CLIN. CHEM. 39/11, 2282-2287 (1993)
Colorimetric Solid-Phase Minisequencing Assay Illustrated by Detection of a1 -AntitrypsinZ Mutation Leena Harju,’ Teddy Weber,2 Ludmila Alexandrova,3
Mark Luldn,3 Marjut Ranki,’
In solid-phase minisequencing,a defined point mutation is detected in microtiter plate-immobilized DNA by a single nucleotide primer extension reaction. We have here developed the method into a colorimetricassay and applied it to the detection of the Z mutation of the a1-antitrypsin
and Anu Jalanko1’4
tion site can be created by PCR-mediated
mutagenesis
(9).
‘Orion Corp., Orion Pharmaceutica, Biotechnology, Valimotie 7, SF-00380 Helsinki, Finland. 2Ara Hospital, Clinical Laboratory, NordensbjOldinkatu 20,
Allele-specific amplification, oligonucleotide ligation, and allele-specific oligonucleotide hybridization assays are all based on the capability of hybridization to distinguish one base pair (1 bp) mismatch. The method we developed for detection of point mutations is based on the specificity of primer extension reaction (10) and has been formatted into a microtiter plate-based diagnostic test (11). In this solid-phase minisequencing method, the point mutation is detected in a microtiter plateimmobilized amplified target by a primer extension reaction, in which one labeled nucleotide is enzymatically incorporated at the site of mutation. For each analyzed sample two minisequencing reactions are performed, one for the normal allele and one for the mutated allele. Unlike the other methods mentioned above, the minisequencing reaction yields quantifiable results. We describe here a colorimetric minisequencing method for the detection of the Z mutation of the a1antitrypsin (A1AT) gene. In the test we make use of novel hapten-labeled nucleoside triphosphates, which permits immunoenzymatic detection on microtiter plates. Deficiency of A]AT is one of the most common hereditary disorders in Caucasians. Most cases involve two mutations, Z and S. The frequency of the Z-allele is 1-2%, that of the S-allele is 2-4% (12). The Z mutation of the ALAT gene is a G9989 to A tranaversion, which results in Glu 342 to Lys 342 substitution (13). Homozygosity for the Z mutation leads to pulmonary emphysema, and - 10% of the ZZ homozygous individuals develop chronic liver disease. Diagnosis of A1AT deficiency is based on the measurement of AIAT in plasma, an analysis that is readily available in most hospital laboratories. Suspected cases are then phenotyped by isoelectric focusing, which requires technical skills and is available only in a few laboratories. Genotyping of A1AT-deficient patients has been described in several publications, but the techniques have been neither simple nor standardized (14, 15). The novel technique for genotyping the Z mutation as described here is nonradioactive, rapid, and simple and is suitable for use in a clinical chemistry laboratory.
SF-00250 Helsinki, Finland. ‘Russian Academy of Sciences, Institute of Molecular Biology, Vavilov St. 32, 117984 Moscow B-334, Russia. for correspondence. Present address: National Public Health Institute, Department of Human Molecular Genetics, Mannerheimintie 166, 00300 Helsinki, Finland. Fax 358-0-4744408, E-mail INTERNET
[email protected]. ‘Nonstandard abbreviations: DNP, dinitrophenyl; PCR, polymerase chain reaction; and A1AT, a,-antitrypein. Received May 4, 1993; accepted June 30, 1993.
Materials and Methods Preparation of DNA samples. Blood samples were obtained from the Laakso and Aurora Hospitals, Helsinki. DNA was extracted from 0.5 mL of EDTA blood accordingto Walsh et al. (16). We used 10 L of the 200 tL of extracted DNA for amplification. Oligonucleotides and nucleotides. The amplification
gene. We used novel nucleoside triphosphates modified
with dinitrophenyl(DNP) hapten,permittingdetectionby anti-DNP-alkaline phosphatase conjugate, with p-nitrophenyl phosphate as substrate. The Z mutation is detected in two reactions: DNP-labeled dCTP is incorporated when the template is normal, DNP-dUTP when the Z mutation is present. Both modified nucleotides were incorporated with high specificity and with an efficiency similar to that of unmodified nucleotides. The test results are measured by spectrophotometry, yielding quantitative absorbance values. Calculation of the ratio of C to U signal permitted unambiguous distinction of normal homozygous, ZZ homozygous, and ZM heterozygous genotypes. The colorimetnc minisequencing assay is rapid, standardized, and automatable, and thus provides an accurate and simple alternative for the analysis of known point mutations. Indexing Terms: heritable disorders
polymerase chain reaction
. biotin-avidin interaction . point mutations immunoenzy-
mometric assay
The majority of polymorphisms in the human genome are caused by point mutations, for which simple diagnostic methods would be desirable. For accuracy of diagnosis, the target sequences must be amplified before detection. The polymerase chain reaction (PCR) (1) is the most widely used amplification method; other methods include the nucleic acid sequence-based anipilfication (2, 3) and the ligase chain reaction (4)#{149}5 Known point mutations can be detected with allelespecific PCR (5, 6), allele-specific oligonucleotide hybridization (7), and oligonucleotide ligation assay (8). For some point mutations, restriction enzyme digestion can be used, e.g., when the mutation destroys or creates a restriction enzyme cleavage site or if a suitable mut.a-
2282 CLINICAL CHEMISTRY, Vol. 39, No. 11, 1993
primers (BlO Zi and Z2), the detection step primer (ZD), and the control oligonucleotides (BIO-CM and BIO-C) were synthesized with an Applied Biosystems (Foster City, CA) 381A Synthesizer (17) (Table 1). The primer BlO Zi and the minisequencing controls BIO-CM and BIOC were biotinylated at their 5’ ends (18). The amplification control was a 91-nucleotide-long oligonucleotide constructed to contain the amplification primerbinding sequences, the detection primer-binding sequence, and the Z mutation. dCTP and dUTP were modified in their 5-position with a linker arm to which a DNP-group was added (details to be published elsewhere). DNA amplification. We amplified 10 L of leukocyte lysate or iO molecules of a synthetic amplification control in 100 L of reaction buffer (see ref. 11) containing primers BlO Zi and Z2 at 0.2 mol/L. Thirty cycles of amplification were carried out in a PTC 100 Thermal Controller (MJ Research, Watertown, MA); each cycle was 97#{176}C for 1 mm and 55 #{176}C for 2 miii, and the final extension was at 72#{176}C for 10 miii. Nonradioactive minisequencing. Four 50-FL aliquots of amplified DNA or biotinylated oligonucleotide control (Bio-CM or Bio-C) after fivefold dilution were transferred to streptavidin-coated microtiter plate wells (Labsystems, Helsinki, Finland). After incubating the plates for 15 mm at room temperature with shaking, we added to each well 50 L of a solution of 0.1 mol/L NaOH and 0.3 molIL NaCl, shook the wells briefly (30 s), and washed them three times with washing buffer (25 mmoL’L Tris-HC1, pH 7.5, containing 125 mmol/L NaCl, 2 mmol/L MgC12, and 3 milL Tween 20) in a microtiter plate washer (Wallac, Turku, Finland). The minisequencung reaction mixture for detecting the normal allele contained 5 pmol of DNP-labeled dCTP, whereas that for detecting the mutant allele contained 2 pmol of DNP-dUTP; and both mixtures also contained 0.2 mol/L detection primer ZD and 1 U of thermostable DNA polymerase (Dynazyme; Finnzymes, Espoo, Finland) in 50 mmolJL Tris-HC1, pH 8.8, containing 15 mmolfL (NH4)2S04, 1.5 mmolJL MgCl2, and 1 milL Tween 20. We added 50 L of each reaction mixture to two microtiter plate wells, which we incubated for 15 miii at 55#{176}C in a microtiter plate incubator and then washed six times with washing buffer. To detect the incorporated DNP-nucleotides, we added to each well 50
L of 1 U/rnL anti-DNP--alkaline phosphatase (Dako, Glostrup, Denmark) in conjugate buffer (25 mmol/L Tris-HC1, pH 7.5, 125 mmol/L NaC1, 2 mmol/l MgC12, 10 g/L bovine serum albumin, and 3 milL Tween 20) and incubated this for 15 miii at room temperature with shaking. The plates were washed six times and the appropriate substrate (colorimetric or luminometric) was added. The minisequencing test for the detection of the A1AT Z-mutation is available as a kit (AffiGeneT1’) from Sangtec Medical (Bromma, Sweden). Spectrophotometric detection. We added 100 L of 4 g/L p-mtrophenyl phosphate substrate (Orion Pharmaceutica, Helsinki, Finland) in 1 mol/L diethanolamine buffer (Orion Diagnostica) to each well of the microtiter plate and then incubated the plate for 20-30 min at room temperature. The absorbance was measured at 405 nm with Multiscan microtiter plate reader (Labsystems). Luminometric detection. To each microtiter plate well we added 100 L of 10 giL Lumigen PPD substrate (Boehringer Mannheim, Mannheim, Germany) in diethanolamine buffer and incubated the plate for 2 miii at room temperature. The luminescence was measured with Luminoscan
plate reader
(Labsystems).
extension assay. We labeled 6 pmol of ZD primer with T4-polynucleotide kinase, using [‘2P-y]ATP (5000 kCilmol) and 2000 pmol of ATP to obtain a specific activity of 5400 x 10 countWmin per mole after purification with chromatography on Sephadex G-25. The primer extension was performed in 20 iL of Tris buffer [50 mmol/L Tris-HC1, pH 8.8, 15 mmol/L (NH4)2S04, 1.5 mmol/L MgCl2, and 1 milL Tween 20] containing 5 pmol of 32P-labeled ZD primer, 1013 molecules of target oligonucleotide BIO-CM or BIO-C, and 5 or 50 pmol of DNP-dUTP or DNP-dCTP or [3H]dTFP (DuPont, Herts, UK) or [3H}dCTP (DuPont). After the reaction mixtures were incubated for 15 miii at 55#{176}C, 5 L of Stop solution (United States Biochemical, Cleveland, OH) was added, the samples were boiled for 5 miii, and the samples were loaded onto 10% sequencing gel. Results Principle
A 126-bp fragment of exon V of the A1AT gene is amplified with one biotunylated and one unbiotinylated
Table 1. Nucleotlde Sequences of Ollgonucleotldes Ollgonucleotlde BIO-z1
microtiter
Primer
for Detection of Al AT Z Mutation Sequence
5’-TCAGCC1TAC4AACGTGTCTCT
_____________
5’-GGATAGACATGGGTATGGCCT ZDL
5’-GCAGCTrCAGTCCCTrrCT 5’-CTGGGATCAGCCTrACAACGTGTCTCTGCTCATCGACjAGAAAGGGACTGAAGCTGTGGGT BIO-C#{176} BIOCzC 5’-CTGGGATCAGCCTrACAACGTGTCTCTGCTCATCGAC6AAAGGGACTQAAGCTGpTGGGT a Amplification pnmer; Zi has a blotin molecule at the 5’ end. b
Detectionprimer.
c Blotinytated
minisequencing control for M allele (Cu); and for Z allele
(Ci).
The sequence complementary to the detection prImer l boxed and
6/A
998918
underlined.
CLINICAL
CHEMISTRY,
Vol. 39, No.
11, 1993
2283
primer. The biotinylated DNA is immobilized onto two microtiter plate wells. The normal allele is detected by primer extension reaction with DNP-dCTP (in one well) and the mutant allele is detected with DNP-diJTP (in the other well). The DNP-labeled nucleotide8 incorporated are detected with anti-DNP-alkfihine phosphatase conjugate acting on p-nitrophenyl phosphate substrate (Figure 1). Characteristics of DNP-dUTP and DNP-dCTP in Minisequencing
The DNP-labeled nucleotides used must fulfill the following criteria their base-pairing characteristics should remain specific, they must be accepted as substrate by the DNA polymerase, and the DNP group must be accessible to detection by the antibody. To establish this assay, we studied the specificity of primer extension and the acceptability of the newly synthesized DNP-dCTP and DNP-dUTP by DNA polymerase. In this assay the 32P-labeled detection primer ZD was hybridized to the biotinylated minisequencing control oligonucleotides BIO-CM and BIO-C. The prmera were elongated with DNP-dCTP and DNP-dTJTP by using Taq DNA polymerase, and the elongation products were analyzed on a sequencing gel. For comparison, [3HJCICTP and [3}fld’l’FP were also incorporated. The specificity of the 3H-labeled nudeoside triphosphates incorporation was equal to that of unmodified nucleotides (data not shown). Moreover, the DNP-labeled Amplilicationof I
MT-well1
C
31.1-
01W-
3-
dUTP dTIP
CMZMZ
01w- l.t. dCTP dCTP
CMZMZ
DNP-
3H-
dUTP dTP
of primer extension reaction with DNP- and 3Hlabeled nucleotides (5 and 50 pmol per reaction) Mand Z blotinylated ollgonucleolldes BIOCM and BIO-C2)withnormaland Z mutation sequence, respectively; C, P-labeled detection primer (ZD) Fig. 2. SpecIficity
dUTP was incorporated with an efficiency similnr to that of the [3H]d11’P; however, DNP-dCTP was incor-
porated less efficiently than [3HJdCTP (Figure 2). No detectable misincorporation was seen at this detection level. To optimize the solid-phase minisequencing method with immunoenzymatic detection, we determined the optimal concentration of the DNP-labeled nucleotides (Figure 3A), using 5 x 1011 molecules of the BIO-CM and BIOC oligonucleotides as samples. This quantity is analogous to the average amount of amplified DNA A
1
-
Blrdng ‘\
Elution
C-reaction
DNP-
dCTP dCTP
CMZMZ
lb
Al AT-fragment B
CMZMZ
MT-wet 2
Amount of DNP-nucleotkie
IT’
Mlnlsequendng
(pmol)
B
I U-reaction
I=
I
1. Substrate
measuredbyspectrephotometly
Amount of DNP-nucleotlde (pmol)
Fig. 1. PrincIple of the A1AT Z mutation assay
Fig.3. Effect of concentration of DNP-nucleotlde on the signalin
Mlnlsequenclng on target DNAwith normal sequence (69989) Is shown. The four-winged structure at left Ineach column Is streptavidln on a mlcrotiter (Ml) plate well; B Is blotin; I-C Is DNP-dCTP; I-U Is DNP-dUTP; and III] Is ZD detection primer
minisequencing
2284
CUNICAL CHEMISTRY, Vol. 39, No. 11, 1993
(A) DNP-dCTP: normal allele (I), mutant allele (0); DNP.dUTP: mutant allele (U), normal allele (0). (B) The ratioof specific to unspecific Incorporation with
IncreasIng amount of labeled nucleotide: DNP-dCTP (#{149}); DNP-dUTP (B)
applied to one saturated with of DNP-dUTP, of DNP-dCTP,
well. The minisequencing reactions were 100 pmol of labeled nudeotide. At 5 pmol 70% saturation was obtained; at 5 pmol saturation was 50%. These results are consistent with those of the primer extension assay, suggesting that the DNP-hapten is accessible to the antibody conjugate. The highest ratio of specific to nonspecific signal was obtained with 0.5-5 pmol of DNPdCTP or DNP-dUTP per reaction (Figure 3B). Sensitivity and Detection Range
The sensitivity of the colorimetric DNP-minisequenci,ttO” lx10 lxi 012 ing assay is demonstrated in Figure 4. The detection Number of target molecules limit (ratio of the specific signal to unspecific incorpoFig. 5. SensitivIty of the luminometric minisequencing assay ration 2) when using DNP-dCTP or DNP-dUTP was DNP-dCTP (5 pmoO:normal allele (I), mutant allele (0); DNP-dUTP (5 pmol): about 5 x 10#{176} target DNA molecules. The linear detecmutant allele (U), normal allele (0). The signals are relative lumInescence tion range was close to two orders of magnitude (5 x 10#{176}units (RLU) to 5 x 1011 target molecules). Table 2. AnalysIs of A1AT Z Mutation from Clinical Colorimetric vs LuminometricDetection Samples By using the anti-DNP-allcsiline phosphatase conjuIncorporation of gate we could select from a variety of substrates: for 85mph DNP.dCTP(C) DNP-dUTP(U) Rc 0 detection by colorimetiy, p-nitrophenyl phosphate; by MM 0.883” 0.040 22.1 fluorometry, ArFOPHOS’ (JBL Scientific, San Luis 1.28 MZ 2 0.471 0.369 Obispo, CA) and 4-methylumbelliferyl phosphate; by MZ 3 0.583 0.617 0.94 iuminometiy, Lumigen. When we compared the sensi4 0.037 20.7 MM 0.766 tivities of colorimetric and luminometric detection, we 1.205 0.062 19.4 MM 5 found the detection limits were similar: 10#{176}-S x 10#{176}6 1.268 0.064 19.8 MM molecules of target DNA (Figures 4 and 5). The dynamic 1.29 MZ 7 0.739 0.572 range of the luminometric assay was consistently 2.5 0.562 1.16 MZ 8 0.654 orders of magnitude. The signal leveled off at target 1.952 Ofl cOflb 0.068 0.03 zz concentrations >1012 molecules because of the limiting Minlsequendng 1.712 37.2 MM quantity of DNP-nudeotide added to the reaction. Furcontror 0.046 No DNA 0.011 0.009 thermore, the microtiter well does not bind more than 5 a Absorbance at 406 nm. x 1012 molecules of biotinylated DNA. b
Analysis
of GenomicDNASamples
C4
Eight clinical samples were amplified and analyzed by the colorimetric minisequencing test for A1AT Z mutation (Table 2). To interpret the results of the minisequencing assay, we used R, the ratio of the sig-
I’,
0.01
Synthetic ollgonucleotlde with Z mutation sequence. (see Table 1).
nals obtained with DNP-dCTP and DNP-dUTP. The R values for the different genotypes were as follows: 19 for MM homozygote. Because the clinical material did not contain a homozygous Z sample, we had to obtain the R value for a ZZ homozygote by using the amplification control oligonudeotide. We repeated the minisequencing assay five times, using two MM sampies and two MZ samples. The CV varied between 6% and 14%. The results obtained with the colorimetric minisequencing assay were in all cases in concordance with those of the isoelectric focusing assay (19) used as the standard comparison test.
0.01
Discussion 1x1&
Number of target molecules FIg. 4. SensltMty and detection range of the colorimetric minisequencingassay DNP-dCTP (5 pmol): normal allele(I), mutant allele (0); DNP-dUTP (5 pmo0: mutant allele (U), normal allele (0). The values are means of two parallel determinations
Diagnosis of genetic diseases in a broad scale depends on the development of routine assays that are accurate, sensitive, simple, standardized, and economicaL For signal detection, radiolsotopes will be replaced by stable reporter molecules that are easily detectable and bear no risk to the user. We previously showed that the solid-phase minisequencing method fulfills the above CUNICAL CHEMISTRY, Vol. 39, No. 11, 1993
2285
mentioned criteria, tection (11).
except
that
we used radioactive
de-
detection of hapten-labeled reoffers an automatizable assay format, reproducible results, and low background when the assay conditions are optimized. Digoxigernn (20) has thus far been widely used in nonradioactive labeling of DNA, but only modified dUTP has been available. We have now successfully synthesized DNP-modifled dCTP and dUTP, to be used for the detection of point mutations by solid-phase minisequencing. The DNP hapten is a small molecule that is not present in the biological sample material and obviates problems of nonspecific background from the sample. In the optimized reaction conditions the DNP-labeled nucleotides incorporate specifically and give a very low reaction background. They are accepted as a substrate by DNA polymerase with an efficiency 5imilRr to that for 3H-labeled nucleotides. The primer extension assay showed that DNP-dUTP is slightly more efficiently incorporated than DNP-dCTP. However, the iinmunoenzymometrically detected signal reaches the same value with both nucleotides, which suggests that the DNP attached to dCTP is more efficiently presented to the anti-DNP antibody than is DNP-dUTP. Our DNP-labeled nucleotides are very stable; after 1 month of storage at room temperature the primer extension activity remained unchanged (data not shown). Synthesis of similarly modified purine-nucleotides is in progress. The DNP hapten is detected by means of an antiDNP-sllknhine phosphatase conjugate, for which colorimetric, fluorometric, and luminometric substrates are available. Application of any of these substrates with the respective detector instrument allows a quantitative measurement over two orders of magnitude. Consequently, distinction of homozygous from heterozygous individuals by differentiating the presence of normal sequence from the point mutation can be done reliably. The sensitivity of the spectrophotometric detection is only slightly lower than that of the luminometric detection. In principle, luminometry offers a larger dynamic range for measurement, but this cannot be fully utilized here because the capacity of the streptavidin-coated microtiter plate to bind biotinylated target DNA is limited to 5 x 10’s molecules. To fully exploit the quantitative property of the test a saturating concentration of the nucleotides needs to be used. Luminometry will be required for distinguishing minor proportions of somatically mutated cells among unmutated ones, e.g., when diagnosing cancer cells (21). We have reported earlier hnmunoenzymometric
porter
molecules
(11) that radioactive
solid-phase
minisequencing
used to detect several mutations simultaneously. also true with the colorimetric minisequencing, have developed
a cystic fibrosis
screening
can be
This is and we
test that
can
detect three mutations simultaneously by using the DNP-labeled nucleotides (Jalanko, unpublished). The performance of the nonradioactive minisequencing assay for detecting the A1AT Z mutation from clinical samples was confirmed by analyzing eight samples with different genotypes. The minisequencing assay was 2286
CUNICAL CHEMISTRY, Vol. 39, No. 11, 1993
completed within 2 h after amplification of the samples and gave fully reliable results for blood samples, from which DNA was prepared by a quick isolation procedure. The R values used to define the genotype fell into three nonoverlapping categories, allowing unambiguous genotype determination. A1AT has another significant mutation in addition to the Z mutation in exon V, i.e., the S mutation, an A to T transversion in exon III leading to the substitutioi of Glu to Val at position 264 (22). This mutation is he next most common after the Z mutation and carriers have A]AT activities 50-60% of normal (12). Diagnosis of SZ compound heterozygutes might be clinically important. We are currently constructing a colorimetric, microtiter plate-based test for detecting the S mutation of the A1AT gene. We thank Auli Santanen for excellent technical Heini JArvi for processing the manuscript.
assistance
and
References 1.
Mullis KB, Faloona FA. Specific synthesis
a polymerase
catalyzed
chain reaction.
of DNA in vitro via Methods Enzymol 1987;
155:335-SO. 2. Gingeras
TR, Prodanovich
DD, Barringer
KJ. Use
P, Latimer
T, Guatelli
of self-sustained sequence
JC, Richman replication
amplification reaction to analyze and detect mutations in zidovudine-resistant human immunodeflciency virus. J Infect Dis 1991; 164:1066-74. 3. Davis GR,,Bluineyer K, DiMichele U, Whitfleld KM, Chappele H, Riggs N, et al. Detection of human immunodeficiency virus type 1 in AIDS patients using amplification-mediated hybridization analyses: reproducibility and quantitative limitations. J Infect Dis 1990;162:13-20.
4. Barony F. Genetic disease detection and DNA amplification using cloned thermostable ilgase. Proc Nat! Aced Sd USA 1991; 88:189-93. 5. Newton CR, Summers C, Schwarz M, Graham A, Heptinstall LE, Super M, et al. Amplification refractory mutation system for prenatal diagnosis and carrier assessment in cystic fibrosis. Lancet 1989;ii:1481-3. 6. Wu DY, Ugozzoli L, Pal BK, Wallace RB. Allele-specific enzymatic amplification of $-globin genomic DNA for diagnosis of sickle-cell anemia. Proc Nat! Aced Sci USA 1989;86:2757-60. 7. Conner BJ, Reyes AA, Morin C, Itakura K, Teplitz RL, Wallace RB. Detection of sickle cell -g!obin allele by hybridization with synthetic oligonucleotides. Proc Natl Aced Sci USA 1983;80:27882. 8. Landegren U, Kaiser R, Sanders J, Hood L. A ligase-mediated gene detection technique. Science 1988;241:1077-80. 9. Haliassos A, Chomel JC, Tesson L, Bandis M, Kruh J, Kaplan JC, et aL Modification of enzymatically amplified DNA for the detection of point mutations. Nucl Acids Res 1989;17:3606. 10. Syvanen AC, Aalto-SetSla K, Haiu L, Kontula K, Soderlund H. A primer-guided nudeotide incorporation assay in genotyping of apolipoprotein E. Genomics 1990;8:684-92. 11. Jalanko A, Kere J, Savilahti B, Schwartz M, Syvanen AC, Ranki M, S#{246}derlund H. Screening for defined cystic fibrosis mutations by solid-phase minisequencing. Clin Chem 1992;38:39-43. 12. Brantley M, Nukiwa T, Crystal RG. Molecular basis of alpha1-antitrypein deficiency. Am J Med 1988;84:13-31. 13. Sifers RN, Carison JA, Clift SM, De Mayo FJ, Bullock DW, Woo SL. Tissue-specific expression of the human alpha-1-antitrypsin gene in transgenic mice. Nucleic Acids Res 1987;15:1459-75. 14. Andresen BS, Knudsen I, Jensen PKA, Rasmussen K, Gregersen N. Two novel nonradioactive polymerase chain reaction-based assays of dried blood spots, genomic DNA, or whole cells for fast, reliable detection of Z and S mutations in the a1-antitrypsin gene. Cliii Chem 1992;38:2100-7. 15. Tazelaar JP, Friedman KJ, Kline RS, Guthrie ML, Farber RA. Detection of a1-antitiypsin Z and S mutations by polymerase chain
reaction-mediated
1486-8.
site-directed
mutagenesis.
Cliii Chem 1992;38:
16. Walsh PS, Metzger DA, Higuchi R. Chelex’ 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. BioTech 1991;1O:506-13. 17. Beaucage SL, Caruthers MH. Deoxynucleoside phosphoramidites-a new class of key intermediates for deoxypolynucleotide synthesis. Tetrahedron Lett 1982;22:1859-62. 18. BengtstrOm M, Jungell-Nortamo A, SyvSnen AC. Biotinylation of oligonucleotides using a water soluble biotin ester. Nudeosides Nucleotid#{248}s 1990;9:123-7. 19. Pierce JA, radio BG. Improved identification of antitrypsin
phenotypes through
isoelectric focusing with dithioerythritol. J Lab Clin Med 1979;94:826-31. 20. Kessler C. The digoxigenin:anti-digoxigenun (DIG) technology-a survey on the concept and realization of novel bioanalytical indication system [Review]. Mol Cell Probes 1991;5:161-205. 21. Long GU, Chandra T, Woo SLC, Davie EW, Kurachi K Complete sequence of the cDNA for human a1-antitrypsin and gene for the S variant. Biochemistry 1984;23:4828-37. 22. Syvanen A-C, SOderlund H, Laaksonen B, BengtstrOm M, Turunen M, Palotie A. N-ins gene mutations in acute myeloid leukemim accurate detection by solid-phase munisequencing. hit J Cancer 1992;50:713-8.
CUNICAL CHEMISTRY, Vol. 39, No. 11, 1993
2287
