Cloning, Expression, Purification and Refolding of

Appl Biochem Biotechnol DOI 10.1007/s12010-014-0733-5

Cloning, Expression, Purification and Refolding of Microtubule Affinity-Regulating Kinase 4 Expressed in Escherichia coli Farha Naz & Mohd Asad & Pawan Malhotra & Asimul Islam & Faizan Ahmad & Md Imtaiyaz Hassan

Received: 27 September 2013 / Accepted: 7 January 2014 # Springer Science+Business Media New York 2014

Abstract Microtubule-associated protein/microtubule affinity-regulating kinase 4 (MARK4) is a member of the family Ser/Thr kinase and involved in numerous biological functions including microtubule bundle formation, nervous system development, positive regulation of programmed cell death, cell cycle control, cell polarity determination, cell shape alterations, cell division etc. For various biophysical and structural studies, we need this protein in adequate quantity. In this paper, we report a novel cloning strategy for MARK4. We have cloned MARK4 catalytic domain including 59 N-terminal extra residues with unknown function and catalytic domain alone in PQE30 vector. The recombinant MARK4 was expressed in the inclusion bodies in M15 cells. The inclusion bodies were solubilized effectively with 1.5 % N-lauroylsarcosine in alkaline buffer and subsequently purified using Ni–NTA affinity chromatography in a single step with high purity and good concentration. Purity of protein was checked on sodium dodecyl sulphate–polyacrylamide gel electrophoresis and identified by using mass spectrometry immunoblotting. Refolding of the recombinant protein was validated by ATPase assay. Our purification procedure is quick, simple and produces adequate quantity of proteins with high purity in a limited step. Keywords Microtubule affinity-regulating kinase . Microtubule dynamics . Alzheimer’s disease . Cloning . Protein expression and purification . Refolding

Introduction The microtubule-associated protein (MAP)/microtubule affinity-regulating kinase (MARK) family has four related proteins: MARK1, MARK2 (EMK1), MARK3 (C-TAK1) and F. Naz : A. Islam : F. Ahmad : M. I. Hassan (*) Centre for Interdisciplinary Research in Basic Sciences, Jamia Millia Islamia, Jamia Nagar, New Delhi 110025, India e-mail: [email protected] M. Asad : P. Malhotra International Centre for Genetic Engineering and Biotechnology, Aruna asaf Marg, New Delhi 110067, India

Appl Biochem Biotechnol

MARK4 (MARKL-1) [1]. MARK4 gene exists in two alternatively spliced isoforms L and S of 752 and 688 amino acid residues long, respectively. Both isoforms have catalytic domain, ubiquitin-associated domain and kinase-associated domain. Residues 65–73 are considered as ATP-binding domain and Lys88 act as ATP-binding site. Asp181 has been proposed to be an active site residue that is activated by phosphorylation of the side chain of Thr214. We are working on MARK4 L gene that has 1 to 59 N-terminal header, Ser/Thr protein kinase catalytic domain [S_TKc (59–310)], membrane-targeting motif (T-region) (314–322), [UBA (331–368)], least-conserved spacer region (369–649 residues) and [KA1 (649–752)] [2]. The kinase-associated domain of MARK4S has no homology with any known structures, but corresponding domain in MARK4L is present in all MARKs [3–5]. The isoform MARK4S is highly expressed in the normal brain and is involved in neuronal differentiation, whereas MARK4L is involved in cell cycle and is upregulated in hepatocarcinoma cells and gliomas [6]. The MARK4 protein regulates programmed cell death, and its overexpression leads to decrease in cell viability [6]. MARK4 phosphorylates the MAPs on their serine motif in the tubulin-binding domains, causing their detachment from the microtubules as it phosphorylates Tau in case of Alzheimer’s disease at Ser262, thereby increasing microtubule dynamics and cell shape alterations and leads to the regulation of centrosomal activities such as amplification and positioning of centrosomes [7]. It also regulates microtubuledependent transport of CCV during endocytosis [8]. MARK4 itself gets phosphorylated at Thr214 (functionally active) and Ser218 (functionally inactive) [6]. It is found to be associated with microtubules, centrosomes and neurite-like processes of neuroblastoma cells [7]. MARK4 has its functional importance in cancerous cells and glioblastoma cell lines [9–11]. Upregulated MARK4 in the early stages of an ischemic event increases the probability of neuronal death [6]. MARK4 have a role in cell proliferation as well [4, 12]. It directly interacts with many proteins to perform respective functions, including cytoskeleton remodelling and it shows proteasomal degradation [13, 14]. All these studies reflect that MARK4 is involved in large number of diseases; therefore, it is important to know about its structure to develop drugs against diseases. Hence, we need plenty of recombinant protein with high purity. Expression and purification of MARK4 have already been done in the mammalian cell line [7]. The described method is tedious, time-consuming and yielded insufficient protein in purified form. For conducting structural and biophysical studies, we need plenty of protein with high purity. Hence, we need to express MARK4 in the bacterial system. Here we expressed MARK4 efficiently in Escherichia coli. However, high-level expressed recombinant proteins get aggregated and accumulated in the inclusion bodies (IBs). These IBs must be solubilized with detergents or denaturants and should be refolded to its natural bioactive form after purification. Many strategies have been described to get pure proteins from their IBs. There is still many proteins that show aggregation, and their activity does not regain after removal of denaturating agents from the protein solution [15–18]. In this paper, we have shown cloning, expression and purification of MARK4 kinase domain with 59 N-terminal extra residues (one to 310 amino acids long; MARK4a) and kinase domain alone (59 to 310 amino acids long; MARK4b) from its inclusion bodies in E. coli. These IBs were solubilized in alkaline buffer containing N-lauroylsarcosine detergent. The purification was done with nickel–nitrilotriacetic acid (Ni–NTA) column in the denatured form. Recombinant protein was subsequently refolded using dialysis for 48 h.


Materials and Methods Strains and Plasmids T-easy vector was purchased from Promega (Madison, WI, USA). Plasmid pQE30, E. coli strain M15, were obtained from Qiagen, and DH5α was obtained from INVITROGEN. FastDigest Restriction enzymes were purchased from Thermo Scientific. The pQE30 vector is placed with a small 6× histidine (6× His) tag coding sequence at the N-terminal of the desired protein. Plasmid isolation, restriction enzyme digestion, ligation and competent cell preparation were carried out following standard procedures [19]. Cloning Human MARK4 gene was purchased from PlasmID Harvard Medical School (http://plasmid. med.harvard.edu/PLASMID). The primers of 5′gcccatgggatccatgtcttcgcggacggt3′ and 5′ gtcgacctcgagatagccgatgttgatccatttg 3′ were used to amplify the MARK4 kinase domain plus 59 N-terminal extra residues having NcoI, BamHI, SalI and XhoI restriction endonuclease sites. The kinase domain was amplified with the primers of 5′ gcggatccatgggcaactaccgcctgctgagg 3′ and 5′ gtcgacctcgagatagccgatgttgatccatttg 3′. This contained NcoI, BamHI, SalI and XhoI restriction endonuclease sites. PCR products were ligated into T-easy vector, transformed into competent DH5α strain and were amplified. These clonings were confirmed through colony PCR and restriction digestion with BamHI and SalI endonucleases. Both desired genes were digested with BamHI and SalI endonucleases and purified by electrophoresis on low-melting agarose (QIAquick Gel Extraction Kit, Qiagen). These genes were ligated into pQE30 expression vector, and cloning was again checked by colony PCR and restriction endonuclease digestion. These plasmids were transformed into E. coli M15 competent cell. Expression Transformed M15 cells were cultured overnight at 37 °C with vigorous shaking at 150 rpm in Luria–Bertani broth medium. Secondary cultures of these cells were grown by adding 1 % of primary cultures. When their absorbance was reached to 0.6, 1 mM isopropyl-1-thio-β-Dgalactopyranoside (IPTG) was added to induce expression of recombinant proteins at 16 °C for 12 h. These cultures were centrifuged at 3,000×g for 20 min at 4 °C. Pellets were dissolved in buffer (50 mM Tris, 20 mM EDTA, 0.1 mM PMSF and 1 % of Triton 100), and sonication was carried out on ice using ultra-sonicator (Cole-Parmer Instrument) for 20 min (7 s off, 7 s on). After the sonication, pellets were collected through centrifugation and resuspended in 50 mM Tris and 20 mM EDTA. Sonication and centrifugation were repeated twice. Pellets were collected and washed with milliQ water twice. Finally inclusion bodies were dissolved in 1 ml of milliQ and stored at 4 °C. Purification and Refolding IBs were solubilized in lysis buffer (1.5 % of N-lauroylsarcosine and 50 mM 3-(cyclohexylamino)-1-propanesulphonic acid (CAPS) buffer pH 11.0) by keeping them on rocker for 1 h at room temperature followed by centrifugation at 10,000×g for 15 min. Supernatant was collected and loaded into Ni–NTA resin. Column was washed with lysis buffer and washing buffer (10 mM imidazole, 1.5 % of N-lauroylsarcosine and 50 mM CAPS


buffer pH 11.0). The desired protein was eluted with increasing imidazole concentration in elution buffer (0.3 % N-lauroylsarcosine and 50 mM CAPS buffer pH 11.0). The eluted fractions were analysed by sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS–PAGE) and scanned by Beckman DU-650 spectrophotometer to determine the purity of proteins. Purified proteins were dialyzed for 48 h in 50 mM phosphate buffer, pH 7.4 with seven changes to get refolded protein. The protein concentration was measured before and after dialysis to determine the protein yield. Protein concentration was measured using Bradford method [20]. Western Blotting To identify proteins, we performed Western blotting using standard protocol [21]. Protein bands of SDS–PAGE were transferred onto nitrocellulose membranes. The membranes were blocked with 5 % skimmed milk in phosphate-buffered saline for 2 h followed by washing with phosphate-buffered saline. Conjugate Anti-His–HRP (Penta-His, Qiagen) was incubated with membranes for 2 h and subsequently washed with phosphate-buffered saline. Blots were developed by incubating the membrane for 2 min with 3,30-diaminobenzidine reagents (Zhongshan Biotech, Beijing, China) and 200 μl of hydrogen peroxide. Mass Spectrometry To identify proteins, we have performed mass spectrometry using standard protocol with slight modifications described elsewhere [22, 23]. Purified proteins were applied to SDS–PAGE. The bands were excised from the gel and washed with water and 100 mM NH4HCO3/acetonitrile 1+1 (v/v). After repeating this process many times, acetonitrile was removed and gel particles were dried down in a vacuum centrifuge. The gel particles were soaked in freshly prepared 10 mM dithiothreitol (DTT) in 100 mM NH4HCO3 and incubated for 45 min at 56 °C. Excess liquid was removed and freshly prepared chilled 55 mM iodoacetamide in 100 mM NH4HCO3 was added and incubated for 30 min at room temperature in dark. All iodoacetamide solution was removed, and gel particles were washed with 100 mM NH4HCO3 and acetonitrile (1+1, v/v). Subsequently acetonitrile was removed and gel particles were dried down in a vacuum centrifuge. The gel was subjected to in-gel trypsin digestion using the mass grade trypsin (Sigma chemicals, T6567) at a concentration of 200 ng/μl. Enough 25 mM NH4HCO3 (approximately 2–3 μl) were added and incubated at 37 °C overnight. The supernatant was collected in a fresh microfuge tube. Ten microlitres of 1 % TFA and 10 μl of acetonitrile were added to the gel followed by sonication for 20 min. The supernatant was dried and resuspended in 8 μl 0.1 % TFA and 2 μl of acetonitrile. One microliter of this solution was used for the analysis of matrix-assisted laser desorption/ionisation time-of-flight (MALDI-TOF) mass spectrometry with an autoflex™ speed MALDI-TOF mass spectrometer (Bruker Daltonics). The resulting peptide mass fingerprinting was used to identify both proteins using Mascot 2.0 search engine with fragment mass tolerance of ±0.5 Da. ATPase Assay ATPase assay was done by measuring the formation of 32P from [γ-32P] ATP catalyzed by MARK4 proteins. This ATP hydrolysis is done in a buffer (20 mM Tris–HCl, pH 8.0, 8 mM DTT, 1.0 mM MgCl2, 20 mM KCl and 16 mg/ml BSA) containing purified refolded MARK4 protein, mixture of [γ-32P] ATP (17 nM) and 1 mM cold ATP. ATPase reaction was carried out for 1 h at 37 °C. For the separation of these products, thin layer chromatography was done. For


autoradiography, these plates were exposed to the hyper-film and scanned on phosphoimager. IMAGE j/geldoc (http://rsbweb.nih.gov/ij/) software was used for their quantification. Different concentrations of both proteins were used for analysis of concentration curve. For time course analysis, fixed concentration of both the proteins was used with different time intervals (15 to 90 min). Percentage of ATP hydrolysis was also plotted as a bar diagram.

Results Identification of Recombinant MARK4 Plasmid MARK4 cDNA was inserted in the PQE30 vector which was confirmed through sequencing. Correct insertion of both genes in recombinant plasmids was also confirmed by colony PCR and restriction endonuclease digestions. Expression of MARK4 Supernatant and pellet were analysed with different IPTG concentrations showing intense bands at 35 and 27 kDa in the IBs of pellet on SDS–PAGE (Fig. 1a, b). Prepared pellets were further sonicated twice on ice using ultra-sonicator (Cole-Parmer Instrument) for 20 min (7 s off, 7 s on) at 42 amplitude. Two sonications were needed in order to completely solubilized IBs. To remove maximum impurity from them, two additional washings were done. All steps were analysed by SDS–PAGE indicating over-expression of MARK4 in the pellet (Fig. 2a, b).

a

Supernatant

b

Pellet

M

Pellet

Supernatant M

170 130 100 70 55 40 35

35 27

25

15

Fig. 1 Expression of recombinant proteins a MARK4a and b MARK4b in E. coli M15 cells harbouring PQE30/ MARK4 gene was induced by increasing concentration of IPTG (0.05 to 1.0 mM). Whole cell lysates were separated by SDS–PAGE and visualized by Coomassie brilliant blue staining. Molecular mass markers are shown as M, and their respective molecular masses are indicated. An arrowhead indicates the 35- and 27-kDa proteins induced by IPTG in M15 cells harbouring PQE30/MARK4 gene


a

b M

1

2

3

M

4

1

2

3

4

170

170 130

130

100

100

70

70

55 55

40

40 35 35 25 25

Fig. 2 Expression of recombinant proteins a MARK4a and b MARK4b in E. coli M15 cells harbouring PQE30/ MARK4 gene was induced by IPTG. The pellet was sonicated twice and washed with water. SDS–PAGE of supernatant obtained after first and second sonication are shown in lane 1 and lane 2, respectively. Lane 3 represent supernatant obtained after washing. Lane 4 represents purified IBs. Molecular mass markers are shown as M

Purification IBs of MARK4 proteins were solubilized in an alkalinized lysis buffer containing 1.5 % N-lauroylsarcosine, and purification was done under denaturing condition using Ni–NTA resin. The eluted products by different imidazole concentrations were analysed by SDS–PAGE clearly indicating the purity of proteins (Fig. 3a, b). The a

b M

170

1

2 3 4

5

6

M 1

7 8

130

170 130

100

100

70

70

55

55

2 3

4 5

6

7 8

40 40 35 35

25

25

Fig. 3 Inclusion bodies obtained for a MARK4a and b MARK4b were solubilized in denaturating buffer (1.5 % of N-lauroylsarcosine and 50 mM CAPS buffer pH 11.0) and subjected to Ni–NTA affinity chromatography. Bound proteins were eluted with increasing concentrations of imidazole with elution buffer (0.3 % Nlauroylsarcosine and 50 mM CAPS buffer pH 11.0) and fractionated at 2 ml/tube. Aliquots of proteins of the representative fractions were separated by SDS–PAGE followed by Coomassie brilliant blue staining. Lanes are indicated as M marker, 1 flow through, 2 wash with lysis buffer, 3 wash with washing buffer, 4 elution with 10 mM imidazole, 5 elution with 20 mM imidazole, 6 elution with 50 mM imidazole, 7 elution with 200 mM imidazole and 8 elution with 400 mM imidazole


fractions eluted with different imidazole concentrations were pooled, and the yield of combined purified protein was over 75 % (Table 2). The purified fractions were dialyzed to remove the detergent N-lauroylsarcosine gradually. After extensive dialysis, protein got refolded that was confirmed by ATPase assay. The concentration of protein was diluted enough prior to dialysis to reduce the aggregation process. Western blot analyses have further confirmed the MARK4 (Fig. 4). Mass Spectrometry A peptide mass fingerprints of MARK4 indicating the occurrence of 11 fragments after tryptic digestion with their molecular mass range from 695 to 2,273 Da (Table 1). Each fragment was further analysed, and mascot search revealed that both proteins are MARK4 with their primary accession no. gi|119577736. A very high Mascot score (90) indicates no ambiguity in identification of MARK4. ATPase Assay In order to confirm proper refolding of proteins, we have performed ATPase assay. Figure 5 shows that MARK4 proteins are able to hydrolyze ATP in a concentration-dependent manner (Fig. 5a, b). Percentage of ATP hydrolysis was also plotted as a bar diagram (Fig. 5c, d). We also measured their ATPase activities at a constant concentration with different time intervals (Fig. 6a, b), and their percent hydrolysis with respect to time is illustrated in a bar diagram (Fig. 6c, d). All these results indicate that protein got actively folded after extensive dialysis and can further be used for various studies. Fig. 4 Western blotting analysis of MARK4a and MARK4b was applied to detect the presence of the amino-terminal region in a protein of Mr 35 and 27 kDa with anti-6× His tag antibodies

M 1 70 55 40 35 25 15

2

Appl Biochem Biotechnol Table 1 Peptide mass fingerprints of MARK4a S. No.

Start–end

Observed

Nominal mass (expected)

Nominal mass (calculated)

ppm

Peptide

1.

78–83

696.4844

695.4771

695.4079

99.6

R.HILTGR.E

2.

227–241

1,632.8969

1,631.8896

1,631.7831

65.3

K.IADFGFSNEFTLGSK.L

3.

211–226

1,770.0745

1,769.0672

1,768.9570

62.3

R.DLKAENLLLDAEANIK.I

4.

192–205

1,773.0404

1,772.0331

1,771.8940

78.5

K.FRQIVSAVHYCHQK.N

5.

44–60

1,958.0646

1,957.0573

1,956.8748

93.2

R.NSIASCPEEQPHVGNYR.L

6.

242–260

2,098.1498

2,097.1425

2,096.9877

73.8

K.LDTFCGSPPYAAPELFQGK.K

7.

42–60

2,274.1935

2,273.1862

2,273.0066

79.0

R.CRNSIASCPEEQPHVGNYR.L

Discussion Although MARK4 is highly expressed in testis and brain, purification of this protein from human subject is a highly complicated process. Although MARK4 has been expressed in mammalian and insect cell lines [7], in low yield and purity is a regular problem. MARK4 mediates the pathological phosphorylation of tau in Alzheimer disease, and it is also related

a

1

2

3

4

c 20

Pi

6µg

18 16

3µg

14

1µg

12 10 8 6

ATP

4 2 0 1

b

1

2

3

2

3

d

4

20

Pi

18

1.5 µg

16 14 12

3.3µg

0.8µg

10

8 6

ATP

4 2 0 1

2

3

Fig. 5 a ATPase activity concentration curve (90 min) of refolded MARK4a. Position of Pi and ATP spots is indicated. Lanes 1, 2, 3 and 4 are indicated as control, 1, 3 and 6 μg of protein, respectively. b ATPase activity concentration curve (90 min) of refolded MARK4b. Lanes 1, 2, 3 and 4 are indicated as control, 0.8, 1.5 and 3.3 μg of protein, respectively. Percent hydrolysis with respect to the concentration of MARK4 is shown in a bar diagram for c MARK4a and d MARK4b


a

1

2

3

4

b

5

25

Pi

90min

20

60min

15 10

30min 15min

5

ATP

0 1

1

c

2

3

4

5 Pi

ATP

2

3

4

d 20 18 16 14 12 10 8 6 4 2 0

60min 90min 15min

30min

1

2

3

4

Fig. 6 Time-dependent ATPase assay of refolded at 3 μg concentration of a MARK4a and b MARK4b. Position of Pi and ATP spots is indicated. Lanes 1, 2, 3, 4 and 5 are indicated as control, 15, 30, 60 and 90 min, respectively. Percent hydrolysis with respect to time for MARK4 is shown in a bar diagram c MARK4a and d MARK4b

with many diseases like cancer and neurodegenerative diseases [2]. Hence, there is a need to investigate its structure and function to understand the mechanism of action and designing a potent inhibitor for drug discovery. To achieve these aims, a prerequisite is to prepare the recombinant pure protein in high concentration. We have purified MARK4 proteins and analysed its purification protocol. We have tried to clone two variants of MARK4 in pET-28b vectors and expressed in BL21 cell line. We did not observe a prominent expression in the BL21 cell line. We further cloned MARK4 gene in the PQE30 vector and expressed them in M15 cell line. Expression of these proteins in M15 cell line is showing very high yield (Fig. 2). Although protein was expressed in IBs, therefore we Table 2 Purification and refolding efficiency of both proteins at different levels of purification Protein name

Total protein in IBs (mg)

Desired protein in IBs (mg)

Purified protein with Ni–NTA (mg)

Refolded protein (mg)

Refolding rate (%) From IBs

From purification

MARK4a

6.8

5.2

3.9

3.7

71.2

94.9

MARK4b

7.4

5.6

4.2

4.0

71.4

95.2

Protein concentration was measured using Bradford method


need to get this protein either in soluble fraction or IBs should be solubilized and protein should be refolded again. Since urea is a commonly used denaturants [15, 16, 24], we have tried to dissolve IBs in the urea buffer (8 M urea, 20 mM Tris and 250 mM Nacl) and subsequently refolded with refolding buffer (100 mM Tris, 20 % glycerol, 250 mM arginine, 1 mM EDTA, 0.5 mM oxidized glutathione and 1 mM reduced glutathione). But we were unable to elute them with different concentration of imidazole in good concentration (data not shown). It is reported that N-lauroylsarcosine interacts with hydrophobic residues to reduce hydrophobicity without impairing protein purification. Therefore, we used N-lauroylsarcosine which can be easily removed by dialysis [25]. Ni–NTA affinity chromatography can be done in the presence of a varieties of ionic and nonionic detergents [26]. Since the expressed proteins have 6× His tag in N-terminus, therefore these proteins were purified by Ni–NTA resin [24, 27]. IBs were resuspended in the lysis buffer (1.5 % of N-lauroylsarcosine and 50 mM CAPS buffer pH 11.0) and subjected to Ni– NTA affinity chromatography. Bound proteins were eluted with increasing concentrations of imidazole with elution buffer (0.3 % N-lauroylsarcosine and 50 mM CAPS buffer pH 11.0). We obtained a single band after eluting protein from the Ni–NTA column (Fig. 3), indicating that MARK4 protein was purified in a single step with high yield. Protein concentrations were measured by using Bradford method, and yield of the proteins was quantified by IMAGE j/geldoc (http://rsbweb.nih.gov/ij/) software (Table 2). It has been observed that there is a problem with the refolding process as protein from nonspecific aggregation due to the interaction among exposed hydrophobic patches and formation of incorrect intramolecular disulphide links [15–18, 28–31]. But these purified proteins were efficiently refolded through simple dialysis. To determine if the protein is fully renatured, the ATPase assay was done (Fig. 5). It had shown that the proteins were fully active as when we have increased their concentration, the % hydrolysis of ATP also got enhanced (Fig. 6). We have successfully cloned, expressed and purified MARK4 catalytic domain plus 59 extra residues and its catalytic domain in E. coli from their inclusion bodies in a single step with high purity and concentration. This will help us in further studies on MARK4. Acknowledgments FN acknowledges the Council of Scientific and Industrial Research for the award of fellowship. We sincerely thank Harvard Medical School for providing MARK4 cDNA. FA and MIH are thankful to the Department of Science and Technology for funding.

References 1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12.

Espinosa, L., & Navarro, E. (1998). Cytogenetics and Cell Genetics, 81(3–4), 278–82. Naz, F., Anjum, F., Islam, A., et al. (2013). Cell Biochemistry and Biophysics, 67(2), 485–99. Marx, A., Nugoor, C., Panneerselvam, S., et al. (2010). The FASEB Journal, 24(6), 1637–48. Kato, T., Satoh, S., Okabe, H., et al. (2001). Neoplasia, 3(1), 4–9. Moroni, R. F., De Biasi, S., Colapietro, P., et al. (2006). Neuroscience, 143(1), 83–94. Schneider, A., Laage, R., von Ahsen, O., et al. (2004). Journal of Neurochemistry, 88(5), 1114–26. Trinczek, B., Brajenovic, M., Ebneth, A., et al. (2004). The Journal of Biological Chemistry, 279(7), 5915– 23. Schmitt-Ulms, G., Matenia, D., Drewes, G., et al. (2009). Cell Motility and the Cytoskeleton, 66(8), 661–72. Magnani, I., Novielli, C., Bellini, M., et al. (2009). Cellular Oncology, 31(5), 357–70. Roversi, G., Pfundt, R., Moroni, R. F., et al. (2006). Oncogene, 25(10), 1571–83. Magnani, I., Moroni, R. F., Roversi, G., et al. (2005). Cancer Genetics and Cytogenetics, 161(2), 140–5. Beghini, A., Magnani, I., Roversi, G., et al. (2003). Oncogene, 22(17), 2581–91.

Appl Biochem Biotechnol 13. Brajenovic, M., Joberty, G., Kuster, B., et al. (2004). The Journal of Biological Chemistry, 279(13), 12804–11. 14. Wojcik, E., Basto, R., Serr, M., et al. (2001). Nature Cell Biology, 3(11), 1001–7. 15. Lilie, H., Schwarz, E., & Rudolph, R. (1998). Current Opinion in Biotechnology, 9(5), 497–501. 16. Vallejo, L. F., Brokelmann, M., Marten, S., et al. (2002). Journal of Biotechnology, 94(2), 185–94. 17. Roder, H., & Shastry, M. R. (1999). Current Opinion in Structural Biology, 9(5), 620–6. 18. Clark, E. D. B. (1998). Current Opinion in Biotechnology, 9(2), 157–63. 19. Sambrook, D. W., Jr. (2001). Molecular cloning: a laboratory manual (3rd ed.). Cold Spring Harbor: Cold Spring Harbor Laboratory. 20. Bradford, M. M. (1976). Analytical Biochemistry, 72, 248–54. 21. Blancher, C., & Jones, A. (2001). Methods in Molecular Medicine, 57, 145–62. 22. Hassan, M. I., Kumar, V., Kashav, T., et al. (2007). Journal of Separation Science, 30(12), 1979–88. 23. Hassan, M. I., Kumar, V., Singh, T. P., et al. (2008). Journal of Separation Science, 31(12), 2318–24. 24. Kim, S. H. (2003). Protein Expression and Purification, 27(1), 85–9. 25. Kurucz, I., Titus, J. A., Jost, C. R., et al. (1995). Molecular Immunology, 32(17–18), 1443–52. 26. Grisshammer, R., & Tucker, J. (1997). Protein Expression and Purification, 11(1), 53–60. 27. Chu, X., & Li, D. (2003). Protein Expression and Purification, 27(1), 165–70. 28. Carrio, M. M., & Villaverde, A. (2002). Journal of Biotechnology, 96(1), 3–12. 29. Babu, K. R., Swaminathan, S., Marten, S., et al. (2000). Applied Microbiology and Biotechnology, 53(6), 655–60. 30. Misawa, S., & Kumagai, I. (1999). Biopolymers, 51(4), 297–307. 31. Shan, J., Baguinon, M., Zheng, L., et al. (2003). Protein Expression and Purification, 27(1), 143–9.