Colored medaka and zebrafish: Transgenics ... - Wiley Online Library

The Japanese Society of Developmental Biologists

Develop. Growth Differ. (2012) 54, 818–828

doi: 10.1111/dgd.12013

Original Article

Colored medaka and zebrafish: Transgenics with ubiquitous and strong transgene expression driven by the medaka b-actin promoter Nozomi Yoshinari, 1 Kazunori Ando, 1 Akira Kudo, 1 Masato Kinoshita 2 and Atsushi Kawakami 1 * 1

Department of Biological Information, Tokyo Institute of Technology, 4259 Nagatsuta, Midori-ku, Yokohama, 226-8501, and 2Division of Applied Biosciences, Graduate School of Agriculture, Kyoto University, Sakyo-ku, Kyoto, 606-8502, Japan

Conditional cell labeling, cell tracing, and genetic manipulation approaches are becoming increasingly important in developmental and regenerative biology. Such approaches in zebrafish research are hampered by the lack of an ubiquitous transgene driver element that is active at all developmental stages. Here, we report the isolation and characterization of the medaka fish (Oryzias latipes) b-actin (Olactb) promoter, which drives constitutive transgene expression during all developmental stages, and the analysis of adult organs except blood cell types. Taking advantage of the compact medaka promoter, we succeeded in generating a zebrafish transgenic (Tg) line with unprecedentedly strong and widespread transgene expression from embryonic to adult stages. Moreover, the Tg carries a pair of loxP sites, which enables the reporter fluorophore to switch from DsRed2 to enhanced green fluorescent protein (EGFP). We induced Cre/loxP recombination with Tg(hsp70l: mCherry-t2aCreERt2) in the double Tg embryo and generated a Tg line that constitutively expresses EGFP. We further demonstrate the powerful application of Olactb-driven Tgs for cell lineage tracing using transplantation experiments with embryonic cells at the shield stage and adult cells of regenerating fin. Thus, the use of promoter elements from medaka is an alternative approach to generate Tgs with stronger and even novel expression patterns in zebrafish. The Olactb promoter and the Tg lines presented here represent an important advancement for the broader use of Cre/loxP-based Tg applications in zebrafish. Key words: b-actin, Cre/loxP, medaka fish, transgenic, zebrafish.

Introduction Conditional gene manipulation using Cre/loxP recombination is one of the important tools in molecular genetics. In particular, a transgene driver element that ubiquitously and strongly expresses the transgene in many cell types and stages is necessary for cell lineage tracing analysis or conditional gain-of-function and/or loss-of-function experiments. In mouse, conditional approaches using Cre/loxP recombination have been greatly accelerated by the discovery of the

*Author to whom all correspondence should be addressed. Email: [email protected] Received 2 September 2012; revised 28 September 2012; accepted 30 September 2012. ª 2012 The Authors Development, Growth & Differentiation ª 2012 Japanese Society of Developmental Biologists

Rosa26 locus (Friedrich & Soriano 1991; Zambrowicz et al. 1997; Soriano 1999). Zebrafish (Danio rerio) has become an alternative and useful vertebrate model system that has the advantages of quick and inexpensive genetic manipulations and beautiful imaging analyses; however, the lack of an ubiquitous transgene driver applicable at both developmental and postdevelopmental stages has been a drawback. So far, a number of ubiquitous promoter elements have been tested in zebrafish, and several promoters such as the h2afx, the TATA box-binding protein (tbp), versions of the actb promoters (Higashijima et al. 1997; Gillette-Ferguson et al. 2003; Kwan et al. 2007; Burket et al. 2008), and the Xenopus laevis elongation factor 1a promoter (Xlef1a1) (Johnson & Krieg 1994; Kawakami et al. 2004) have been used to generate transgenic (Tg) lines. However, these promoters are progressively inactivated in some neuronal, blood, and/ or other cell types during development. For example,

Medaka and zebrafish b-actin transgenics

819

although Xlef1a1 is strongly expressed during early development, the expression is restricted to specific cell types (Hans et al. 2009; Collins et al. 2010). actb promoter fragments retain expression in adult tissues, yet show no or weak activity in blood cell types, fins, or several other cell types (Traver et al. 2003; Burket et al. 2008). This likely reflects specialization of differentiating cells, differences in cell-type-specific requirements for molecules controlling translation or chromatin maintenance, and/or the inactivation of foreign DNA sequences in the genome. Recently, two relatively successful examples of ubiquitous transgene expression in zebrafish have been reported. In one case, the long 9.8-kb promoter of actb2 was used to generate a Tg line that expressed the transgene in the adult heart and fin (Bertrand et al. 2010; Kikuchi et al. 2010; Liu et al. 2010; Singh et al. 2012). In another case, a 3.5-kb element of the ubiquitin promoter was successfully used to drive ubiquitous transgene expression not only in embryonic tissues, but also in adult tissues, including blood cell types (Mosimann et al. 2011). Here, we report on another ubiquitous promoter element that possibly drives the strongest reporter transgene expression in zebrafish. We demonstrate that a short 2.5-kb promoter element of the medaka actb gene drives strong transgene expression in medaka fish, and surprisingly this short element also drives ubiquitous and strong transgene expression in embryonic and adult zebrafish tissues. Given that the construct was designed to switch the transgene from dsRed2 (dsR2) to enhanced green fluorescent protein (EGFP) using Cre/loxP recombination, the Tg is useful for genetically labeling specific cell groups and tracking their long-term fates. We actually show that the strong and persistent expression of the transgene is useful for tracing cell lineage at single-cell resolution. Thus, promoter elements derived from foreign species are alternative and efficient tools to generate Tg animals in zebrafish with higher gene expression or novel expression patterns that unify duplicated gene expressions.

gene between the SalI and NotI sites was replaced with the EGFP gene that was amplified by PCR from pEGFP-1 (Clontech). In the resultant plasmid, the loxPDsRed2-polyA signal (pA)-loxP cassette, which was PCR-amplified from the modified pDsRed2-1 using the primers loxP-DsR2-FW1 (5′-CAGTGTCGACATAACTT CGTATAGCATACATTATACGAAGTTATACTAGTGATAT CCATGGCCTCCTCCGAGAACGT-3′) and loxP-GFPRV2 (5′-GACTCCGCGGATAACTTCGTATAATGTATGC TATACGAAGTTATCGATATCATATGTTAATTAACGCTT ACAATTTACGCCT-3′), was inserted between the SalI and SacII sites. The NotI site of the template pDsRed2-1 was disrupted by blunt-end ligation.

Materials and methods

Transgenesis

Plasmid constructs p067Olactb:loxP-dsR2-loxP-EGFP. The 2.5-kb promoter region, the first untranslated (UTR) exon, the 1.5-kb first intron, and the sequence of the second intron before the initiation codon of the medaka fish actb (Olactb) gene was polymerase chain reaction (PCR)-amplified from the Oryzias latipes genome using KOD polymerase and cloned between the EcoRI and SalI sites of pDsRed2-1 (Clontech). Then, the DsRed2

pT2Olactb:loxP-dsR2-loxP-EGFP. The Xlef1a1 promoter region and the EGFP coding region were removed from pT2KXIGDin (Kawakami 2005) by partial digestion with EcoRI and NotI and replaced with Olactb:loxP-dsR2-loxP-EGFP from p067Olactb:loxPdsR2-loxP-EGFP. A 370-bp sequence of Xlef1a1 remained upstream of the Olactb promoter, but it did not affect actb promoter activity, because we did not observe any difference in expression when the construct lacking the Xlelf1a promoter region was injected (unpubl. obs., 2011). pT2hsp70l:mCherry-t2a-CreERt2. A similar construct with hsp70l promoter and its Tg have been previously reported (Hans et al. 2009, 2011); however, we were unable to detect mCherry expression in adult fish after heat shock. To improve transgene expression, particularly in adult tissues, we used a modified construct and generated a Tg line. The hsp70l promoter was PCR-amplified from a vector in the tol2 kit (Kwan et al. 2007) and replaced with the promoter region of pT2pax2:mCherry-t2a-CreERt2 (Hans et al. 2009 at the SfiI and FseI sites. The resultant plasmid contains the 5′UTR sequence derived from the pax2 construct. The PCR reaction was carried out using KOD plus polymerase, according to the manufacturer’s instructions (Toyobo).

Fish were maintained in accordance with Animal Research Guidelines at Kyoto University and Tokyo Institute of Technology. Fish were maintained in an aquarium with recirculating water a 14 h/day and 10 h/night cycle at 28.5°C. The medaka Tg was generated according to the method described by Kinoshita et al. (2000). Briefly, a circular form of plasmid (25 lg/mL) was injected into the cytoplasm of fertilized eggs of the d-rR medaka strain before the first cleavage.

ª 2012 The Authors Development, Growth & Differentiation ª 2012 Japanese Society of Developmental Biologists

820

N. Yoshinari et al.

Zebrafish Tgs were generated using tol2-mediated transgenesis (Kikuta & Kawakami 2009). Briefly, each transgenesis vector (25 lg/mL) was combined with 25 lg/mL tol2 mRNA and injected into one-cell-stage eggs derived from TL wild-type crosses, and the injected animals were grown to adulthood. Individual F0 founders were either outcrossed to TL or incrossed to other F0 founders, and their F1 progeny were screened for DsR2, EGFP, or mCherry fluorescence. Tg(hsp70l:mCherry-t2a-CreERt2) was identified by heat shock at 37°C for 1 h at 24 h post-fertilization (hpf) and screened for mCherry fluorescence at 48 hpf. Positive individual F1 adults were subsequently outcrossed to wild-type zebrafish until 50% transgene transmission, indicating single transgene insertions, was observed. Tgs were examined in each generation for uniform and strong transgene expression. Histology Transgene expression in adult tissues was assessed in transverse sections. A young adult Tg fish, approximately 2 months old, was euthanized with ice and immediately fixed with 4% paraformaldehyde (PFA) in phosphate-buffered saline (PBS) overnight at 4°C. The fixed fish was equilibrated with 20% sucrose in PBS, embedded in Tissue-Tek compound (Miles), and sectioned at 20 lm using a cryostat. Cut sections were picked up on glass slides and washed two to three times with PBS followed by PBS supplemented with 0.1% Tween 20 (PBST). Sections were stained with polyclonal anti-DsRed antibody (Invitrogen) and Alexa568-labelled anti-rabbit antibody and further counterstained with the SYTO Green 11 Nucleic Acid Stain (5 mmol/L in PBST; Invitrogen) for 10 min at room temperature and mounted with 80% glycerol containing 2.5% 1,4-diazabicyclo [2,2,2] octan (DABCO, Nacalai Tesque) as an anti-fading reagent. Pictures were taken using a confocal microscope. Blood cell analysis Adult fish blood cells were collected from the tail fin vessels by amputating the fin on a piece of parafilm. Blood cells were mixed with a drop of PBS and mounted on a slide glass. A cover slip was placed on the sample using pieces of vinyl tape as a spacer. Cre/loxP recombination Respective female Tg(hsp70l:mCherry-t2a-CreERt2) and male Tg(Olactb:loxP-dsR2-loxP-EGFP) were mated to obtain embryos that carried both transgenes. Fertilized eggs with DsRed fluorescence at 24 hpf were selected

and heat-shocked at 37°C for 1 h. The embryos were returned to 28.5°C and incubated overnight in medium containing 5 lmol/L tamoxifen (TAM; Sigma-Aldrich). Approximately 50% of embryos became EGFP-positive. These embryos were raised to adulthood and mated with wild-type fish to obtain embryos that constitutively expressed EGFP. Transplantation experiments Cell transplantation at early embryonic stage was performed according to standard procedures. Briefly, female Tg(Olactb:loxP-dsR2-loxP-EGFP) were crossed with male wild-type fish. All fertilized eggs had maternal contribution of DsR2 and were used as donors. The donors and the wild-type host embryos were dechorionated at 30% epiboly stage and further incubated in embryo medium supplemented with 100 units of penicillin and 0.01% streptomycin until they attained the appropriate stage for transplantation. Donor and host embryos were placed in small wells on a 2% agarose platform that accommodated one embryo per well. Transplantation was performed between 40% epiboly and shield stages using glass needles with tip diameters of 30–50 lm. For adult blastema transplantation, the fins of adult Tg(Olactb:loxP-dsR2-loxP-EGFP) and wild-type fish were amputated in the middle and fin regeneration was induced. At 2 days post-amputation (dpa), the regenerating tissue of the donor was collected by recutting the fin at a slightly proximal site. The blastema and wound epidermis were manually separated with 30-guage needles in Hank’s buffer and further cut into small pieces. The donor tissue was transplanted into the blastema region of the host using a transplantation needle with a wide tip. For transplanting the wound epidermis, the donor epidermis was cut into small pieces, approximately 1/10 of the blastema size, and inserted into the blastema or the space between the epidermis and blastema. The donor blastema was also cut into small pieces and inserted into the host blastema region.

Results Medaka b-actin promoter transgenic actb is one of the genes that exhibits strong and ubiquitous expression in many cell types and stages. Taking advantage of its ubiquitous and strong expression, we used the 2.5-kb promoter region along with the first UTR exon, 1.5-kb first intron, and a short sequence before the initiation codon in the second exon (Fig. 1A) to generate the medaka Tg. The Tg



(A)

821

(B)

(D)

(C)

Fig. 1. The medaka (Oryzias latipes) and zebrafish (Danio rerio) transgenic (Tg) lines with widespread expression of dsRed2 (dsR2) driven by the medaka fish actb promoter (Olactb). (A) Schematic of the plasmid DNA construct used to generate the Tgs. The construct contains a 2.5-kb upstream region, 1.1-kb first intron, and a 7-bp sequence of the second exon before the actb initiation codon. The dsR2 cassette is flanked by 2 loxP sites and followed by the enhanced green fluorescent protein (EGFP) cassette. (B) Bright field (upper) and fluorescent (lower) images of medaka Tg(Olactb:loxP-dsR2-loxP-EGFP) with strong and widespread expression of DsR2. The strong DsR2 expression is clearly seen under daylight. (C) Bright field (upper) and fluorescent (lower) images of zebrafish Tg(Olactb:loxP-dsR2loxP-EGFP) carrying a single copy of the transgene. The stable Tg line displays red-orange color due to strong DsR2 expression. Lines and numbers indicate the approximate locations of the cross-sections shown in Figure 2A. (D) Zebrafish Tg carrying homozygous transgene copies.

displayed strong dsR2 expression such that the fish had a visible red body color under daylight (Fig. 1B). Furthermore, transgene expression was observed in a variety of adult tissues, such as the brain, spleen, kidney, gill, gut, ovary, and testis (data not shown). Compared to the long (9.8 kb) promoter element of the zebrafish actb2 required for stable adult tissue expression, a 2.5-kb region of the medaka b-actin was sufficient to drive an even stronger expression of the transgene in embryonic and adult tissues. Generation of a zebrafish transgenic using the medaka b-actin promoter Zebrafish has 2 actb genes, actb1 and actb2. The promoters of both genes have been used to generate Tg lines (Gillette-Ferguson et al. 2003; Burket et al. 2008; Bertrand et al. 2010; Liu et al. 2010). In our hands, zebrafish actb1 or actb2 promoters 20; Fig. 4D). During the course of regeneration, even a single cell was clearly traceable, demonstrating that the cells derived from Tg(Olactb:loxP-dsR2-loxP-EGFP) were also traceable at single-cell resolution in adult tissues. Thus, the zebrafish Olactb-driven Tg can be seamlessly used as a useful cell lineage tracer throughout the life cycle.

Discussion Conditional gene manipulation using Cre/loxP recombination is one of the important tools for molecular genetic analysis in model organisms. The number of potent zebrafish tools to manipulate genetic events and trace cell lineages through development has steadily increased in recent years; however, the lack of an ubiquitous transgene driver has been a common obstacle (Hans et al. 2009; Blackburn & Langenau 2010; Collins et al. 2010). Although the actb gene promoter has been one of the strong candidates, it has been difficult to generate a Tg line that uniformly and stably expresses the transgene (Gillette-Ferguson et al. 2003; Burket et al. 2008; Bertrand et al. 2010; Liu et al. 2010). Here, we found that the short 2.5-kb medaka actb promoter strongly drives transgene expression in every life stage from one cell to adulthood and in most cell types in the medaka Tg, and further used it to generate a zebrafish Tg that ubiquitously expresses the transgene in all stages and tissues, except the blood cell lineage. Intriguingly, the transgene was expressed in endothelial cells (Fig. 2C), despite their closely related cell lineage with hematopoietic cell types. Although we cannot exclude the potential existence of other cell types that lack transgene expression, our Tg line using the medaka actb

promoter is a breakthrough in the limitation of Cre/loxP technology in zebrafish genetics. Because the size of the medaka genome is approximately half of that of zebrafish (Kasahara et al. 2007), it is reasonable to assume that the promoter/enhancer elements are located within a compact region. Indeed, compared to the long zebrafish actb2 promoter (9.8 kb) required to sustain adult tissue expression, 2.5 kb of the Olactb promoter was sufficient to drive a stronger expression of the transgene in embryonic and adult tissues. Recently, almost the same promoter region was successfully used to generate a uniform Tg in a related medaka species, Oryzias dancena (Cho et al. 2011). In addition, medaka has a single actb gene, whereas zebrafish has two actb genes, which may have redundant functions and expression. Therefore, the zebrafish actb genes may have a weaker transcriptional activity than that of medaka fish. Still, the zebrafish Tg(Olactb:loxP-dsR2-loxP-EGFP) displayed a weaker red color in comparison to the bright red body color of the medaka Tg (Fig. 1). This may be due to the multiple copy number of the transgene integrated into a locus in the medaka Tg rather than the promoter activity itself, because the medaka Tg was generated by a simple plasmid injection, which leads to the integration of multiple copies of the transgene into a locus. By contrast, the zebrafish Tg was generated via tol2-based transgenesis, which introduces a single transgene insertion per locus. Thus, the overall intensity of Olactb-driven transgene expression appears to depend on the number of transgene copies. The observation that adult zebrafish Tgs carrying homozygous transgenes displayed a brighter red color supports this notion (Fig. 1D). Given the single copy of the transgene in the zebrafish Tg, its orange-red body color is surprising; therefore, we speculate that the transcription efficiency per transgene copy may be comparable to that of medaka. Thus, our established Tg displayed an unprecedentedly strong and widespread transgene expression in zebrafish. Moreover, the insertion of a single transgene copy in zebrafish is an advantage when using Cre/loxP recombination, because it enables complete color switch from red to green in every cell. To further demonstrate the actual application of the zebrafish Olactb-driven Tg as a cell tracing reagent, we performed a series of transplantation experiments in early embryonic stage and adult regenerating fin. We successfully demonstrated that the established Tg is a useful tool for tracking cell lineage throughout the life cycle. Taking advantage of the established Tg, we were able to observe an intriguing cell behavior of transplanted blastema cells during adult fin



regeneration. As shown in Figure 4D, the donor blastema cells proliferated to distribute into a wide region of the regenerated tissue (n > 20). However, in some cases, the donor cells stably incorporated into the host tissue, but did not proliferate (data not shown). Between the proliferated and un-proliferated cases, it seemed likely that the host blastema region that received the transplantation was decisive for activating/maintaining cell proliferation. Irrespective of the place of origin of donor blastema cells, transplantation in the distal region of the host blastema induced explosive cell proliferation, suggesting the presence of a localized signal for regenerative cell proliferation. Another intriguing outcome of our adult cell transplantation was that the transplanted endothelial cells only contributed to the regeneration of blood vessels, and did not differentiate into other cell types (Fig. 2C), indicating the fate restriction of endothelial cells during fin regeneration. In summary, the widespread and, particularly, strong expression of the transgene driven by the medaka actb promoter can be seamlessly used as a useful cell lineage tracer throughout the life cycle. In addition, due to the small size of the Olactb promoter element, it is easily applicable in other constructs for conditional loss-of-function or gain-of-function analyses. Thus, foreign promoter elements derived from the compact medaka genome are alternative and efficient tools to generate Tg animals in zebrafish with higher gene expression or new expression patterns that unify multiple gene expressions. The medaka actb promoter now provides an alternative choice for constructing elaborate recombinase-dependent or drug-inducible transgene systems for all developmental stages in zebrafish.

Acknowledgments This work was supported by research grants from the Ministry of Education, Sports, Science and Technology of Japan, KAKENHI (Grant-in-Aid for Scientific Research). We thank K. M. Kwan and C. B. Chien for providing the Tol2 kit, and S. Hans and M. Brand for generously providing the CreERt2constructs and Tg (hsp70l:mCherry-t2a-CreERt2).

References Blackburn, J. S. & Langenau, D. M. 2010. aMAZe-ing tools for mosaic analysis in zebrafish. Nat. Methods 7, 188–190. Bertrand, J. Y., Chi, N. C., Santoso, B., Teng, S., Stainier, D. Y. & Traver, D. 2010. Haematopoietic stem cells derive directly from aortic endothelium during development. Nature 464, 108–111. Burket, C. T., Montgomery, J. E., Thummel, R., Kassen, S. C., LaFave, M. C., Langenau, D. M., Zon, L. I. & Hyde, D. R.

827

2008. Generation and characterization of transgenic zebrafish lines using different ubiquitous promoters. Transgenic Res. 17, 265–279. Cho, Y. S., Lee, S. Y., Kim, Y. K., Kim, D. S. & Nam, Y. K. 2011. Functional ability of cytoskeletal b-actin regulator to drive constitutive and ubiquitous expression of a fluorescent reporter throughout the life cycle of transgenic marine medaka Oryzias dancena. Transgenic Res. 20, 1333–1355. Collins, R. T., Linker, C. & Lewis, J. 2010. MAZe: a tool for mosaic analysis of gene function in zebrafish. Nat. Methods 7, 219–223. Feil, R., Brocard, J., Mascrez, B., LeMeur, M., Metzger, D. & Chambon, P. 1996. Ligand-activated site-specific recombination in mice. Proc. Natl. Acad. Sci. USA 93, 10887– 10890. Feil, R., Wagner, J., Metzger, D. & Chambon, P. 1997. Regulation of Cre recombinase activity by mutated estrogen receptor ligand-binding domains. Biochem. Biophys. Res. Commun. 237, 752–757. Friedrich, G. & Soriano, P. 1991. Promoter traps in embryonic stem cells: a genetic screen to identify and mutate developmental genes in mice. Genes Dev. 5, 1513–1523. Gillette-Ferguson, I., Ferguson, D. G., Poss, K. D. & Moorman, S. J. 2003. Changes in gravitational force induce alterations in gene expression that can be monitored in the live, developing zebrafish heart. Adv. Space Res. 32, 1641–1646. Hans, S., Freudenreich, D., Geffarth, M., Kaslin, J., Machate, A. & Brand, M. 2011. Generation of a non-leaky heat shockinducible Cre line for conditional Cre/lox strategies in zebrafish. Dev. Dyn. 40, 108–115. Hans, S., Kaslin, J., Freudenreich, D. & Brand, M. 2009. Temporally controlled site-specific recombination in zebrafish. PLoS ONE 4, e4640. Higashijima, S., Okamoto, H., Ueno, N., Hotta, Y. & Eguchi, G. 1997. High-frequency generation of transgenic zebrafish which reliably express GFP in whole muscles or the whole body by using promoters of zebrafish origin. Dev. Biol. 192, 289–299. Johnson, A. D. & Krieg, P. A. 1994. pXeX, a vector for efficient expression of cloned sequences in Xenopus embryos. Gene 147, 223–226. Kasahara, M., Naruse, K., Sasaki, S., Nakatani, Y., Qu, W., Ahsan, B., Yamada, T., Nagayasu, Y., Doi, K., Kasai, Y., Jindo, T., Kobayashi, D., Shimada, A., Toyoda, A., Kuroki, Y., Fujiyama, A., Sasaki, T., Shimizu, A., Asakawa, S., Shimizu, N., Hashimoto, S., Yang, J., Lee, Y., Matsushima, K., Sugano, S., Sakaizumi, M., Narita, T., Ohishi, K., Haga, S., Ohta, F., Nomoto, H., Nogata, K., Morishita, T., Endo, T., Shin-I, T., Takeda, H., Morishita, S. & Kohara, Y. 2007. The medaka draft genome and insights into vertebrate genome evolution. Nature 44, 714–719. Kawakami, K. 2005. Transposon tools and methods in zebrafish. Dev. Dyn. 234, 244–254. Kawakami, K. 2007. Tol2: a versatile gene transfer vector in vertebrates. Genome Biol. 8, S7. Kawakami, K., Takeda, H., Kawakami, N., Kobayashi, M., Matsuda, N. & Mishina, M. 2004. A transposon-mediated gene trap approach identifies developmentally regulated genes in zebrafish. Dev. Cell 7, 133–144. Kikuchi, K., Holdway, J. E., Werdich, A. A., Anderson, R. M., Fang, Y., Egnaczyk, G. F., Evans, T., Macrae, C. A., Stainier, D. Y. & Poss, K. D. 2010. Primary contribution to zebrafish heart regeneration by gata4(+) cardiomyocytes. Nature 464, 601–605.


828

N. Yoshinari et al.

Kikuta, H. & Kawakami, K. 2009. Transient and stable transgenesis using tol2 transposon vectors. Methods Mol. Biol. 546, 69–84. Kinoshita, M., Kani, S., Ozato, K. & Wakamatsu, Y. 2000. Activity of the medaka translation elongation factor 1alpha-A promoter examined using the GFP gene as a reporter. Dev. Growth Differ. 42, 469–478. Kwan, K. M., Fujimoto, E., Grabher, C., Mangum, B. D., Hardy, M. E., Campbell, D. S., Parant, J. M., Yost, H. J., Kanki, J. P. & Chien, C. B. 2007. The Tol2kit: a multisite gatewaybased construction kit for Tol2transposon transgenesis constructs. Dev. Dyn. 236, 3088–3099. Liu, J., Bressan, M., Hassel, D., Huisken, J., Staudt, D., Kikuchi, K., Poss, K. D., Mikawa, T. & Stainier, D. Y. 2010. A dual role for ErbB2 signaling in cardiac trabeculation. Development 137, 3867–3875. Mosimann, C., Kaufman, C. K., Li, P., Pugach, E. K., Tamplin, O. J. & Zon, L. I. 2011. Ubiquitous transgene expression and Cre-based recombination driven by the ubiquitin promoter in zebrafish. Development 138, 169–177.

Provost, E., Rhee, J. & Leach, S. D. 2007. Viral 2A peptides allow expression of multiple proteins from a single ORF in transgenic zebrafish embryos. Genesis 45, 625–629. Soriano, P. 1999. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat. Genet. 21, 70–71. Singh, S. P., Holdway, J. E. & Poss, K. D. 2012. Regeneration of amputated zebrafish fin rays from de novo osteoblasts. Dev. Cell 22, 879–886. Traver, D., Paw, B. H., Poss, K. D., Penberthy, W. T., Lin, S. & Zon, L. I. 2003. Transplantation and in vivo imaging of multilineage engraftment in zebrafish bloodless mutants. Nat. Immunol. 4, 1238–1246. Yoshikawa, S., Kawakami, K. & Zhao, X. C. 2008. G2R Cre reporter transgenic zebrafish. Dev. Dyn. 237, 2460–2465. Zambrowicz, B. P., Imamoto, A., Fiering, S., Herzenberg, L. A., Kerr, W. G. & Soriano, P. 1997. Disruption of overlapping transcripts in the ROSA beta geo 26 gene trap strain leads to widespread expression of beta-galactosidase in mouse embryos and hematopoietic cells. Proc. Natl Acad. Sci. USA 94, 3789–3794.
