Cloning, Molecular Characterization, and Functional Activity of ...

4 downloads 12 Views 2MB Size Report
Dehydrogenase, a Putative Vaccine Candidate against. Schistosomiasis Japonica ...... bundling and unbundling of microtubules in brain tissue (14) and in the ...
INFECrION AND IMMUNITY, Nov. 1993, p. 4716-4723

Vol. 61, No. 11

0019-9567/93/114716-08$02.00/0

Copyright C 1993, American Society for Microbiology

Cloning, Molecular Characterization, and Functional Activity of Schistosoma japonicum Glyceraldehyde-3-Phosphate Dehydrogenase, a Putative Vaccine Candidate against Schistosomiasis Japonica G. J. WAINE, M. BECKER, W. YANG, B. KALINNA, ,ND D. P. McMANUS* Molecular Parasitology Unit, Tropical Health Program, Queensland Institute of Medical Research, The Bancroft Centre, 300 Herston Road, Brisbane, Queensland 4029, Australia Received 30 April 1993/Returned for modification 11 June 1993/Accepted 13 August 1993

We report the cloning, molecular characterization, and purification of functionally active recombinant glyceraldehyde-3-phosphate dehydrogenase (GAPDH) from the human bloodfluke Schistosomajaponicum. The GAPDH homolog from the related species Schistosoma mansoni has shown correlation of antibody titer to resistance to reinfection. A 1,164-bp cDNA (C1) was isolated from an S. japonicum AZapll cDNA expression library immunoscreened with hyperimmune rabbit serum raised against soluble adult S. japonicum proteins. The open reading frame of Cl encodes a protein of 338 amino acids exhibiting 90%o identity to the amino acid sequence of S. mansoni GAPDH. The inferred molecular mass of the protein is 36,589 daltons, and in vitro translation of the cDNA with [35S]methionine produced a radiolabelled band of the predicted size. Antibodies to Cl selected from hyperimmune rabbit serum by affinity purification recognized an S. japonicum protein doublet of37 kDa but did not cross-react with a corresponding protein in S. mansoni extracts. The S.japonicum GAPDH appears to be translated from a single mRNA encoded by a single-copy gene. After subcloning in the QLAexpress vector pQE-10 and subsequent expression, the recombinant protein was purified under nondenaturing conditions and shown to exhibit functional GAPDH enzymatic activity. Of the major parasitic diseases, schistosomiasis, also known as bilharzia, is second only to malaria in terms of human suffering. The disease is of major socioeconomic and public health importance in tropical and subtropical areas of Africa, South America, and Asia. It is caused by adult bloodflukes (trematode worms) depositing eggs in blood vessels surrounding the bladder or gut, many of which lodge in the tissues and provoke an inflammatory reaction. Human infection occurs by contact with water contaminated with the larvae of the parasite, the cercariae, which are released from snail intermediate hosts. It is estimated that more than 200 million people are infected with schistosomiasis and that a further 500 to 600 million are exposed to infection. The most important schistosome species infecting humans are Schistosoma haematobium, which causes urinary schistosomiasis in Africa and the Middle East; Schistosoma mansoni, which is responsible for intestinal schistosomiasis in Africa, parts of Latin America, and the Caribbean; and Schistosoma japonicum, the Asian schistosome, endemic mainly in China and the Philippines, which is responsible for a grave, debilitating, and chronic form of intestinal schistosomiasis. The present policy for control of schistosomiasis relies primarily on diagnosis and targeted chemotherapy supplemented with snail control. Praziquantel, a highly effective but expensive antischistosome drug, has proved especially useful for human treatment, but it cannot prevent reinfection and has little effect on already developed tissue lesions. The development of resistance to praziquantel by schistosomes is a real concern, particularly as its use in the field increases. The development of human schistosomiasis vaccines is now recognized as a priority to complement existing control *

Corresponding author.

measures, especially as there is now good evidence that humans acquire immunity to schistosomes, suggesting that development of such vaccines is an achievable goal. In particular, slow development with age of an acquired resistance to reinfection after chemotherapy of infections occurs with both S. mansoni and S. haematobium (6, 12, 20, 21). While similar human studies on S. japonicum have not yet been reported, induction of specific immunity against S. japonicum by prior exposure to UV-attenuated cercariae has been demonstrated in rodents (19). A very successful UVattenuated S. japonicum cercarial vaccine has been tested in buffaloes under field conditions (24). Most work on the assessment of experimental antischistosome vaccine candidates has been carried out on S. mansoni, mainly for practical reasons, especially the relative ease of maintaining this species in the laboratory. A major target of protective immunity, a 37-kDa molecule found on the surface of S. mansoni, is one such vaccine candidate. Immunoglobulin G (IgG) antibodies to this antigen have been shown to correlate with resistance to infection; it is well recognized by sera from Brazilian children resistant to S. mansoni infection but poorly recognized by sera from children susceptible to reinfection (10). Preliminary observations have indicated that mice immunized with the 37-kDa antigen are less susceptible than control animals to infection by cercariae (10). A cDNA encoding the S. mansoni 37-kDa antigen has been cloned (11), and it has 73% amino acid homology with the human glycolytic enzyme glyceraldehyde-3-phosphate dehydrogenase (GAPDH). As well as being located in the cytosol (8), the S. mansoni GAPDH has been detected on the surface of intact living schistosomula larvae (11). A single, functional gene with two small introns encodes the enzyme in both locations (8). Biologically active recombinant antigens may be more 4716

VOL. 61, 1993

effective in inducing an appropriate immune response than inactive or denatured forms, since they more closely resemble the native antigen. To the best of our knowledge, purified, biologically active, recombinant GAPDH has not previously been obtained for any helminth parasite. In this report, we describe the cloning, molecular characterization, and purification of biologically active recombinant GAPDH from S. japonicum. MATERIALS AND METHODS Bacterial strains, phage, and growth conditions. Escherichia coli BB4 [LE392.23; F' laclqZAM15 proAB Tn1O (Tetr)] was cultured and maintained in LB medium (1% Bacto-Tryptone, 0.5% yeast extract, 1% NaCl) supplemented with tetracycline (12.5 pg/ml). Before use in phage propagation, cells were cultured in LB medium supplemented with 0.2% maltose-10 mM MgSO4 (pH 7.4) at 37°C with shaking. The cells were pelleted and resuspended in 10 mM MgSO4 at an optical density at 600 nm (OD6.) of 0.5/ml. Aliquots of the packaged XZapII cDNA library containing approximately 10,000 PFU were mixed with 600 pl of BB4 cells (OD6. = 0.5/ml) and incubated for 15 min at 37°C. Melted top agarose (0.7% agarose in LB) was added to each aliquot, plated on 150-mm LB plates, and incubated at 42°C for 3.5 h for immunoscreening. After the plates were overlaid with nitrocellulose filters impregnated with 10 mM IPTG (isopropyl-13-D-thiogalactopyranoside), incubation was continued for a further 3 h at 37°C. E. coli BB4 containing plasmids were grown at 37°C in LB medium supplemented with ampicillin (50 ,ug/ml). DNA cloning and sequencing. An S. japonicum cDNA library was constructed in AZapII with polyadenylated [poly(A)+]RNA isolated from parasites of mainland Chinese origin. A total of 6.5 x 105 recombinant PFU of the unamplified library were screened (13) with a hyperimmune rabbit serum (HRS) raised against soluble adult S. japonicum (Chinese mainland origin) proteins. HRS was adsorbed against E. coli proteins before use in immunoscreening. Plaques adsorbed onto IPTG (Sigma)-impregnated nitrocellulose filters were rinsed with TBST (50 mM Tris-HCl [pH 7.5], 150 mM NaCl, 0.05% Tween 20) and then blocked with 3% skimmed milk in TBS (50 mM Tris-HCl [pH 7.5], 150 mM NaCl). The filters were incubated with HRS (diluted 1:100 in TBST) at 37°C for 1 h and then washed three times in TBST. After being washed, the filters were incubated at 37°C for 1 h with goat anti-rabbit IgG conjugated to horseradish peroxidase, washed three times in TBST and once in TBS, and developed with 4-chloro-1-naphthol. Positive plaques were identified, and each was extracted with a sterile pasteur pipette and plaque purified by another round of screening (at a lower concentration so that individual plaques could be isolated). Purified plaques containing AZapII were then subjected to automatic excision with helper phage to excise the plasmid (pBluescriptII SK+), according to the manufacturer's instructions (Clonetech). Recombinant cDNA plasmids were sequenced from both ends on an Applied Biosystems automated DNA sequencer with 17 and T3 dye-labelled primers. Manual sequencing was performed with a Sequenase Version 2 kit (United States Biochemical Corporation). Sequence data were analyzed with the Genetics Computer Group (University of Wisconsin) software package. Affinity purification of antibodies. Antibodies to the antigen expressed by recombinant phage in E. coli were purified by affinity adsorption on induced plaques, essentially as described before (1). Briefly, plaques were adsorbed onto

CLONING OF S. JAPONICUM GAPDH

4717

IPTG-impregnated nitrocellulose filters as described above; the filters were washed four times with TBST, incubated with HRS at 37°C for 1 h, and washed again. To elute the adsorbed antibodies, the filter was placed on a parafilmcovered dish and covered with 0.2 M glycine (pH 2.8)-0.01 M EDTA for approximately 20 min with gentle shaking. The eluate was collected and neutralized by adding 1/10 volume of 2 M Tris-HCl (pH 8.0)-20% fetal calf serum. Sodium azide was added to a final concentration of 0.02%, and the affinitypurified antibodies were stored at 4°C. Immunoblot analysis. Immunoblot analysis of whole-parasite extracts was performed with the affinity-purified antibodies to determine the molecular size of the corresponding native protein synthesized by the parasite. Whole-parasite extracts were prepared by homogenization and sonication of adult worms (Chinese or Philippine S. japonicum or S. mansoni) in phosphate-buffered saline (PBS) (29). After ultracentrifugation, the supernatants were mixed 1:1 (volV vol) with sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) buffer (17), boiled for 3 min, and electrophoresed on SDS-10% PAGE gels (26). The separated proteins were transferred to nitrocellulose filters, which were rinsed with TBST and blocked with 3% skim milk in TBST. The filters were incubated with the affinitypurified antibodies or HRS at 37°C for 1 h and then washed three times in TBST. The ifiters were then incubated at 37°C for 1 h with goat anti-rabbit IgG conjugated to horse-radish peroxidase. After incubation, the filters were washed three times with TBST and once with TBS and developed with

4-chloro-1-naphthol. In vitro transcription and translation. In vitro transcription and translation were performed with the TNT Coupled Reticulocyte Lysate System (Promega Corporation, Madison, Wis.), according to the manufacturer's instructions. The DNA template for the reaction was Cl (or another clone containing a known gene as a control) in pBluescriptIl SK+. T3 RNA polymerase was used to synthesize mRNA from the T3 promoter located upstream from the cloning site in pBluescriptII SK+. [35S]methionine was used in place of unlabelled methionine in the reaction to generate a radiolabelled protein product. [35S]methionine-labelled proteins were separated on SDS-10% PAGE gels and visualized by soaking the gels in fluorography enhancer (Amplify, Amersham), drying them, and exposing them to X-ray film at -800C. mRNA extraction and Northern (RNA blot) analysis. For extraction of mRNA, S. japonicum adult worms were perfused from an infected rabbit and quickly rinsed three times in sterile PBS with only a Chinese writing brush used for handling to prevent damage of the parasites. The worms were immediately snap frozen in liquid nitrogen and ground with a mortar and pestle in liquid nitrogen. The liquid nitrogen and ground tissue were transferred to a sterile 50-ml conical tube, in which the liquid nitrogen was allowed to evaporate. Extraction buffer containing guanidine thiocyanate was added immediately after evaporation. Poly(A)+ RNA was then extracted directly from the suspension with the PolyATract System 1000 (Promega) according to the manufacturer's instructions. mRNA was electrophoresed, transferred to nylon membranes (Hybond-N; Amersham), and hybridized by standard procedures (22). Radiolabelled probe was prepared by digesting the GAPDH gene from pBluescriptIl SK+ with PstI and EcoRI, purifying the fragment on a low-melting-point agarose gel, and labelling it with [32P]dcrP by the Megaprime DNA labelling system

(Amersham).

4718

WAINE ET AL.

Southern blot analysis. Southern analysis was performed by standard protocols (22). Restriction enzymes used were EcoRI, Hinfl, BamHI, and HindIII. The probe used for Southern hybridization was prepared in the same way as described for Northern hybridization. Subcloning, expression, and purification of recombinant antigen. The QLAexpress system (Qiagen) was used for high-level expression and purification of recombinant protein. In this vector, the recombinant protein is synthesized with a short tag of six histidine residues (6x His) fused to the N terminus. The presence of this tag allows proteins to be purified from a cleared bacterial lysate based on the high affinity of nickel-nitrilo triacetic acid (NTA) resin for proteins carrying the 6 xHis tag. Proteins bound to the resin can be eluted under very mild conditions. The GAPDH cDNA was subcloned into the QIAexpress vector pQE-10 at the PstI cloning site. To generate the fragment for subcloning, an oligonucleotide was designed which matched the KS primer of pBluescriptIl and incorporated a PstI restriction site sequence. The sequence of this primer was 5'-TAATAT GGATCCTGCAGCGAGGTCGACGGTATCG-3'. The Cl plasmid (50 ng) was subjected to 30 cycles of polymerase chain reaction (PCR) with the modified KS primer described above and the normal SK primer at final concentrations of 10 ng/l,l each. For PCR, the following parameters were used: denaturation at 94°C for 30 s, annealing at 50-C for 30 s, and polymerization at 72°C for 60 s. The reaction mixes contained 50 mM KCl, 2 mM MgCl2, 10 mM Tris-HCl (pH 9.0 at 25°C), 1% Triton X-100, 0.2 mM each of the four deoxynucleoside triphosphates, and 1 U of Taq DNA polymerase (Promega). After PCR, the reaction mix was used directly in a restriction digest with PstI and purified with the Prep-agene DNA purification matrix (Bio-Rad). The fragment was ligated with PstI-digested pQE-10 vector treated with calf intestinal alkaline phosphatase (Boehringer Mannheim) and used to transform E. coli SURE cells (Stratagene) by electroporation. Clones containing inserts in the correct orientation were identified by restriction enzyme analysis and DNA sequencing. For expression of recombinant protein, a positive clone was incubated overnight at 37°C with shaking in LB medium supplemented with ampicillin (50 ,glml). This culture was used to inoculate a 100-ml culture (LB with ampicillin at 50 jg/ml), which was grown at 37°C with vigorous shaking until the OD600 reached 0.7 to 0.9. IPTG was added to a final concentration of 1 mM, and the culture was incubated for a further 4 h. Cells were harvested by centrifugation at 4,000 x g for 10 min. The supernatant was discarded, and the pellet was resuspended in 6 ml of 50 mM Tris-HCl (pH 8.0) supplemented with lysozyme (1 mg/ml). The cell suspension was rotated for 1 h at room temperature, snap frozen in liquid nitrogen, thawed at room temperature, and finally sonicated at 20 kHz for 15 min. This lysate was centrifuged at 10,000 x g for 30 min, and the supernatant was mixed with 4 ml of Ni-NTA resin (Qiagen) and rotated for 1 h at room temperature. The resin was loaded into a 1-cm-diameter column and washed with 50 mM Tris-HCl (pH 8.0) (flow rate, 0.5 ml/min) until the OD2. was less than 0.01. The recombinant protein was eluted with a linear gradient to 0.5 M imidazole in 50 mM Tris-HCl (pH 8.0) at a flow rate of 0.5 ml/min. For a negative control, the above procedure was applied to a clone transformed with nonrecombinant pQE-10 vector. Enzymatic analysis of recombinant S. japonicum GAPDH. The activity of the GAPDH enzyme was determined in a coupled test by measuring the decrease in absorbance of NADH at a wavelength of 340 nm (2). Triplicate tests were

INFECT. IMMUN.

performed on recombinant S. japonicum GAPDH, commercial rabbit muscle GAPDH (positive control), and nonrecombinant pQE-10 (negative control). Protein content was determined by the Bradford assay (3). Nucleotide sequence accession number. The DNA sequence of the S. japonicum GAPDH gene has been assigned GenBank accession number L09549. RESULTS Cloning and DNA sequence analysis of S. japonicum GAPDH. Of 6.5 x 105 plaques, 36 immunoreacted positively with HRS. All the positive plaques were picked and rescreened in a second round of immunoscreening to confirm positive signals and plaque-purify the clones. Twenty-nine clones were identified as definitely positive after the second screening. These were all subjected to automatic excision to convert them to plasmid form in pBluescriptIl SK+. The plasmids were sequenced from both ends, and the resulting DNA sequences were used to search for homology in the GenBank data base. One clone (Cl) exhibited significant homology to the GAPDH family of genes from various species, in particular to the nucleotide sequence of S. mansoni GAPDH (11). Cl was fully sequenced by a combination of automated sequencing and manual sequencing with primers designed to match the newly read sequence. The full nucleotide sequence of Cl is shown in Fig. 1. The 1,164-bp cDNA of Cl includes an open reading frame, beginning with the initiation codon ATG at position 4 and ending with a TAA termination codon at position 1018, followed immediately by a second in-frame TAA termination codon at position 1021. The cDNA also includes a presumptive polyadenylation signal (AATAAA) 53 nucleotides upstream from the start of the 39-bp poly(A) tail. The nucleotide sequence of Cl has 81% identity overall with the S. mansoni GAPDH gene and 82.5% within the open reading frame. Analysis of protein structure. The open reading frame encodes a protein of 338 amino acids, as inferred from the nucleotide sequence (Fig. 1). The translation product of this gene has a deduced molecular mass of 36,589 Da and an isoelectric point of 8.2. The protein product synthesized in a rabbit reticulocyte lysate in vitro transcription-translation system migrated at a position, relative to standard markers, of approximately 37 kDa (Fig. 2, lane 2), indicating that a full-length protein had been produced. To confirm that the 37 kDa radioactive product was due exclusively to the cDNA insert of Cl, two control reactions were performed. In one reaction, all the components except plasmid were added. No radioactive product was produced (Fig. 2, lane 1), confirming that the product was not synthesized endogenously by the reaction components. In the second control, a pBluescriptII clone containing a gene known to encode a 47-kDa protein was translated under the same conditions as Cl. This clone produced only a 47-kDa protein and no 37-kDa protein (data not shown), indicating that the 37-kDa product of Cl was due exclusively to the insert and not to pBluescriptII vector sequences. Comparison of the amino acid sequence encoded by Cl with that of S. mansoni GAPDH (Fig. 3) reveals 90% absolute identity and 94.7% identity when conservative substitutions are taken into account. Both proteins are 338 amino acids in length. A number of amino acid residues essential to the enzymatic activity of Bacillus stearothermophilus GAPDH have been determined previously (18, 25). These amino acids play essential roles in enzyme specificity,

CLONING OF S. JAPONICUM GAPDH

VOL. 61, 1993 M

K

S

K

A

V

G

I

N

G

F

R

G

I

G

R

L

V

L

R

A

A

F

L

K

N

T

V

D

I

4719

V

A

V

1

AAAATGTCGAAGGCTAAGGTTGGTATCAATGGGTTTGGTCGTATTGGGAGACTTGTACTCCGTGCAGCTTTTCTCAAAAATACCGTGGATATAGTTGCCG

101

TAAATGATCCATTCATCGATTTAGAGTACATGGTGTACATGATAAAATATGACTCCACCCATGGAAAGTTTCAAGGTGATGTTTCGGTTGAGAATGGAAA

201

ACTTAATGTCAATGGAAGGCTTATATCAGTTTACTGCGAGAGGGATCCATTGAACATACCATGGAACAAGGATGGTGCTGAGTATGTTGTAGAGTCCACT

301

G V F T T I D K A Q A H I K N D R A K K V I I S A P S A D A P M F V GGAGTCTTCACTACAATTGATAAAGCTCAAGCTCATATTAAAAACGATCGGGCTAAAAAAGTTATAATATCAGCTCCGTCGGCAGACGCACCCATGTTTG

401

V G V N E K T Y D K S M S V V S N A S C T T N C L A P L A K V I N TTGTTGGTGTGAATGAAAAGACTTACGACAAGTCAATGTCTGTGGTTTCGAATGCATCGTGCACCACAAACTGTCTAGCACCTCTAGCTAAAGTCATTAA

501

D N F E I V E G L M T T V H S F T A T Q K T V D G P S S K L W R D TGACAATTTTGAAATAGTTGAAGGCCTTATGACTACTGTACACTCATTTACGGCTACGCAAAAGACCGTTGATGGACCATCTTCAAAACTGTGGAGAGAT

601

G R G A F Q N I I P A S T G A A K A V G K V I P A L N G K L T G M A GGTCGTGGGGCGTTTCAGAATATTATTCCAGCCTCCACTGGTGCTGCAAAGGCAGTGGGCAAAGTCATCCCTGCATTAAACGGAAAGTTGACAGGAATGG

701

F R V P T A N V S V V D L T C R L G K G A T Y D Q I K A V I K A A CTTTCCGGGTGCCTACAGCGAATGTTTCAGTAGTTGACCTGACATGCAGGTTGGGCAAAGGAGCTACCTACGATCAAATCAAGGCTGTGATCAAAGCAGC

801

A N G P L K G I L E Y T E D E V V S S D F I G C T S S S I F D A K CGCAAATGGACCATTAAAAGGCATCTTGGAATATACTGAAGACGAAGTTGTCAGCTCAGACTTTATTGGATGTACCAGTTCATCCATATTTGATGCAAAG

N

L

P

D

N

V

F

N

I

L

D

G

R

L

E

Y

I

S

M V

V Y

Y C

I

M

E

R

K D

Y

P

D L

S N

T I

H P

G W

K N

F K

Q D

G G

D A

V E

S Y

V V

E V

N

E

G

S

K

T

901

G I S L N N N F V K L V S W Y D N E F G Y S C R V V D L I T H M H GCTGGAATCTCTCTCAACAACAATTTCGTGAAACTGGTTTCATGGTACGACAATGAATTCGGCTACAGTTGCCGCGTGGTCGATCTCATCACGCATATGC

1001

R V D H S * * ATAGAGTCGACCATTCTTAATAAAATAGCTTTCAACGTAGTCTACGATTTTCGTTTATAGATAACGAATAAAGTGTTGATCTACTCTATTATTTTATCAT

1101

TCTTAACCAAATATCATTATAATTC

A

FIG. 1. Nucleotide sequence of clone Cl. Nucleotides are numbered at the left side of each row. Amino acids encoded by the open reading frame are indicated above the nucleotide sequence by the single-letter amino acid code. Termination codons are marked by asterisks. A presumptive polyadenylation signal (AATAAA) is underlined.

charge transfer, or binding of NAD (coenzyme), glyceraldehyde 3-phosphate (substrate), or Pi. The corresponding amino acids of S. mansoni GAPDH have been compared with those found at the essential positions in the B. stearothennophilus enzyme (11). Comparison of the amino acid sequence of the S. japonicum GAPDH that we have obtained with that of S. mansoni GAPDH shows that none of the amino acids that differ between S. mansoni and S. japonicum are located at positions essential for GAPDH activity. 1

2

kDa 205 11697 6645I

Suggest Documents