 5. Prescott AG, John P (1996) Di-oxygenases: molecular structure and role in plant metabolism. Annu Rev Plant Physiol Plant Mol Biol 47:245–271. doi:10.1146/annurev.arplant.47.1.245 6. Wellmann F, Matern U, Lukacˇin R (2004) Significance of Cterminal sequence elements for Petunia flavanone-3ß-hydroxylase activity. FEBS Lett 561:149–154. doi:10.1016/S0014-5793 (04)00159-0 7. Britsch L, Ruhnau-Brich B, Forkmann G (1992) Molecular cloning, sequence analysis, and in vitro expression of flavanone3ß-hydroxylase from Petunia hybrida. J Biol Chem 267:5380– 5387 8. Davies KM (1993) A cDNA clone for flavanone 3-hydroxylase from Malus. Plant Physiol 103:291 9. Kim JH, Lee YJ, Kim BG, Lim Y, Ahn JH (2008) Flavanone-3ßhydroxylases from rice: key enzymes for favonol and anthocyanin biosynthesis. Mol cells 25:312–316 10. Pelletier MK, Shirley BW (1996) Analysis of flavanone 3hydroxylase in Arabidopsis thaliana seedlings (Coordinate regulation with chalcone synthase and chalcone isomerase). Plant Physiol 111:339–345 11. Jin Z, Grotewold E, Qu W, Fu G, Zhao D (2005) Cloning and characterization of a flavanone 3-hydroxylase gene from Saussurea medusa. DNA Seq 16:121–129 12. Shen G, Pang Y, Wu W, Deng Z, Zhao L, Cao Y, Sun X, Tang K (2006) Cloning and characterization of a flavanone 3-hydroxylase gene from Ginkgo biloba. Biosci Rep 26:19–29. doi:10.1007/ s10540-006-9007-y 13. Charrier B, Coronado C, Kondorosi A, Ratet P (1995) Molecular characterization and expression of alfalfa (Medicago sativa L.) flavanone-3-hydroxylase and dihydroflavonol-4-reductase encoding genes. Plant Mol Biol 29:773–786 14. Baek MH, Chung BY, Kim JH, Wi SG, An BC, Kim JS, Lee SS, Lee IJ (2008) Molecular cloning and characterisation of the flavanone-3-hydroxylase gene from Korean black raspberry. J Hort Sci Biotech 83:595–602 15. Martens S, Forkmann G, Britsch L, Wellmann F, Matern U, Lukacin R (2003) Divergent evolution of flavonoid
Mol Biol Rep (2010) 37:3283–3289
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30. 31. 32.
33.
2-oxoglutarate-dependent dioxygenases in parsley. FEBS Lett 544:93–98. doi:10.1016/S0014-5793(03)00479-4 Owens DK, Crosby KC, Runac J, Howard BA, Winkel BSJ (2008) Biochemical and genetic characterization of Arabidopsis thaliana flavanone-3ß-hydroxylase. Plant Physiol Biochem 46:833–843. doi:10.1016/j.plaphy.2008.06.004 Britsch L, Grisebach H (1986) Purification and characterization of (2S)-flavanone 3-hydroxylase from Petunia hybrida. Eur J Biochem/ FEBS 156:569–577. doi:10.1111/j.1432-1033.1986.tb09616.x Britsch L, Dedio J, Saedler H, Forkmann G (1993) Molecular characterization of flavanone-3ß-hydroxylases. Consensus sequence, comparison with related enzymes and the role of conserved histidine residues. Eur J Biochem/FEBS 217:745– 754. doi:10.1111/j.1432-1033.1993.tb18301.x Lukacin R, Groning I, Pieper U, Matern U (2000) Site-directed mutagenesis of the active site serine290 in flavanone-3ßhydroxylase from Petunia hybrida. Euro J Biochem/FEBS 267: 853–860. doi:10.1016/S0014-5793(00)01116-9 Lukacin R, Urbanke C, Groning I, Matern U (2000) The monomeric polypeptide comprises the functional flavanone-3ßhydroxylase from Petunia hybrida. FEBS Lett 467:353–358. doi: 10.1006/abbi.1999.1676 Lukacin R, Groning I, Schiltz E, Britsch L, Matern U (2000) Purification of recombinant flavanone-3ß-hydroxylase from Petunia Hybrida and assignment of the primary site of proteolytic degradation. Arch Biochem Biophys 375:364–370. doi:10.1046/ j.1432-1327.2000.01064.x Cook DR (1999) Medicago truncatula- a model in the making!. Curr Opin Plant Biol 2:301–304. doi:10.1016/S1369-5266(99) 80053-3 Oldroyd GE, Geurts R (2001) Medicago truncatula, going where no plant has gone before. Trends Plant Sci 6:552–554. doi: 10.1016/S1360-1385(01)02153-7 Young ND, Cannon SB, Sato S, Kim D, Cook DR, Town CD, Roe BA, Tabata S (2005) Sequencing the genespaces of Medicago truncatula and Lotus japonicus. Plant Physiol 137:1174– 1181. doi:10.1104/pp.104.057034 Town CD (2006) Annotating the genome of Medicago truncatula. Curr Opin Plant Biol 9:122–127. doi:10.1016/j.pbi.2006. 01.004 Sato S, Nakamura Y, Asamizu E, Isobe S, Tabata S (2007) Genome sequencing and genome resources in model legumes. Plant Physiol 144:588–593. doi:10.1104/pp.107.097493 Ane JM, Zhu H, Frugoli J (2008) Recent advances in Medicago truncatula genomics. Int J Plant Genomics 2008:256597 (Article ID). doi:10.1155/2008/256597 Mathesius U, Keijzer G, Natera SHA, Weinman JJ, Djordjevic MA, Rolfe BG (2001) Establishment of a root proteome reference map for the model legume Medicago truncatula using the expressed sequence tag database for peptide mass fingerprinting. Proteomics 1:1424–1440. doi:10.1002/1615-9861(200111)1:11 \1424:AID-PROT1424[3.0.CO;2-J Munns R (2002) Comparative physiology of salt and water stress. Plant Cell Environ 25:239–250. doi:10.1046/j.0016-8025.2001. 00808.x Munns R (2005) Genes and salt tolerance: bringing them together. New Phytol 167:645–663. doi:10.1111/j.1469-8137.2005.01487.x Chinnusamy V, Jagendorf A, Zhu J-K (2005) Understanding and improving salt tolerance in plants. Crop Sci 45:437–448 Eryilmaz F (2006) The relationships between salt stress and anthocyanin content in higher plants. Biotechnol Biotechnol Equip 20:47–52 Oosten MV, Bressan R (2005) (abstract no. 518). The anthocyanin-impaired-response-1 (air-1) mutant in the sos3-1 background of Arabidopsis thaliana is deficient in the accumulation of
3289
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46. 47.
48.
49.
anthocyanins in response to salt stress. 16th International Conference on Arabidopsis Research, www.arabidopsis.org/ news/PosterAbstracts.pdf, pp 229 Barker DG, Pfaff T, Moreau D, Groves E, Ruffel S, Lepetit M, Whitehand S, Maillet F, Nair RM, Journet E-P (2006) Medicago truncatula handbook: Growing M. truncatula: choice of substrates and growth conditions, Available via DIALOG. http:// www.noble.org/MedicagoHandbook/ Liu Y, Su Z, Dong J, Shen X, Li D, Wang T (2006) Construction and application of Medicago truncatula bio-data analysis platform. Acta Agrestia Sinica 14:231–235 Merchan F, de Lorenzo L, Rizzo SG, Niebel A, Manyani H, Frugier F, Sousa C, Crespi M (2007) Identification of regulatory pathways involved in the reacquisition of root growth after salt stress in Medicago truncatula. Plant J 51:1–17. doi:10.1111/ j.1365-313X.2007.03117.x de Lorenzo L, Merchan F, Blanchet S, Megı´as M, Frugier F, Crespi M, Sousa C (2007) Differential expression of the TFIIIA regulatory pathway in response to salt stress between Medicago truncatula genotypes. Plant Physiol 145:1521–1532. doi: 10.1104/pp.107.106146 de Lorenzo L, Merchan F, Laporte P, Thompson R, Clarke J, Sousa C, Crespi M (2009) A novel plant leucine-rich repeat receptor kinase regulates the response of Medicago truncatula roots to salt stress. Plant Cell 21:668–680. doi:10.1105/tpc.108.059576 Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2-DDC(T) method. Methods 25:402–408. doi:10.1006/meth.2001.1262 Marchler-Bauer A, Bryant SH (2004) CD-Search: protein domain annotations on the fly. Nucleic Acids Res 32:327–331. doi: 10.1093/nar/gkh454 Gebhardt YH, Witte S, Steuber H, Matern U, Martens S (2007) Evolution of flavone synthase I from parsley flavanone-3ßhydroxylase by site-directed mutagenesis. Plant Physiol 144:1442–1454. doi:10.1104/pp.107.098392 Kim BG, Kim JH, Kim J, Lee C, Ahn JH (2008) Accumulation of flavonols in response to ultraviolet-B irradiation in soybean is related to induction of flavanone-3ß-hydroxylase and flavonol synthase. Mol cells 25:247–252 Winkel-Shirley B (2002) Biosynthesis of flavonoids and effects of stress. Curr Opin Plant Biol 5:218–223. doi:10.1016/S13695266(02)00256-X Ithal N, Reddy AR (2004) Rice flavonoid pathway genes, OsDfr and OsAns, are induced by dehydration, high salt and ABA, and contain stress responsive promoter elements that interact with the transcription activator, OsC1-MYB. Plant Sci 166:1505–1513. doi:10.1016/j.plantsci.2004.02.002 Walia H, Wilson C, Condamine P, Liu X, Ismail AM, Zeng L, Wanamaker SI, Mandal J, Xu J, Cui X, Close TJ (2005) Comparative transcriptional profiling of two contrasting rice genotypes under salinity stress during the vegetative growth stage. Plant Physiol 139:822–835. doi:10.1104/pp.105.065961 Waller GR, Nowacki EK (1978) Alkaloid biology and metabolismin in plants. Plenum Press, New York, pp 121–141 Buer CS, Muday GK, Djordjevic MA (2007) Flavonoids are differentially taken up and transported long distances in Arabidopsis thaliana. Plant Physiol 145:478–490. doi:10.1104/ pp.107.101824 Buer CS, Djordjevic MA (2009) Architectural phenotypes in the transparent testa mutants of Arabidopsis thaliana. J Exp Bot 60:751–763. doi:10.1093/jxb/ern323 Cho S, Chen W, Muehlbauer FJ (2005) Constitutive expression of the flavanone 3-hydroxylase gene related to pathotype-specific ascochyta blight resistance in Cicer arietinum L. Physiol Mol Plant Pathol 67:100–107. doi:10.1016/j.pmpp.2005.09.011
123
