Cloning and expression of the gene cluster encoding key proteins ...

Proc. Natl. Acad. Sci. USA Vol. 86, pp. 32-36, January 1989

Biochemistry

Cloning and expression of the gene cluster encoding key proteins involved in acetyl-CoA synthesis in Clostridium thermoaceticum: CO dehydrogenase, the corrinoid/Fe-S protein, and methyltransferase (acetogenic bacteria/gene expression/CO metabolism/metalloenzymes/iron-sulfur proteins)

DAVID L. ROBERTS*, JULIE E. JAMES-HAGSTROM*, DENISE K. GARVIN*, CAROL M. GORST*, JENNIFER A. RUNQUIST*, JACQUELINE R. BAUR*, F. CARL HAASEt, AND STEVE W. RAGSDALE*t *Department of Chemistry, University of Wisconsin-Milwaukee, Milwaukee, WI 53201; and tRohm and Haas, Spring House, PA 19477

Communicated by Harland G. Wood, September 9, 1988 (received for review June 21, 1988)

ABSTRACT Acetogenic bacteria fix CO or CO2 by a pathway of autotrophic growth called the acetyl-CoA (or Wood) pathway. Key enzymes in the pathway are a methyltransferase, a corrinoid/Fe-S protein, a disulfide reductase, and a carbon monoxide dehydrogenase. This manuscript describes the isolation of the genes that code for the methyltransferase, the two subunits of the corrinoid/Fe-S protein, and the two subunits of carbon monoxide dehydrogenase. These five genes were found to be clustered within an 10-kilobase segment on the Clostridium thermoaceticum genome. The proteins were expressed at up to 5-10% of Escherichia coli cell protein, and isopropyl .8-D-thiogalactopyranoside had no effect on the levels of expression, implying that the C. thermoaceticum inserts contained transcriptional and translational signals that were recognized by E. coli. The methyltransferase is expressed in E. coli in a fully active dimeric form with a specific activity and heat stability similar to the enzyme expressed in C. thermoaceticum. However, both the corrinoid/Fe-S protein and carbon dioxide dehydrogenase, although expressed in high amounts and with identical subunit molecular weights in E. coli, are inactive and less heat stable than are the native enzymes from C. thermoaceticum.

CoA (12, 13) and to catalyze the actual synthesis of acetyl-CoA

(12).

In this manuscript, we report the cloning of the genes for CODH, MeTr, and C/Fe-SP and the expression of the proteins at high levels in Escherichia coli in the absence of any inducer. We have established that these genes are clustered within a 10-kilobase (kb) DNA segment in the C. thermoaceticum genome and that the CODH genes are directly upstream of the 55-kDa subunit of the C/Fe-SP. We suggest that these clustered genes contain promoter-like sequences and translational signals that are recognized by E. coli. MeTr is expressed in E. coli as a heat-stable dimer and is fully active. Both the C/Fe-SP and CODH, although expressed in high amounts by E. coli, are inactive and are much less heat stable than are the active enzymes from C. thermoaceticum. A preliminary report describing the cloning of the C/Fe-SP and MeTr-encoding genes has been published (14).

MATERIALS AND METHODS Bacterial Strains, Plasmids, and Growth Conditions. C. thermoaceticum, DSM 521, was cultured in 20-liter carboys at 55°C under CO2 as described by Ljungdahl and Andreesen (15). E. coli K-12 strain JM109 (F' traD36 proAB laclqZAM15/supE44 thi) was cultured on SOB medium (16). Colonies transformed with pUC9 (17) were grown at pH 7.5 at 37°C on LB-ampicillin medium (16) containing 0.8% tryptone, 0.5% yeast extract, 0.5% sodium chloride, and ampicillin at 0.1 mg/ml. 5-Bromo-4-chloro-3-indolyl (3-D-galactopyranoside and isopropyl B-D-thiogalactopyranoside (IPTG) (both from Boehringer Mannheim) were added to the LB-ampicillin medium to final concentrations of 0.032% and 1.6 mM, respectively, for colony screening. Construction and Screening of C. thermoaceticum Library. High-molecular weight DNA from C. thermoaceticum was isolated by the method of Saito and Miura (18). The purified DNA was then partially digested with Sau3A endonuclease and fractionated by ultracentrifugation in a 5-30%o sucrose gradient. Fractions in the 10-kb size range were ligated into pUC9, which had been digested with BamHI and treated with alkaline phosphatase. E. coli strain JM109 was transformed by the method of Hanahan (19) and spread onto LBampicillin plates containing 5-bromo-4-chloro-3-indolyl /8D-galactopyranoside and IPTG. White colonies were isolated and screened by colony hybridization (18) with oligonucle-

The pathway of acetyl-CoA synthesis, which has been named the Wood pathway, is a specific mode of autotrophic and heterotrophic growth involving tetrahydrofolate (H4fblate) enzymes and enzyme-bound organometallic intermediates (for recent reviews, see refs. 1-3). In this pathway, methyltetrah,ydrofolate (MeH4folate) is formed from CO or CO2 via a sernes of reactions involving formate dehydrogenase and H4folate enzymes. Methyltransferase (MeTr) transfers the methyl group of MeH4folate to the cobalt center of a corrinoid/Fe-S protein (C/Fe-SP), forming a methyl-Co3+ species. MeTr was first purified by Drake et al. (4) and shown to be a 59-kDa protein containing two 26-kDa subunits. C/Fe-SP contains two subunits with molecular masses of 55 kDa and 33 kDa. Partial purification of the C/Fe-SP and important mechanistic studies (5) were followed by purification to homogeneity and characterization of the metal centers (a cobalt corrin and a [4Fe-4S] cluster) of the enzyme (6). Carbon monoxide dehydrogenase (CODH), also called, more appropriately, acetyl-CoA synthase, catalyzes the final steps in the synthesis of acetyl-CoA. CODH has been purified to homogeneity from the acetogenic bacteria Clostridium thermoaceticum (7) and Acetobacterium woodii (8). CODH consists of two subunits with Mr values of 78,000 and 71,000 and contains 2 Ni atoms, '12 Fe atoms, "14 acid-labile sulfides, and 1-3 Zn atoms per dimer (7). The roles of CODH in the pathway are to bind CO (9, 10), a methyl group (11), and

Abbreviations: MeTr, methyltransferase; C/Fe-SP, corrinoid/Fe-S protein; CODH, carbon monoxide dehydrogenase; H4folate, tetrahydrofolate; MeH4folate, methyltetrahydrofolate; SDS, sodium dodecyl sulfate; IPTG, isopropyl 3-D-thiogalactopyranoside. tTo whom reprint requests should be addressed at: Department of Chemistry, Box 413, University of Wisconsin-Milwaukee, Milwaukee, WI 53201.

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact. 32

Biochemistry: Roberts et al. otide probes that had been end-labeled with [y-32P]ATP (ICN) by T4 polynucleotide kinase (Boehringer Mannheim). Enzyme Determinations, Protein and Subunit Isdation, Protein Sequencing, and DNA Synthesis. MeTr (5), CODH (12), and C/Fe-SP (6) activities were determined as described previously. MeTr (4) and C/Fe-SP (6) were purified to homogeneity. Individual subunits of the C/Fe-SP were separated and isolated to -95% homogeneity by ion-exchange chromatography after treatment with 6 M urea. Typically, 378 mg of urea was added to 0.6 ml of C/Fe-SP (15 mg of protein in 50 mM Tris HC1, pH 7.6) and incubated overnight in an anaerobic chamber (Coy Laboratory Products, Ann Arbor, MI) at 16'C. The solution was then applied to a 15-ml DEAESephacel column equilibrated with 30 mM TrisHCI/6 M urea, and a linear gradient from 0 to 0.4 M NaCl in the same buffer was run. The large subunit (55 kDa) eluted at -100 mM NaCi, and the 33-kDa subunit eluted at -200 mM NaCl. The N-terminal residues were determined by the dansylation method of Gray (20) with 1 gmol of peptide. Purified 33-kDa subunit of the C/Fe-SP (10 nmol) was incubated overnight with trypsin (3 1.d of 1 mg of trypsin/ml in 1 mM HCl) in 0.1 M ammonium bicarbonate at 370C. Peptides were isolated and purified on a C4 HPLC column in a gradient of 0-55% acetonitrile in 0.1% trifluoroacetic acid. Approximately 1 nmol of each purified subunit or tryptic fragment was subjected to automated Edman degradation sequencing. Sequencing of the 55-kDa and 33-kDa subunits of C/Fe-SP and MeTr was done on an Applied Biosystems model 470A gas-phase sequencer at Rohm and Haas. The N-terminal residue of MeTr was N-formylmethionine. The formyl group was removed by treatment with 0.5 M HCl in methanol for 48 hr at 230C (21). Sequencing of the tryptic fragments of the 33-kDa subunit was done on an Applied Biosystems model 477A pulsed liquid-phase sequenator with an on-line amino acid analyzer at the Protein and Nucleic Acid Sequencing Facility, Medical College of Wisconsin, Milwaukee, WI. DNA Syntheses, DNA Hybridizations, Restriction Endonuclease Mapping, and DNA Sequencing. Based on the amino acid sequences of MeTr and the large (55 kDa) and small (33 kDa) subunits of C/Fe-SP, 17-mers were synthesized on an Applied Biosystems model 380B DNA synthesizer. The DNA probes were then purified by electrophoresis on a 20%

polyacrylamide gel. Plasmid DNA was isolated essentially as described (16) after lysing the cells with sodium dodecyl sulfate (SDS). The DNA was then digested with a number of restriction endonucleases and electrophoresed on 1.0% agarose gels. The DNA was denatured, transferred to GeneScreen (New England Nuclear), baked, and hybridized with 32P-labeled oligonucleotide probes in the presence of dextran sulfate using conditions recommended by the manufacturer (New England Nuclear). Hybridizations with probes for MeTr, and for the 55-kDa and 33-kDa subunits of C/Fe-SP were done at 520C, 480C, and 450C, respectively. Restriction endonuclease mapping of pCt946B was also performed by partial cleavage of end-labeled DNA (22) with HindIII and BamHI. Purified plasmid DNA was sequenced essentially by the method of Sanger et al. (23) with the heptadecanucleotide probes (17-mers) as primers. DNA sequencing was performed with modified T4 polymerase (Sequenase), adenosine 5'-[a-35S]thiotriphosphate (New England Nuclear), and the Sequenase kit according to the instructions of the manufacturer (United States Biochemical). Inmunoblotting of Cell Extracts with Antibodies Against the Purified Proteins. E. coli cells (1 ml with an OD of =1.0 at 660 nm) were centrifuged at 2000 x g and resuspended in 0.1 ml of cell-lysis solution containing 10%o glycerol and 0.4% SDS. The cell suspension was boiled for 5 min and centrifuged at 14,000 x g. In other experiments cell suspensions were prepared

Proc. Natl. Acad. Sci. USA 86 (1989)

33

anaerobically, and cells were lysed with a French press as described (12) in buffer containing 50 mM Tris-HCl, pH 7.6/5 mM dithiothreitol. The cell suspension was centrifuged, and the supernatant was used for subsequent studies (12). With the extract obtained by the French press procedure, protein was determined by the method of Elliott and Brewer (24). For the cells obtained by SDS lysis, protein was determined in the supernatant by the method of Smith et al. (25) before addition of dithiothreitol (1.0%6) and bromphenol blue (0.1%). This cell extract was applied to a 10%o SDS/polyacrylamide gel under denaturing conditions (26) or to a nondenaturing gradient gel (27) (10-35% acrylamide gradient) in the anaerobic chamber and either silver stained (28) (Bio-Rad) or electrophoretically transferred to nitrocellulose for Western (immunologic) hybridization analysis. Incubation with primary rabbit antibodies and secondary goat anti-rabbit alkaline phosphatase antibody and staining with nitro blue tetrazolium and 5-bromo,4-chloroindolyl phosphate were performed as described by the manufacturer (Bio-Rad). The polyclonal antibodies were prepared against CODH, C/Fe-SP, and MeTr in New Zealand White rabbits and purified by elution from columns containing these proteins immobilized on Affi-Gel 10. The proteins were bound to Affi-Gel 10 following the instructions of the manufacturer (Bio-Rad). Heat Treatment of Extracts. Cells (4 g, wet weight) from E. coli or C. thermoaceticum were suspended in anaerobic buffer and lysed in a French press under anaerobic conditions as described (12). After centrifuging at 27,000 rpm in a type 35 rotor in stainless steel centrifuge tubes, the supernatants were maintained at temperatures between 25°C and 77°C for 10 min. The suspension was then centrifuged, and the supernatants, containing the heat-stable proteins, were then used for electrophoresis and for determination of enzyme

activity.

RESULTS AND DISCUSSION Isolation and Analyses ofProteins and Peptides. CODH (12), MeTr (5), and C/Fe-SP (6) were purified to homogeneity as reported earlier. For MeTr, we determined the sequence for the first 27 amino acids (the first 18 of these are shown in Fig. 1) and synthesized a 17-mer with 24-fold degeneracy correMETHYLTRANSFERASE ATGCTCATTATCGGTGAACGGATT M L I I G E R I fM L I I G E R I N G M F G D

I K R A

CORRINOID/FE-S PROTEIN 55 kDa Subunit

ATGCCTTTGACGGGACTGGAGATT M P L T G L E I P L T G L E I Y K O L P K K N C G E 33 kDa Subunit

Tryntic Fragment CGCAGCCATACCATCGTCGTCGGTGGCGAATGCTGCC CTGCCTTTCAC R S H T I V V G G D A A L P F H S I T I V V G G D A A L P F H CATTTCGAAGGAGAGATTGTCAACGAG

H F E G E I V N E H F E G E I V N E P V

I G M E V O D I

FIG. 1. Partial sequences of MeTr and C/Fe-SP. In each case, the first line shows the DNA sequence obtained using the oligonucleotide probe as a primer in the dideoxynucleotide chain-termination sequencing reaction. The second line shows the amino acid sequence (in one-letter code) predicted from the DNA sequence. The bottom line is the amino acid sequence determined by Edman degradation of the purified peptide. The sequences shown for MeTr and the 55-kDa subunit of C/Fe-SP are from the N-terminal of the protein. The sequences shown for the 33-kDa subunit are from the N-terminal of a tryptic fragment. Underlined residues correspond to sequences used to predict DNA sequences that were then used as oligonucleotide probes in colony and Southern hybridization and DNA sequencing experiments. The residue marked ¶ was ambiguous.

34

Biochemistry: Roberts et al.

Proc. Natl. Acad. Sci. USA 86

(1989)

pCtJ9A (colony D), hybridized to the probes for the 33-kDa subunit and MeTr. Because each insert was =4-7 kb and the genes overlapped in separate colonies, these results indicated that the three genes were clustered. Plasmid DNA was isolated from pCt946A, pCt946B, pCt946C, and pCtJ9A. To confirm that we, indeed, had isolated the genes of interest, we sequenced the regions of the plasmid DNAs directly adjacent to the regions that hybridized with the various probes. For all three proteins, we obtained perfect agreement between the predicted sequences and those determined by Edman degradation of the peptides (Fig. 1). For the 55-kDa subunit of C/Fe-SP, the DNA sequence predicts methionine as the N-terminal amino acid, whereas the protein sequence determined by Edman degradation begins with proline, which is the second amino acid based on the DNA sequence. The DNA sequence of the 33-kDa subunit gene predicts an Arg-Ser sequence at the border of the tryptic peptide; this is expected because the product of trypsin cleavage is a C-terminal arginine or lysine. We showed above that pCt946B contains the genes encoding MeTr and also the 55-kDa and 33-kDa subunits of C/Fe-SP. To determine the relative location of the genes, we mapped the insert with a variety of restriction endonucleases. Results of Southern hybridizations of the restriction fragments with the probes demonstrate that the three genes are clustered within a region of -5 kb (Fig. 3). In this figure, the vertical bars indicate the locations to which the oligonucleotide probes hybridized. The exact distances between the regions that hybridize to the probes and the nearest upstream restriction sites were determined by DNA sequence analyses. To reflect the actual size of each gene, an arrow is drawn below the DNA segment that corresponds to the predicted size and the orientation of each gene. For the 33-kDa subunit, we do not know the exact location of the probe because it corresponded to a region in a tryptic fragment of unknown relationship to the N-terminal region. Therefore, two arrows are drawn below the DNA segment for this -1-kb gene, showing its possible extreme locations. The 5' end of the MeTr gene is the farthest possible location of the 3' end of the gene for the 33-kDa subunit. The farthest location of the 5' end of the MeTr gene is =1 kb upstream of the 3' end of the DNA sequence we have determined. Thus, the 33-kDa subunit gene is located between these two extremes (Fig. 3). There is a segment of DNA of 1.6-2.1 kb between the genes for the 55-kDa and 33-kDa subunits that could code for a protein of between 50,000 and 70,000 kDa. The insert in pCtJ9A, which overlaps with the insert in pCt946B, contains the entire MeTr gene as well as the gene for the 33-kDa subunit of C/Fe-SP. The orientation and predicted size of the MeTr gene is shown in Fig. 3.

FIG. 2. Colony hybridization of E. coli transformed with pUC9 containing -5- to 8-kb inserts of C. thermoaceticum DNA. Colonies were grown on nitrocellulose on a YT-ampicillin plate and lysed; the DNA was denatured and baked onto the filters. The colonies were hybridized to 32P-end-labeled probes for the 55-kDa (Top), and 33-kDa (Middle) subunits of C/Fe-SP and for MeTr (Bottom). The colonies labeled A-E are as follows: A, pCt946A; B, pCt946B; C, pCt946C; D, pCtJ9A; and E, JM109 containing pUC9 without any insert.

sponding to amino acid residues 11-17. After separating the two subunits of C/Fe-SP as described, we determined partial N-terminal sequences. Based on the sequence of the first 18 residues of the 55-kDa protein (Fig. 1), two 17-mers were synthesized, corresponding to residues 6-11 and 13-18. Because the N-terminal sequence of the 33-kDa subunit of the C/Fe-SP (data not shown) would generate oligonucleotide probes of 17 bases or longer, too degenerate for hybridization studies, we digested the purified subunit with trypsin and purified a number of peptides. Sequencing of one peptide yielded an N-terminal sequence consisting of 38 residues (Fig. 1 shows the first 34 residues) from which a 17-mer with 32-fold redundancy was synthesized, corresponding to residues 29-34 of the tryptic fragment. Identification of the Genes Encoding MeTr and C/Fe-SP. We screened a genomic library of C. thermoaceticum DNA in E. coli consisting of -1400 colonies with 32P-labeled oligonucleotide probes for MeTr and the large and small subunits of C/Fe-SP. Several colonies that hybridized to the oligonucleotides for one or more of the three genes (Fig. 2) were isolated and purified. One colony, containing the plasmid pCt946B, hybridized to all three probes (colony B, Fig. 2). Two colonies, containing plasmids pCt946A and pCt946C (colonies A and C, respectively) hybridized to the probe for the 55-kDa subunit only; and another colony,

Kilobase

H

IH I

HHE 1

P

P

iiI IE

C

HP

L

P

pCt946B

j pCt946C pt94I6C

HlillE

I pCt946A

UEf c =

CODH

55kDa Subunit of C/Fe-SP

=

_=

=>==

c===: 33kDa

MeTr

Subunit of C/Fe-SP

FIG. 3. Restriction map of the insert in pCt946B and partial maps of pCt946A, pCt946C, and pCtJ9A. Plasmid DNAs were digested with restriction enzymes, electrophoresed in agarose gels, transferred to nitrocellulose, and probed with the 32P-labeled oligonucleotides shown in Fig. 1. The insert in pCt946B also was mapped by the partial digestion method (22). The abbreviations for the restriction enzymes are as follows: C, Cla I; E, EcoRI; H, HindII; HIII, HindIII; P, Pst I. The multiple cloning sites of pUC9 (data not shown) are at the borders of each insert. Locations of the regions that hybridized to the probes are designated by vertical bars. Arrows show approximate location and orientation of the genes. We do not yet know the orientation or order of the genes for the 78- and 71-kDa subunits of CODH or the exact location for the 33-kDa subunit of C/Fe-SP.

Biochemistry: Roberts et al. Expression of the Genes in E. coil. We then determined the levels of expression of these genes in E. coli. The amounts of each protein were estimated by immunological staining by comparison with purified proteins as standards (Table 1). Cell extracts from E. coli containing pCt946A and pCt946C react with antibodies raised against the 55-kDa subunit of C/Fe-SP (Fig. 4A, lanes 8 and 13). This protein is expressed at levels up to 5% of cell protein in pCt946A and l100 of cell protein in pCt946C. Both the 55-kDa and 33-kDa subunits of C/Fe-SP are expressed at a level of -1% of the cell protein in pCt946B (Fig. 4A, lane 11). Based on the results shown in Fig. 3, pCt946B apparently contains :60% of the MeTr gene; however, we never detected by immunoblotting any peptide that would correspond to this segment of the gene with the MeTr antibody. The MeTr gene (Fig. 4A, lane 6) and the 33-kDa subunit of C/Fe-SP (Fig. 4B, lane 9) are both expressed in pCtJ9A at a level of -1% of cell protein. In addition to the 55-kDa subunit of C/Fe-SP, pCt946A expresses both the 78-kDa and 71-kDa subunits of CODH (Fig. 4C, lanes 13-15) at quite high levels, amounting to =5% of cell protein for all three peptides. The genes are full length (2.3 and 2.1 kb for the 78-kDa and 71-kDa subunits, respectively) because the sizes of the subunits expressed by pCt946A are identical to those from C. thermoaceticum. The insert in pCt946A is =7 kb long, leaving only =0.6 kb in the insert that would not code for either CODH or the 55-kDa subunit of C/Fe-SP. Even though the levels of expression in pCt946B and pCtJ9A are less than those in pCt946A and pCt946C, expression of these cloned proteins at levels of even 1% of cell protein in the absence of IPTG is interesting. JM109 is a lac Iq host; thus, expression from the lac promoter of pUC9 would be expected to be minimal in the absence of the inducer, IPTG. Apparently, the high level of expression of these genes is due to promoter and translational signals present on the C. thermoaceticum DNA. It is clear that E. coli efficiently recognizes these C. thermoaceticum transcriptional and translational signals. Recently, another gene from C. thermoaceticum has been cloned and expressed at levels of 15-30%o of cell protein in E. coli (29). Properties of the Cloned and Native Proteins. The cloned MeTr expressed in E. coli is extremely active in transfer of the methyl group of [3H]methyl-B12 to H4folate, forming [3H]MeH4folate. The activity of MeTr in extracts of pCtJ9A and C. thermoaceticum were 1.6 and 2.7 nmol min-1 mg-1, respectively. Under these conditions, the specific activity of homogeneous MeTr from C. thermoaceticum was 150. Table 1. Expression of genes coding for MeTr, C/Fe-SP, and CODH in E. coli Level of expression of gene product, % of cell protein*

C/Fe-SP 55-kDa subunit 33-kDa subunit

CODH Plasmid MeTr 5 5 ND ND pCt946A 1 1 ND ND pCt946B ND ND ND 10 pCt946C 1 ND ND 1 pCtJ9A ND, not detected. *Levels of expression were determined by Western hybridization of cell extracts with purified antibodies using alkaline phosphataseconjugated goat anti-rabbit secondary antibody. Various concentrations of purified MeTr, C/Fe-SP, and CODH were electrophoresed and blotted, along with the cell extracts, to serve as standards for the amount of specific protein expressed. The concentration of protein in the extract was obtained as described, and the samples were electrophoresed in a 10%o polyacrylamide gel under denaturing conditions in the presence of SDS.

35

Proc. Natl. Acad. Sci. USA 86 (1989) A

2

4

10

8

6

12

I

B

C

2.46

2

4

14 .

10

8

6

8

10

12

14

12

14

I

FIG. 4. Immunological identification of CODH, C/Fe-SP, and MeTr in E. coli transformants. Cells were grown in 1 ml of YT-ampicillin medium, lysed with SDS, and electrophoresed under denaturing conditions in 10%o polyacrylamide gels. Proteins were transferred to nitrocellulose membranes and probed with antibodies raised against C/Fe-SP (A), MeTr (B), and CODH (C). (A) Lanes: 13, 50, 15, and 5 ng, respectively, of purified C/Fe-SP; 4 and 5, 2400 and 480 ng, respectively, of JM109 with pUC9 but no insert; 6 and 7, 2400 and 480 ng, respectively, of pCtJ9A; 8-10, 2400, 480, and 160 ng, respectively, of pCt946C; 11 and 12, 2400 and 480 ng, respectively, of pCt946B; 13-15, 2400, 480, and 160 ng, respectively, of pCt946A. (B) Lanes: 2 and 3, 480 and 2400 ng, respectively, of pCt946A; 4 and 5, 480 and 2400 ng, respectively, of pCt946B; 6 and 7, 480 and 2400 ng, respectively, of pCt946C; 8 and 9, 480 and 2400 ng, respectively, of pCtJ9A; 10 and 11, 480 and 2400 ng, respectively, of JM109 containing pUC9 but no insert; 12-14, 5, 10, and 20 ng, respectively, of purified MeTr. (C) Lanes: 1-4, 100, 50, 20, and 10 ng, respectively, of purified CODH; 5 and 6, 5000 and 2000 ng, respectively, of JM109 containing pUC9 but no insert; 7 and 8, 5000 and 2000 ng, respectively, of pCtJ9A; 9 and 10, 5000 and 2000 ng, respectively, of pCt946C; 11 and 12, 5000 and 2000 ng, respectively, of pCt946B; 13-15, 5000, 2000, and 800 ng, respectively, of pCt946A.

Therefore, active MeTr represents 1.1% of cell protein in pCtJ9A and 1.9o in C. thermoaceticum. The amount of MeTr in pCtJ9A determined by immunological staining also is 1% of cell protein, which strongly suggests that the MeTr from E. coli is totally active. Comparison of MeTr as synthesized by E. coli with that from C. thermoaceticum by nondenaturing pore-limit electrophoresis (data not shown) demonstrates that both proteins migrate as a 55-kDa dimer. Proteins isolated from C. thermoaceticum, which has an optimal growth temperature of 55°C, are generally heat stable (30). There is