The Plant Journal (2001) 26(3), 339±349
Collateral gene expression changes induced by distinct plant viruses during the hypersensitive resistance reaction in Chenopodium amaranticolor Bret Cooper Torrey Mesa Research Institute, 3115 Merry®eld Row, San Diego, CA 92121, USA Received 22 February 2001; accepted 5 March 2001. For correspondence (fax +1 858 812 1105; e-mail
[email protected]).
Summary Hypersensitive reactions to plant diseases are typically mediated by R genes. Many R genes that have been cloned only confer resistance to a particular pathogen. However, Chenopodium spp. have multivirus hypersensitive resistance, thus making the understanding of this broad-spectrum resistance mechanism attractive. Using tobacco mosaic virus (TMV) tagged with green ¯uorescent protein to follow infection over time, cDNA-AFLP to ®nd genes up-regulated during virus infection in C. amaranticolor and quantitative RT±PCR to accurately measure gene expression at different time points, the ®rst dissection of this signi®cant defense response pathway is presented. The detected diseaseexpressed sequences in C. amaranticolor (DESCA) are similar to those that encode p450 monooxegenases, hypersensitivity-related genes, cellulases, ABC transporters, receptor-like kinases, serine/threonine kinases, phosphoribosylanthranilate transferases and hypothetical R genes, many of which are associated with pathogen defense in other plants. The expressions of these DESCA genes are also induced by infection with the taxonomically distinct tobacco rattle virus (TRV) in C. amaranticolor. In particular, DESCA1, one of the gene fragments from C. amaranticolor that lacks similarity to any other sequence in the GenBank database, is induced at least 200 fold 4 d after infection (dai) by both TMV and TRV. The potential role of DESCA genes in a C. amaranticolor multivirus defense response with regard to their levels and time of gene expression is discussed. Keywords: hypersensitive resistance, tobacco mosaic virus, cDNA-AFLP, Chenopodium, GFP, DESCA.
Introduction A number of hypersensitive disease resistance systems has been studied and much progress has been made recently in characterizing R (resistance) genes and their cognate pathogen-encoded avirulence genes (Bent, 1996; Boyes et al., 1996; Dangl, 1995; Hammond-Kosack et al., 1996; Jones, 1996; Staskawicz et al., 1995). Subsequent to recognition of the pathogen by the host, a complex series of biochemical and physiological changes is induced that mediates intercellular signaling, apoptosis in the vicinity of the infection sites, attack of the microbe directly, and establishment of a persistent state of heightened sensitivity and resistance against a range of pathogens throughout the tissues of the plant (Dixon and Lamb, 1990; Fritig et al., 1987; HammondKosack and Jones, 1996; Lamb et al., 1989; Ryals et al., 1994). Many of the biochemical and physiological ã 2001 Blackwell Science Ltd
changes that take place during hypersensitive resistance (HR) have been well de®ned, and advances have begun to elucidate the signal-transduction events that coordinate this form of plant defense (Dangl et al., 1996; Dangl, 1995; Hammond-Kosack and Jones, 1996; Jones, 1996; Lamb et al., 1989; Lamb, 1994). Despite the high degree of pathogen speci®city of R gene-mediated pathogen recognition, the consequent HR appears to be very similar for a variety of host±pathogen interactions. This supports the traditional view that separate gene-for-gene signaling pathways may activate similar downstream response mechanisms (Lamb et al., 1989). Of the many disease resistance mechanisms that can be studied, the HR system of Chenopodium spp. should be attractive to plant pathologists because of the broadspectrum virus resistance the plants have. Members of the 339
340
Bret Cooper
Figure 1. C. amaranticolor inoculated with TMV-MGfus. Four dai ¯uorescent light (a). 7 dai ¯uorescent light (b). 11 dai ¯uorescent light (c). 4 dai visible light (d). 7 dai visible light (e). 11 dai visible light (f). Images d, e and f were equally adjusted for contrast and brightness with Adobe Photoshop 5.0 software to better resolve the tissue chlorosis (con¯uent area of yellow) seen in f, but not d or e. Image pairs a and d, b and e, and c and f are each taken of the same respective tissues with different light sources and are, thus, superimposable. (Black bar = 0.4 mm).
bromo-, como-, cucumo-, ilar-, alfamo-, nepo-, sobemo-, tombus-, tymo-, carla-, clostero-, hordei-, potex-, poty-, tobra- and tobamovirus groups elicit local lesion HR on Chenopodium spp. (CMI/A.A.B. Description of Plant Viruses, 1984; Cooper et al., 1995). In many instances, the HR completely blocks viral spread. However, some viruses can break through the induced hypersensitive response and move systemically through certain species (Rao and Grantham, 1995). The genetic mechanisms of Chenopodium spp. HR are unde®ned. However isozyme pro®ling studies have shown that some of the gene products involved in common defense signaling pathways in other plants are induced by viral infections during HR in C. foetidum (Visedo et al., 1990). Some circumstantial experimental evidence suggests that Chenopodium HR may be similar to HR controlled by the tobacco N gene, which confers multivirus resistance to most naturally occurring tobamoviruses (Whitham et al., 1994). Genetically engineered movement defective tobacco mosaic tobamovirus (TMV) will replicate within an inoculated cell of a tobacco plant with an N gene, but fails to move from cell to cell (Cooper et al., 1996).
Hypersensitivity is not induced, meaning that replication alone is not suf®cient to induce the HR (despite the N gene elicitor being mapped to the replicase gene of TMV [Padgett and Beachy, 1993]). Thus, the process of virus movement may trigger hypersensitivity, which implicates intercellular signaling in this type of HR. Support for this possibility comes from experiments in which cell-to-cell contacts were disrupted in tobacco carrying the N gene, resulting in the prevention of necrotic lesion formation in infected leaves (Gulyas and Farkas, 1978). Likewise, TMV will not induce hypersensitive cell death in N genotype tobacco protoplasts whose plasmodesmata are not intact (Otsuki et al., 1972), while the HR does occur in N genotype tobacco callus cultures whose plasmodesmata are intact (Beachy and Murakishi, 1971). By comparison, in C. quinoa, movement defective brome mosaic bromovirus (BMV) replicates but fails to move from cell to cell (Schmitz and Rao, 1996). Initial infection is not suf®cient to induce HR. Similarly, in C. amaranticolor, cucumber mosaic cucumovirus (CMV) lacking a movement protein replicates within inoculated cells but fails to move and does not elicit cell death (Canto and Palukaitis, 1999). Therefore, like TMV ã Blackwell Science Ltd, The Plant Journal, (2001), 26, 339±349
Hypersensitive virus resistance in Chenopodium on tobacco carrying the N gene, the process of viral spread of BMV and CMV in C. quinoa and C. amaranticolor may be responsible for inducing HR. In light of this important similarity between the two systems, Cheonopodium multivirus resistance may not necessarily be regulated by a single R gene. However, it would be scienti®cally important to understand how Chenopodium can have an HR to so many different viruses. Thus, Cheonopodium provides us with a unique system from which we can isolate genes that act in restricting viral spread and that are suf®cient to confer multivirus resistance to a plant. To elucidate which genes may be involved in the complex signaling and regulation pathways that mediate the response of Chenopodium to viruses, cDNA-AFLP technology and quantitative RT±PCR was used to discover and con®rm genes whose expressions are up-regulated during the subsequent induction of HR in C. amaranticolor after infection with distinct viruses, TMV and tobacco rattle tobravirus (TRV). A number of new genes with similarity to known genes whose expressions are coordinated with pathogen attack in other plants has been identi®ed. Results Using cDNA-AFLP to discover genes induced during virus infection The interaction of the elicitor and the R gene product establishes a cascade of reactions and signaling events that is then manifested in a phenotypic HR. In essence, HR is the end result of disease activated signaling events. In order to detect the early expression of genes induced by viral infection, it was necessary to isolate infected tissue before the onset of local lesion formation. Therefore, infection of C. amaranticolor with RNA transcripts of TMVMGfus (Heinlein et al., 1995) that express GFP in infected cells was carred out. This enabled monitoring of the infectious spread over time. Infection foci comprising over 100 cells could be detected at 4 dai (days after innoculation) and foci of more than 500 cells could be detected at 7 dai (Figures 1a, 1b). There was no visible appearance of cell death or chlorotic local lesion formation at the infection foci at 4 and 7 dai (Figures 1d, 1e). By 11 dai, the infection foci were associated with chlorotic local lesions (Figure 1f). Virus infected tissue was excised from leaves at each time point and RNA was puri®ed from the tissue and used for cDNA-AFLP (Bachem et al., 1996). Tissue from mock inoculated leaves was excised and treated in a comparable way to eliminate differential wound response effects. cDNA made from poly A + RNA was digested with EcoRI and MseI, and linkers were ligated to the ends of the digested molecules. A subset of these molecules was ã Blackwell Science Ltd, The Plant Journal, (2001), 26, 339±349
341
ampli®ed using sets of MseI-NN or MseI-N primers along with 5¢NED-EcoRI-NN primers. These ¯uorescent cDNAAFLP fragments were separated on polyacrylamide sequencing gels and imaged with a ¯uorescent scanner. Samples derived from mock-inoculated tissue at 7 dai were run next to samples derived from TMV-MGfus infected tissue at 7 dai for comparison. Ninety-eight bands whose intensities in the TMV-MGfus lanes were greater than that of analogous bands in the mock lanes were identi®ed (data not shown). A deliberate choice was made not to select genes down-regulated during the virus infection. Nonetheless, these genes are equally interesting for understanding a plant's response to virus infection. Thirty out of the 98 bands were also up-regulated in an independent set of experiments designed to reduce biological variation between experiments. These bands were excised from the gel, reampli®ed, and sequenced. Figure 2 shows one gel from which bands were excised (Figure 2). Obviously, there were many bands that did not remain up-regulated when independently reanalyzed with the same primer pairs. For example, the band labeled 10d tcg was not up-regulated in the TMV-MGfus infected sample in the repeat experiment (Figure 2 and see below). Similarly, and for technical reasons rather than biological reasons, not all cDNA fragments could be reampli®ed from the gel despite being noticeably upregulated in the TMV-MGfus infected sample (bands 11b aact and 14b atct, Figure 2). Likewise, some gene fragments yielded low quality sequence data. Triage left 19 gene fragments to be quantitatively examined for gene expression levels. Similarities of C. amaranticolor genes to other disease resistance genes The hypothetical protein sequences derived from the reampli®ed fragments translated from all six reading frames were compared with sequences in the GenBank protein sequence database and the BLASTX (Altschul et al., 1997) results are summarized in Table 1. The disease-expressed sequences in C. amaranticolor (DESCA) whose gene expression levels were quantitatively con®rmed have been deposited in GenBank. To con®rm that the expression levels of DESCA genes were induced in infected tissue compared with mock inoculated tissue, the relative amount of DESCA and actin transcript in a third independent set of samples at 4 dai, 7 dai, and 11 dai was quantitatively measured by RT±PCR using TaqMan chemistry. (Table 1). The expression level of DESCA1 (Figure 2) increased most in the TMV-MGfus infected plants. The expression level of DESCA1 increased 200 times by 4 dai but tapered off drastically by 11 dai. DESCA1 is unrelated to any protein known at this time.
no signi®cant similarity ser/thr kinase endo-1,4-betaglucanase pdr 5-abc transporter transcriptional regulator protein kinase salicylate-induced glucosyltransferase IS5a nbs-LRR cytochrome p450 monooxygenase MRP-like ABC transporter phosphoribosylanthranilate transferase hypersensitivity-related 201 integral membrane glycoprotein no signi®cant similarity hypothetical protein F3F9.18 no signi®cant similarity actin
DESCA1 DESCA2 DESCA3 DESCA4 DESCA5 DESCA6 DESCA7
tobacco puffer ®sh ± Arabidopsis ± C. rubrum
Arabidopsis Arabidopsis
rice tobacco
± bean rape duckweed yeast Arabidopsis tobacco
Organism
X95343 AF013613 ± AC013430 ± X92353
U96399 AAF18518
AAF82158 X96784
± AF078082 AJ242807 Z70524 NP 014933 T00502 T03747
Related accession number
3e-23 9e-1 ± 7e-15 ± 7e-45
8e-7 8e-17
5e-2 7e-31
± 2e-12 4e-19 1e-27 9e-1 7e-1 2e-21
Blast score*
1
*NCBI BLASTX translated search (Altschul et al., 1997). Values are the fold increases in gene expression of TMV-MGfus infected compared to mock-inoculated plants. 2 Values are the fold increases in gene expression of TRV infected compared to mock-inoculated plants. 3 Values are the fold increases in gene expression of TMV infected compared to mock-inoculated plants.
DESCA12 DESCA13 7a tgaa 10d tcg 11a tgca c.r. actin
DESCA10 DESCA11
DESCA8 DESCA9
Related known protein
cDNA Related
5.0 2.9 1.5 2.2 1.6 1.0
5.6 5.5
5.9 5.1
200 36 23 21 19 8.4 8.9
4dai
2.4 1.8 1.4 0.75 0.54 1.0
1.9 3.6
3.2 5.9
180 25 15 9.2 8.0 9.6 2.8
7dai
TMV1
1.7 1.9 1.7 0.25 0.18 1.0
0.95 3.0
2.0 4.2
6.1 27 2.7 4.5 9.1 12 5.6
11dai
C. amaranticolor
5.6 3.3 not tested not tested not tested 1.0
4.1 3.9
5.8 3.1
278 10 19 6.8 15 2.1 53
4dai
TRV2
Gene expression fold changes
7.9 34 not tested not tested not tested 1.0
not detectable 230
120 not detectable
not detectable 700 46 52 1100 not detectable 150
4dai
TMV3
C. quinoa
Table 1. cDNA-AFLP gene fragments with similarity to other known proteins and their relative gene expression fold changes at different time points during viral infections as determined by quantitative RT±PCR
342 Bret Cooper
ã Blackwell Science Ltd, The Plant Journal, (2001), 26, 339±349
Hypersensitive virus resistance in Chenopodium
Figure 2. cDNA-AFLP gel analysis of mock-inoculated versus TMV-MGfus inoculated C. amaranticolor. Chosen induced bands in the TMV-infected samples are noted with an arrow. The corresponding primer pairs for various primer sets are at the bottom of the ®gure and can be identi®ed by the designation for the penultimate and last bases for the EcoRI primer (RI) and the last or the penultimate and last bases for the MseI primer (Mse) used in the cDNAAFLP PCR reactions. Base pair sizes are noted on the left. M, mockinoculated; T, TMV-inoculated.
Two sequences, DESCA4 and DESCA10, are both related to pump-encoding genes found in Arabidopsis and yeast (Balzi et al., 1994; Sanchez-Fernandez et al., 1998; Smart and Fleming, 1996). DESCA4 is expressed highly at 4 dai but the expression drops off over time whereas DESCA10 is only moderately induced and its expression returns to normal by the time of the visible appearance of local lesions in C. amaranticolor. DESCA7 is similar to a salicylate-induced glucosyltransferase gene in tobacco (Horvath and Chua, 1996). DESCA9 is similar to cytochrome P450-like proteins that can produce cytotoxic compounds such as phytoalexins that ã Blackwell Science Ltd, The Plant Journal, (2001), 26, 339±349
343
are deployed by a plant to defend against invading microbes. DESCA12 is related to a proanthranilate benzoyltransferase from carnation that plays a direct role in the phytoalexin biosynthesis in carnation (Yang et al., 1998). DESCA11 is similar to the tryptophan biosynthetic enzyme phosphoribosylanthranilate transferase whose gene expression is induced in the presence of ozone in Arabidopsis (Conklin and Last, 1995). The gene expressions of DESCA7, 9, 11 and 12 are only moderately induced. DESCA3 is similar to endo-1,4-betaglucanases that have a role in fruit ripening, abscission, and cell elongation (Lashbrook et al., 1994). DESCA3 is highly expressed in the infected C. amaranticolor and remains highly expressed until the appearance of local lesions. Many disease responses are mediated by positive regulators such as transcription factors or protein kinases that kick-start signaling cascades for the activation of defense responses. One such possible gene, DESCA5, is loosely similar to a yeast potential transcriptional regulator. DESCA5 expression is twice as high during the early stages of infection compared with the late stages of infection, an observation that could corroborate an importance for gene regulation at the early stages of infection. DESCA6 is related to protein kinase homologues of Arabidopsis. Protein kinases have essential roles in programmed cell death during viral infection (Dunigan and Madlener, 1995). DESCA2 is the most highly expressed of the group suggesting that it is an important regulator at the onset of infection. It is similar to a receptor-like protein kinase in bean that responds to Fusarium solani attack (Lange et al., 1999). Some R genes have kinase-like regions that must have a function in initiating a signal cascade during the onset of HR (Song et al., 1995; Zhou et al., 1997). Global amino acid sequence alignment (Henikoff and Henikoff, 1992) of DESCA2 with Pto or Xa21, R gene proteins with ser/thr kinase domains, reveals a 37% similarity. Interestingly, DESCA8 has a nucleotide binding site and a leucine-rich repeat that is common for many R gene proteins that can be found in other plants (Leister et al., 1998; Meyers et al., 1999). Some cDNA fragments whose gene expressions appeared to be increased in the TMV-MGfus infected plants in the cDNA-AFLP gel were not actually increased when the gene expression level was measured quantitatively. For example, the bands labeled 7a tgaa and 11a tgca appear to be increased in virus infected C. amaranticolor (Figure 2). But in fact, the amounts of their cognate mRNAs were lower when measured by quantitative RT±PCR (Table 1). Likewise, the band labeled 10d tcg, which appeared to be increased in the ®rst set of TMV-MGfus infected plants studied by cDNA-AFLP but not in the second (Figure 2) did not have a cognate mRNA that was
344
Bret Cooper
increased in the third set of infected plants when measured by quantitative RT±PCR (Table 1). Linking DESCA genes to a multivirus resistance pathway To illustrate that the same DESCA genes induced by TMV could be induced by a heterologous virus, C. amaranticolor was inoculated with tobacco rattle tobravirus (TRV), a virus that is taxonomically distinct from TMV. Local lesions appeared by 4 dai and RNA was puri®ed from the infected leaves. DESCA gene expression levels in infected tissue were compared with mock inoculated tissue by quantitative RT±PCR and revealed that the same DESCA genes induced during a TMV infection are also induced during a TRV infection (Table 1). To determine whether orthologous DESCA genes are induced during HR in another Chenopodium species, the gene expression levels in TMV infected C. quinoa were measured using the same C. amaranticolor-derived primers. Most of the orthologous DESCA genes were upregulated in C. quinoa and were expressed at levels many times higher than in C. amaranticolor (Table 1). This may be a result of the infection of C. quinoa with the aggressive wild-type virus rather than slower moving TMV-MGfus. Expression levels of DESCA1, 6, 8 and 9 could not be determined. Perhaps the probe/primer sets do not hybridize to the orthologous sequences in C. quinoa or these orthologous sequences are absent in C. quinoa. Discussion cDNA-AFLP as a means for gene discovery cDNA-AFLP is a useful technology for detecting differential gene expression (Bachem et al., 1996). With commercially available materials and reagents and a few modi®cations to allow for the ¯uorescent detection of molecules, one can establish a high-throughput gene expression detection system. Using a theoretical estimate for the number of times a six-base recognizing restriction endonuclease will cut a 1000-bp cDNA (1/4096) one would need to digest cDNAs with at least four separate six-base endonucleases to cover more than 90% of a transcriptome, assuming the average transcript is 1000 bases long. By these estimates, nearly 25% of the transcriptome using all combinations of EcoRI-NN and MseI-N or MseI-NN primers have probably been screened. Nevertheless, despite the strict requirements of only selecting up-regulated genes that were detected repeatedly in three independent experiments to eliminate biological variation and false positives, a requirement that many researchers choose not to impose when implementing cDNA-AFLP technology, it was possible to prove that 13 of the detected gene fragments are induced during TMV and TRV infection in C. amaranticolor.
Whereas cDNA-AFLP gene expression analysis can be overshadowed by the seemingly sexier gene expression analysis that can be performed with oligonucleotide arrays (Harmer et al., 2000), cDNA-AFLP is useful when genome sequence data is unavailable or when such arrays are not available. Molecular mechanisms behind HR Generally, pathogen infection induces a complex series of biochemical and physiological changes that mediate resistance against a range of pathogens throughout the tissues of the plant (Dixon and Lamb, 1990; Fritig et al., 1987; Hammond-Kosack and Jones, 1996; Lamb et al., 1989; Ryals et al., 1994). One of the earliest detectable signs of the HR is a rapid oxidative burst that precedes the appearance of visible necrosis by several hours and plays an important role in regulating other aspects of the defense response (Dangl et al., 1996; Dixon et al., 1994; Hammond-Kosack and Jones, 1996; Low and Merida, 1996; Mehdy, 1994). Reactive oxygen intermediates (ROIs) that may be generated by the action of a membrane-bound NADPH oxidase complex (Desikan et al., 1996) are produced in the area of tissue where the local necrotic lesion forms and accumulate within that region to levels that may have a direct toxic effect on the cells of the plant and the invading pathogen (Peng and Kuc, 1992). Given the fact that gene expression was not analyzed until 4 dai, there is a good chance that the experiments did not detect the gene expressions coordinated with these immediate events. Rather these genes are likely to be recognized if they are part of a positive feedback loop or other genes triggered in a secondary defense scheme. In a parallel approach using a separate system, Durrant et al. (2000) successfully avoided detection of gene expressions in¯uenced by ROIs in order to concentrate on unrelated downstream signaling events. In the tissues that surround the necrotic zone, lower concentrations of ROIs play a catalytic role in the rapid formation of physical barriers, which include cross-linked cell wall proteins (Bradley et al., 1992) and lignin deposits (Gross et al., 1977). Low levels of ROIs may also coordinate plant defense gene induction (Dangl et al., 1996) and signal salicylic acid (SA) biosynthesis. SA may cause HR by inhibiting catalase activity which functions to exacerbate the effects of ROIs (Chen et al., 1993), or SA may be a result of HR and be transformed into a free radical that modi®es other molecules (Savenkova et al., 1994). Additionally, the onset of a cascade of reactions occurs, including programmed cell death (Dangl et al., 1996; Jones and Dangl, 1996; Lamb, 1994; Mittler and Lam, 1995), the coordinated induction of pathogenesis-related genes (Ryals et al., 1994), wound-induced gene expression (Farmer, 1994; Pena-Cortes et al., 1993), and the production of pathogen ã Blackwell Science Ltd, The Plant Journal, (2001), 26, 339±349
Hypersensitive virus resistance in Chenopodium toxins such as phytoalexins (Smith, 1996). Biosynthesis of ethylene gas and ion ¯uxes across membranes also increase dramatically prior to HR (DeLaat and VanLoon, 1983; Pritchard and Ross, 1975; Weststeijn, 1978). Ethylene has been shown to enhance the sensitivity of defense gene induction by SA, implying that the defense responses may be modulated by multiple signaling pathways (Lawton et al., 1994). The experimental procedure presented here may detect any similar gene involved in the aforementioned signaling pathways such as SA signaling. Except for DESCA1, whose expression is increased the most at 200 + fold but whose identity remains elusive at this time, many of the fragments are similar to other genes that have already been placed in disease resistance pathways in other plants. DESCA12 and DESCA9 are, respectively, similar to hypersensitivity related gene 201 (possibly a proanthranilate benzoyltranferase; see Results section) and genes encoding p450 monooxygenases. Both which are expressed during the hypersensitive response in tobacco upon infection with Pseudomonas solanacearum but are not regulated by SA (Czernic et al., 1996). However, DESCA7 is similar to a salicylate-induced glucosyltransferase gene in tobacco (Horvath and Chua, 1996). Clearly, the disease resistance response in C. amaranticolor involves pathways both dependent and independent of SA signaling. The discovery of DESCA4, DESCA7, DESCA9, DESCA10, and DESCA12, reveals the underpinnings of an endogenous detoxi®cation system, described by Rea et al. (1998) as a multiphase process. Brie¯y, the activation phase involves cytochrome P450 monooxygenases introducing functional groups (e.g. aromatic rings) to potential toxins. The conjugation phase in plants involves the linking of glutathione or glucose to the toxin at which point the conjugated molecule can be recognized by an ATP-binding cassette transporter and pumped into the vacuole (or possibly the neighboring cells) during the elimination phase. The ®nal phase includes either storage or breakdown of such molecules. DESCA9 (similar to cytochrome P450 genes) and DESCA12 (similar to a gene associated with the production of phytoalexin) could produce potential toxins. In fact, C. amaranticolor produces many such compounds that are antiviral to TMV (De Oliveira et al., 1993). DESCA7 (similar to a glucosyltransferase) could conjugate such toxins to be transported by the ABCtransporters encoded by DESCA4 or DESCA10. In this particular case, the transported compound could then be deployed by the infected plant cell as an antiviral agent or cytotoxic compound, stored by non-infected cells in anticipation of infection, or eliminated by non-infected cells neighboring infected cells. All of these genes must be part of some multivirus resistance pathway since they are induced by TMV and TRV in C. amaranticolor. The DESCA genes described here may not act in concert or be ã Blackwell Science Ltd, The Plant Journal, (2001), 26, 339±349
345
completely responsible for HR, however. The expression of an orthologue of DESCA10 has not been detected in C. quinoa even though TMV induces HR in that plant. Although genes involved in down-stream signaling events of HR are certainly important and may contribute to the end result of multivirus resistance, the R genes responsible for the early recognition of the multiple viruses in C. amaranticolor should be appealing to those who study disease resistance. Is cDNA-AFLP capable of detecting differential R gene expression? Possibly. The expression of Xa1, an R gene in rice that confers resistance to Xanthomonas oryzae, is induced upon infection (Yoshimura et al., 1998). Are any of these DESCA genes candidates for early recognition of plant viruses? DESCA1 may be although the expression of its orthologue was not detectable in C. quinoa. There may be species-speci®c sequence differences between DESCA1 orthologues that fall in the regions that the probes and primers were designed to. Better candidates are DESCA8 and 2. DESCA8 encodes a nucleotide binding site and a leucine-rich repeat that are common for many R genes that can be found in other plants (Leister et al., 1998; Meyers et al., 1999). DESCA2 is induced in both Chenopodium species and is similar to other R genes, Xa21 and Pto, which have similar ser/thr kinase domains. Furthering the understanding of discovered DESCA genes The transfer of any potential HR genes from one member of the Chenopodiaceae to another will help establish that cloned genes are involved in HR. For example, BMV induces local lesions that do not limit the systemic spread in the green variety of C. hybridum (Verduin, 1978). Restoration of the restriction of viral spread in the green variety transformed with a gene from the purple variety that does limit spread is possible since Chenopodium spp. are amenable to transformation (Komari, 1990). Thus, a system for complementation, reverse genetics, overexpression, and gene silencing is within reach to study novel genes. Furthermore, since the R genes N and Pto have been shown to function in heterologous species (Rommens et al., 1995; Whitham et al., 1996), there is practical hope that the Chenopodium genes will be able to initiate hypersensitivity in crops or Arabidopsis. However, current cross-compatibility of known R-genes has only been experimentally demonstrated in Solanaceae species. The downstream signaling genes that allow for cross-compatibility in Solanaceae may not exist in other species from other families. Recent experiments that focus upon some of the visual and molecular markers of HR, such as timing of necrosis and activation of known defense genes, reveal that separate pathogens elicit somewhat different responses (Reuber
346
Bret Cooper
Table 2. Probe and primer sets used in quantitative RT±PCR to determine expression levels of particular genetic sequences in infected and mock-inoculated C. amaranticolor cDNA
forward primer
reverse primer
¯uorescent probe
DESCA1 DESCA2 DESCA3 DESCA4 DESCA5 DESCA6 DESCA7 DESCA8 DESCA9 DESCA10 DESCA11 DESCA12 DESCA13 7a tgaa 10d tcg 11a tgca c.r. actin
aattctagagctgaacttacaagaacatct ggcgacattcctacctccaa tcgtactcgaggaggattgataga agtagggaaatagaggtcctgtgaac cttttattaggacaaaatgaagctacattac caattcgcccatgagcatatt ggtcgacaatatcactgacagatga ggaggtcgtgctcaatgca tgatatgtttatggagcatgtattagatga aattcgattcaccagcaaggtt gcgttggttgattgattgtagct ggcgaacttcccatcatca cagttattatcaccgccttacattacat ccgacatcgaaggatcaaaaag gaggataacattctgggagctatttt aaaatctacaattggaaatacattcatga ccagaagagcatcctgttttgc
ggtgtcataataaagtgatactacatacatacca gctaggacaatctaagccaatcct ccaaaaatgctgtattcgctaca aattatacaggagaaacaaagcagtgat agacatatcaatagacaatagtcacaataatg ggcttataattagagaagtgactgaagtgt catataaacttctccccgcatctt ggtgcttcatgagattggtcttt acaaaacatccaccatatctttagga gcgatttgcgtattcttgtacca aaagacttgaaccctgtttggaat aaatggttgcagtctccctatgtat tgattcgtggagtgccga accacagggataactggcttgt tgttcctcaatatcttcccgagat gcgtaccaattctgaacgagagt tctgagtcatcttctccctgttagc
tttccatcaatctatgatgactttaat* ctgccgcataatcaacgcacgtctt caatggctttggtcctccactgttcag aggtcgaggcgttcccaactcctg tgtcacaccacaaatcacatctaaagtg* ctcattttcttcttcatggtcaca* ccaacccgttagccaactctgtgatctg cggctcctctgtggccatagatacaa cccaattttccttgtcattttct* ctcgataggccatcaatattcgcagca aatccaaacaatcttcccaatcttacc* ctggaactatcgaacatccccattggg caagcacgaacacattcaactgtatg* cgtcgctatgaacgcttggctgc tggcgtctttcaagtcctcccatatgct ttatcttagtcagtgctgtgagtcct* ctgaggccccactgaaccccaa
*Turbo TaqMan Probe (Applied Biosystems, Foster City, CA, USA)
and Ausubel, 1996; Ritter and Dangl, 1996). This suggests that HR is not induced through entirely common mechanisms, but to some extent, through some distinct signaling pathways. It remains to be determined if the DESCA genes described here (despite being clearly shown to be induced by separate viruses) are activated in a virus-speci®c or virus-general manner or if the genes are just generally associated with HR. Given the enormous number of viruses that induce hypersensitivity in this plant, it seems likely that a resistance mechanism that is sensitive to a function that most viruses share, such as cell-to-cell movement, could result in the gene expressions being activated by collateral virus infection. Consequently, advanced work will have to approached with care, because information obtained from plant-pathogen systems must not be generalized. Much effort will be required to explore the possible diversity of signaling events that mediate the activation of HR in each plant species against any range of pathogens. Experimental procedures Infection of plants Leaves of 10-wk-old C. amaranticolor or C. quinoa were inoculated with in vitro transcripts of TMV-MGfus (Heinlein et al., 1995), TMV virions, tobacco rattle tobravirus (TRV), or they were mockinoculated (hand-rubbed with buffer). TMV-MGfus encodes GFP fused to the viral movement protein. Infectious spread can be monitored through the detection of GFP. Using an Olympus stereomicroscope (Olympus America, Inc., Melville, NY, USA) ®tted with a U-ULH Olympus lamp, infected C. amaranticolor tissue accumulating GFP was excised at 4, 7 and 11 dai. Leaves
inoculated with TRV or TMV were collected at 4 dai, at which point local lesions were forming. Mock-inoculated tissue was collected at the same time and treated similarly as infected tissue. Tissue was frozen in liquid nitrogen and total RNA was puri®ed from it. Three separate sets of plants were inoculated with TMV-MGfus and yielded three independent preparations of RNA.
cDNA-AFLP Poly A + RNA was isolated from TMV-MGfus infected C. amaranticolor using Qiagen's Oligotex mRNA puri®cation system (Qiagen, Valencia, CA, USA) and cDNA was generated using cDNA synthesis reagents from Life Technologies (Rockville, MD, USA). cDNA was used to generate AFLP fragments with the AFLP reagents from Life Technologies and reactions were performed according to the manufacturer's instructions. cDNA made from one microgram of poly A + RNA was digested with EcoRI and MseI and the supplied compatible linkers were ligated to the ends of the digested molecules. A few modi®cations were introduced to the kit. EcoRI-NN primers (GACTGCGTACCAATTCNN), rather than EcoRI-NNN, were used with the 5¢ ¯uorescent label NED (Applied Biosystems, Foster City, CA, USA) and MseI-N and MseINN [GATGAGTCCTGAGTAAN(N)], rather than MseI-NNN, primers were used (Genosys, The Woodlands, TX, USA) to reduce the complexity of the primer sets evaluated. All possible primer combinations (256 + 64) were used for PCR ampli®cation and products were separated on polyacrylamide gels and visualized using a Genomyx SC ¯uorescent scanner (Beckman Coulter, Fullerton, CA, USA). Gene fragments that appeared to be induced in infected tissues compared with mock-inoculated tissues were tested to see if they were also induced in a second preparation of cDNA from RNA from a second set of infected plants. Gene fragments that were induced in both RNA preparations were excised from the gel, eluted from the gel in water and reampli®ed by PCR using the appropriate MseI and EcoRI primers and sequenced with 377 ABI sequencers (Applied Biosystems) using dideoxysequencing methods. Gene fragments were initially desã Blackwell Science Ltd, The Plant Journal, (2001), 26, 339±349
Hypersensitive virus resistance in Chenopodium ignated by the quadrant of the gel in which they appeared (e.g. 13c) and by the primer sets used to amplify the product (tact for EcoRI-TA + MseI-CT primers). Once it was determined that the transcription of the corresponding gene was induced during viral infection the band was given the DESCA nomenclature. For example, the band labeled 13c tact was renamed DESCA1
Quantitative RT±PCR DNase treated total RNA (2 ng per reaction) from the third independent preparation of TMV-MGfus infected C. amaranticolor, the ®rst preparation of TRV infected C. amaranticolor, or the ®rst preparation of TMV C. quinoa was used with TaqMan OneStep RT±PCR reagents for quantitative analysis (Holland et al., 1991) in an ABI 7700 (Applied Biosystems). Reactions were performed according to the manufacturer's instructions. Primers and 6-FAM 5¢ end-labeled probes (6-carboxy¯uorescein, Applied Biosystems or Genosys) were designed from the sequences from the C. amaranticolor induced gene fragments using Primer Express software (Applied Biosystems) and are listed in Table 2. Expression levels were interpolated from standard curves with a correlation coef®cient of 0.99 or greater and the quantities were normalized to the expression level of actin in each sample.
Acknowledgements I am grateful for the help of Kimberly Campbell for growing plants, Mona Jazayeri for lab assistance, Todd Moughamer for sequencing, and Dr Steve Whitham and Dr Jane Glazebrook for review of the manuscript. I also thank Dr Roger Beachy for the continued use of TMV-MGfus. This work was supported in kind by Dr Xun Wang and Dr Jane Glazebrook at the Torrey Mesa Research Institute, San Diego, CA, USA.
References Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J.H., Zhang, Z., Miller, W. and Lipman, D.J. (1997) Gapped BLAST and PSIBLAST: a new generation of protein database search programs. Nucl Acids Res. 25, 3389±3402. Bachem. C.W.B., van der Hoeven, R.S., de Bruijn, S.M., Vreugdenhil, D., Zabeau, M. and Visser, R.G.F. (1996) Visualization of differential gene expression using a novel method of RNA ®ngerprinting based on AFLP: analysis of gene expression during potato tuber development. Plant J. 9, 745±753. Balzi, E., Wang, M., Leterme, S., Van Dyck, L. and Goffeau, A. (1994) PDR5, a novel yeast multidrug resistance conferring transporter controlled by the transcription regulator PDR1. J. Biol. Chem. 269, 2206±2214. Beachy, R.N. and Murakishi, H.H. (1971) Local lesion formation in tobacco tissue culture. Phytopathology, 61, 877±878. Bent, A.F. (1996) Plant disease resistance genes: Function meets structure. Plant Cell, 8, 1757±1771. Boyes, D.C., McDowell, J.M. and Dangl, J.L. (1996) Plant pathology: Many roads lead to resistance. Current Biol. 6, 634±637. Bradley, D.J., Kjellbom, P. and Lamb, C.J. (1992) Elicitor-induced and wound-induced oxidative cross-linking of a proline-rich plant cell wall protein: a novel, rapid defense response. Cell, 70, 21±30. Canto, T. and Palukaitis, P. (1999) The hypersensitive response to ã Blackwell Science Ltd, The Plant Journal, (2001), 26, 339±349
347
cucumber mosaic virus in Chenopodium amaranticolor requires virus movement outside the initially infected cell. Virology, 265, 74±82. Chen, Z.X., Silva, H. and Klessig, D.F. (1993) Active oxygen species in the induction of plant systemic acquired resistance by salicylic acid. Science, 262, 1883±1886. CMI/A.A.B. (1984) Descriptions of Plant Viruses, July Commonwealth Mycological Institute and the Association of Applied Biologists. Unwin Brothers Ltd. Old Working Surrey. Conklin, P.L. and Last, R.L. (1995) Differential accumulation of antioxidant mRNAs in Arabidopsis thaliana exposed to ozone. Plant Physiol. 109, 203±212. Cooper, B., Lapidot, M., Heick, J.A., Dodds, J.A. and Beachy, R.N. (1995) A defective movement protein of TMV in transgenic plants confers resistance to multiple viruses whereas the functional analog increases susceptibility. Virology, 206, 307±313. Cooper, B., Schmitz, I., Rao, A.L.N., Beachy, R.N. and Dodds, J.A. (1996) Cell-to-cell transport of movement-defective cucumber mosaic and tobacco mosaic viruses in transgenic plants expressing heterologous movement protein genes. Virology, 216, 208±213. Czernic, P., Huang, H.C. and Marco, Y. (1996) Characterization of hsr201 and hsr515, two tobacco genes preferentially expressed during the hypersensitive reaction provoked by phytopathogenic bacteria. Plant Mol. Biol. 31, 255±265. Dangl, J.L. (1995) Piece de resistance: Novel classes of plant disease resistance genes. Cell, 80, 363±366. Dangl, J.L., Dietrich, R.A. and Richberg, M.H. (1996) Death don't have no mercy: Cell death programs in plant±microbe interactions. Plant Cell, 8, 1793±1807. DeLaat, A.M.M. and VanLoon, L.C. (1983) The relationship between stimulated ethylene production and symptom expression in virus-infected tobacco leaves. Physiol. Plant Pathology, 22, 261±273. De Oliveira, M.M., Sampaio, M.R., Noronha, A.B., Vicente, M. and Vianna, S. (1993) Detection of antiviral and antitumoral fractions of Chenopodium amaranticolor leaf extract. Microbios. 76, 213±221. Desikan, R., Hancock, J.T., Coffey, M.J. and Neill, S.J. (1996) Generation of active oxygen in elicited cells of Arabidopsis thaliana is mediated by a NADPH oxidase-like enzyme. FEBS Lett. 382, 213±217. Dixon, R.A. and Lamb, C.J. (1990) Molecular communication in interactions between plants and microbial pathogens. Annu. Rev. Plant Physiol. Plant Mol. Biol. 41, 339±367. Dixon, R.A., Harrison, M.J. and Lamb, C.J. (1994) Early events in the activation of plant defense responses. Annu. Rev. Phytopathol. 32, 479±501. Dunigan, D.D. and Madlener, J.C. (1995) Serine/threonine protein phosphatase is required for tobacco mosaic virus-mediated programmed cell death. Virology, 207, 460±466. Durrant, W.E., Rowland, O., Piedras, P., Hammond-Kosack, K.E. and Jones, J.D.G. (2000) cDNA-AFLP reveals a striking overlap in race-speci®c resistance and wound response gene expression pro®les. Plant Cell, 12, 963±977. Farmer, E.E. (1994) Fatty acid signaling in plants and their associated microorganisms. Plant Mol. Biol. 26, 1423±1437. Fritig, B., Kauffmann, B., Dumas, P., Geoffroy, M., Kopp, M. and Legrand, M. (1987) Mechanism of the hypersensitivity reaction of plants. Plant Resistance to Viruses. (Evered D. and Harnett S., eds). Chichester, UK. Wiley, pp. 92±108. Gross, G.G., Janse, C. and Elstner, E.F. (1977) Involvement of malate, monophenols, and the superoxide radical in hydrogen
348
Bret Cooper
peroxide formation by isolated cell walls from horseradish (Armoracia lapthifolia Gilib.). Planta, 136, 271±276. Gulyas, A. and Farkas, G.L. (1978) Is cell-to-cell contact necessary for the expression of the N-gene in Nicotiana tabacum cv. Xanthi nc plants infected by TMV? Phytopath. Z. 91, 182±187. Hammond-Kosack, K.E., Jones, D.A. and Jones, J.D.G. (1996) Ensnaring microbes: The components of plant disease resistance. New Phytologist, 133, 11±24. Hammond-Kosack, K.E. and Jones, J.D.G. (1996) Resistance genedependent plant defense responses. Plant Cell, 8, 1773±1791. Harmer, S.L., Hogenesch, M., Straume, M., Chang, H.-S., Han, B., Zhu, T., Wang, X., Kreps, J.A. and Kay, S.A. (2000) Orchestrated transcription of key pathways in Arabidopsis by the circadian clock. Science, 290, 2110±2113. Heinlein, M., Epel, B.L., Padgett, H.S. and Beachy, R.N. (1995) Interaction of tobamovirus movement proteins with the plant cytoskeleton. Science, 270, 1983±1985. Henikoff, S. and Henikoff, J.G. (1992) Amino acid substitution matrices from protein blocks. Proc. Natl Acad. Sci. USA, 89, 10915±10919. Holland, P.M., Abramson, R.D., Watson, R. and Gelfand, D.H. (1991) Detection of speci®c polymerase chain reaction product by utilizing the 5¢Ð3¢ exonuclease activity of Thermus aquaticus DNA polymerase. Proc. Natl Acad. Sci. USA, 88, 7276±7280. Horvath, D.M. and Chua, N.H. (1996) Identi®cation of an immediate-early salicylic acid-inducible tobacco gene and characterization of induction by other compounds. Plant Mol. Biol. 31, 1061±1072. Jones, A.M. and Dangl, J.L. (1996) Logjam at the Styx: Programmed cell death in plants. Trends Plant Science, 1, 114±119. Jones, J.D.G. (1996) Plant disease resistance genes: Structure, function, and evolution. Current Opinion Biotechnology, 7, 155±160. Komari, T. (1990) Transformation of cultured cells of Chenopodium quinoa by binary vectors that carry a fragment of DNA from the virulence region of pTiBo542. Plant Cell Reports, 9, 303±306. Lamb, C.J. (1994) Plant disease resistance genes in signal perception and transduction. Cell, 76, 419±422. Lamb, C.J., Lawton, M.A., Dron, M. and Dixon, R.A. (1989) Signals and transduction mechanisms for activation of plant defenses against microbial attack. Cell, 56, 215±224. Lange, J., Xie, Z.-P., Broughton, W.J., Voegeli-Lange, R. and Boller, T. (1999) A gene encoding a receptor-like protein kinase in the roots of common bean is differentially regulated in response to pathogens, symbionts and nodulation factors. Plant Sci. 142, 133±145. Lashbrook, C.C., Gonzalez-Bosch, C. and Bennett, A.B. (1994) Two divergent endo-beta-1,4-glucanase genes exhibit overlapping expression in ripening fruit and abscising ¯owers. Plant Cell, 6, 1485±1493. Lawton, K.A., Potter, S.L., Uknes, S. and Ryals, J. (1994) Acquired resistance signal transduction in Arabidopsis is ethylene independent. Plant Cell, 6, 581±588. Leister, D., Kurth, J., Laurie, D.A., Yano, M., Sasaki, T., Devos, K., Graner, A. and Schulze-Lefert, P. (1998) Rapid reorganization of resistance gene homologues in cereal genomes. Proc. Natl Acad. Sci. USA, 95, 370±375. Low, P.S. and Merida, J.R. (1996) The oxidative burst in plant defense: Function and signal transduction. Physiologia Plantarum, 96, 533±542.
Mehdy, M.C. (1994) Active oxygen species in plant defense against pathogens. Plant Physiol. 105, 467±472. Meyers, B.C., Dickerman, A.W., Michelmore, R.W., Sivaramakrishnan, S., Sobral, B.W. and Young, N.D. (1999) Plant disease resistance genes encode members of an ancient and diverse protein family within the nucleotide-binding superfamily. Plant J. 20, 317±332. Mittler, R. and Lam, E. (1995) Identi®cation, characterization, and puri®cation of a tobacco endonuclease activity induced upon hypersensitive response cell death. Plant Cell, 7, 1951±1962. Otsuki, Y., Shimomura, T. and Takebe, I. (1972) Tobacco mosaic virus multiplication and expression of the N gene in necrotic responding tobacco varieties. Virology, 50, 45±50. Padgett, H.S. and Beachy, R.N. (1993) Analysis of a tobacco mosaic virus strain capable of overcoming N gene-mediated resistance. Plant Cell, 5, 577±586. Pena-Cortes, H., Albrecht, T., Prat, S., Weiler, E.W. and Wilimitzer, L. (1993) Aspirin prevents wound-induced gene expression in tomato leaves by blocking jasmonic acid biosynthesis. Planta, 191, 123±128. Peng, M. and Kuc, J. (1992) Peroxidase-generated hydrogen peroxide as a source of antifungal activity in vitro and on tobacco leaf disks. Phytopathology, 82, 696±699. Pritchard, D.W. and Ross, A.F. (1975) The relationship of ethylene to formation of tobacco mosaic virus lesions in hypersensitive responding tobacco leaves with and without induced resistance. Virology, 64, 295±307. Rao, A.L.N. and Grantham, G.L. (1995) Biological signi®cance of the seven amino-terminal basic residues of brome mosaic virus coat protein. Virology, 211, 42±52. Rea, P.A., Li, Z.-S., Lu, Y.-P. and Drozdowicz, Y.M. (1998) From vacuolar GS-X pumps to multispeci®c ABC transporters. Annu. Rev. Plant Physiol. Plant Mol. Biol. 49, 727±760. Reuber, T.L. and Ausubel, F.M. (1996) Isolation of Arabidopsis genes that differentiate between resistance responses mediated by the RPS2 and RPM1 disease resistance genes. Plant Cell, 8, 241±249. Ritter, C. and Dangl, J.L. (1996) Interface between two speci®c pathogen recognition events mediated by distinct plant disease resistance genes. Plant Cell, 8, 351±257. Rommens, C.M.T., Salmeron, J.M., Oldroyd, G.E.D. and Staskawicz, B.J. (1995) Intergeneric transfer and functional expression of the tomato disease resistance gene Pto. Plant Cell, 7, 1537±1544. Ryals, J., Uknes, S. and Ward, E. (1994) Systemic acquired resistance. Plant Physiol. 104, 1109±1112. Sanchez-Fernandez, R., Ardiles-Diaz, W., Van Montagu, M., Inze, D. and May, M.J. (1998) Cloning and expression analyses of AtMRP4, a novel MRP-like gene from Arabidopsis thaliana. Mol. Gen. Genet. 258, 655±662. Savenkova, M.I., Mueller, D.M. and Heinecke, J.A. (1994) Tyrosyl radical generated by myeloperoxidase is a physiological catalyst for the initiation of lipid peroxidation in low density lipoprotein. J. Biol. Chem. 269, 20394±20400. Schmitz, I. and Rao, A.L. (1996) Molecular studies on bromo virus capsid protein I. Characterization of cell-to-cell movementdefective RNA3 variants of Beome mosaic virus. Virology, 226, 281±293. Smart, C.C. and Fleming, A.J. (1996) Hormonal and environmental regulation of a plant PDR5-like ABC transporter. J. Biol. Chem. 271, 19351±19357. Smith, C.J. (1996) Accumulation of phytoalexins: Defense mechanism and stimulus response system. New Phytol. 132, 1±45. ã Blackwell Science Ltd, The Plant Journal, (2001), 26, 339±349
Hypersensitive virus resistance in Chenopodium Song, W.Y., Wang, G.L., Chen, L.L et al. (1995) A receptor kinaselike protein encoded by the rice disease resistance gene Xa21. Science, 270, 1804±1806. Staskawicz, B.J., Ausubel, F.M., Baker, B.J., Ellis, J.G. and Jones, J.D.G. (1995) Molecular genetics of plant disease resistance. Science, 268, 661±667. Verduin, B.J.M. (1978) Reversible change in the nucleoprotein composition of bromoviruses after multiplication in. Chenopodium Hybridum. J. Gen. Virol. 38, 571±575. Visedo, G., Fernandez-Piqueras, J. and Garcia, J.A. (1990) Isozyme pro®les associated with the hypersensitive response of Chenopodium foetidum to plum pox virus infection. Physiologia Plantarum, 78, 218±224. Weststeijn, E.A. (1978) Permeability changes in the hypersensitive reaction of Nicotiana tabacum cv. Xanthi nc after infection with tobacco mosaic virus. Physiol. Plant Pathology, 13, 253±258. Whitham, S., Dinesh-Kumar, S.P., Choi, D., Hehl, R., Corr, C. and Baker, B. (1994) The product of the tobacco mosaic virus
349
resistance gene N: Similarity to Toll and the Interleukin-1 receptor. Cell, 78, 1101±1115. Whitham, S., McCormick, S. and Baker, B. (1996) The N gene of tobacco confers resistance to tobacco mosaic virus in transgenic tomato. Proceedings Natl Acad. Sci. USA 93, 8776±8781. Yang, Q., Grimmig, B. and Matern, U. (1998) Anthranilate Nhydroxycinnamoyl/benzoyltransferase gene from carnation: rapid elicitation of transcription and promoter analysis. Plant Mol. Biol. 38, 1201±1214. Yoshimura, S., Yamanouchi, U., Katayose, Y., Toki, S., Wang, Z.X., Kono, I., Kurata, N., Yano, M., Iwata, N. and Sasaki, T. (1998) Expression of Xa1, a bacterial blight-resistance gene in rice, is induced by bacterial inoculation. Proc. Natl Aca. Sci. USA, 95, 1553±1558. Zhou, J.M., Tang, X.Y. and Martin, G.B. (1997) The Pto kinase conferring resistance to tomato bacterial speck disease interacts with proteins that bind a cis-element of pathogenesis-related genes. EMBO J. 16, 3207±3218.
Accession numbers AF078082, AJ242807, Z70524, NP014933, T00502, T3747, AAF82158, X96784, U96399, AAF18518, X95343, AF013613, AC013430, X92353.
ã Blackwell Science Ltd, The Plant Journal, (2001), 26, 339±349
