conference program & abstract book

6

Seventh International Food Legumes Research Conference, Marrakesh, Morocco, May 06-08, 2018

May 6-8, 2018

CONFERENCE PROGRAM & ABSTRACT BOOK

7


May 6-8, 2018

CONFERENCE PROGRAM & ABSTRACT BOOK

8


INTERNATIONAL STEERING COMMITTEE  Dr. Pooran M Gaur (Chair, ISC), ICRISAT, Hyderabad, India  Dr. Thomas (Tom) Warkentin (Chair, PC), University of Saskatchewan, Saskatoon, Canada  Dr. Shiv Kumar Agrawal, ICARDA, Rabat, Morocco  Dr. Stephen (Steve) Beebe, CIAT, Cali, Colombia  Dr. Gondwe Therese, IITA, Lusaka, Zambia  Dr. Ramakrishnan M Nair, World Vegetable Center South Asia, Hyderabad, India  Dr. Caterina Batello, FAO, Rome, Italy  Dr. Narendra Pratap Singh, IIPR, Kanpur, India  Dr. Brent N. Kaiser, The University of Sydney, Sydney, Australia  Dr. Anna Arnoldi, UniversitàdegliStudi di Milano, Milano, Italy  Dr. Maria Carlota Vaz Patto, Universidade Nova de Lisboa, Oeiras, Portugal  Dr. Khalid Daoui, INRA, Meknès, Morocco  Dr. Jorge Acosta-Gallegos, INIFAP, Chapingo, Mexico  Dr. Felix DapareDakora, Tshwane University of Technology, Pretoria 0001, South Africa LOCAL ORGANISING COMMITTEE  Dr. Michael Baum (Chair, LOC), ICARDA, Rabat, Morocco  Dr. Rachid Dahan (Co-Chair, LOC), INRA, Rabat, Morocco  Dr. Shiv Kumar Agrawal (Organizing Secretary), ICARDA, Rabat, Morocco  Dr. Mohamed El Mourid, ICARDA, Rabat, Morocco  Dr. Khalid Daoui, INRA, Meknès, Morocco  Dr. Ahmed Amri, ICARDA, Rabat, Morocco  Dr. Seid Ahmed Kemal, ICARDA, Rabat, Morocco  Dr. Moez Amri, ICARDA, Rabat, Morocco  Dr. Sobhan Sajja, ICRISAT, Hyderabad, India  Mr. Si Mohamad El-Bawi, ICARDA, Rabat, Morocco  Ms. Nezha Mouchfi, INRA, Rabat, Morocco  Ms. Oumekaltoum Essahli, ICARDA, Rabat, Morocco  Ms. Meriem Nasser, ICARDA, Rabat, Morocco SCIENTIFIC PROGRAM COMMITTEE  Dr. Thomas (Tom) Warkentin (Chair, PC), University of Saskatchewan, Saskatoon, Canada  Dr. Pooran M Gaur, ICRISAT, Hyderabad, India  Dr. Seid Ahmed Kemal, ICARDA, Rabat, Morocco  Dr. Shiv Kumar Agrawal, ICARDA, Rabat, Morocco PUBLICATION COMMITTEE  Dr. Seid Ahmed Kemal, Rabat, ICARDA  Dr. Shiv Kumar Agrawal, ICARDA, Rabat, Morocco  Dr. Moez Amri, ICARDA, Rabat, Morocco  Dr. Sobhan Sajja, ICRISAT, Hyderabad, India  Mr. Kamal Hejjaoui, ICARDA, Rabat, Morocco  Mss Hasnae Choukri, ICARDA, Rabat, Morocco  Mr. Noureddine El-Haddad, ICARDA, Rabat, Morocco

9


CONTENTS

CONFERENCE PROGRAM………………………………………………............ 1 KEYNOTE PRESENTATIONS…………………………………………………... 7 ORAL PRESENTATIONS………………………………………………………… 33 Workshop: Data Management Systems & Big Data Analytics………….................... 63 WORKSHOP PRESENTATIONS………………………………………………... 69 Workshop: Chickpea……………………………………………………… 73 Workshop: Lentil and Grasspea………………………………………....... 84 Workshop: Faba bean…………………………………………………….. 93 Workshop: Pigeonpea…………………………………………………….. 103 Workshop: Pea……………………………………………………………. 109 POSTER PRESENTATIONS……………………………………………………... 115 Theme 1: Global Food Legumes Scenario………………………………... 132 Theme 2: Marketing, Promotion and Policies……………………………. 135 Theme 3: Nutritional Quality and Value Addition……………………….. 143 Theme 4: Breeding Improved Germplasm……………………………….. 154 Theme 5: Biotic Stresses and their Management………………………... 179 Theme 6: Agronomy, Physiology and Abiotic Stresses………………….. 200 Theme 7: Ecosystem Services……………………………………………..229 Theme 8: Genomics, Genetics and Genetic Resources……………………235

10


1


7th International Food Legume Research Conference (IFLRC-VII) Palais des Congrès, Marrakesh, Morocco May 6-8, 2018

Program Date/Time 17:00-19:00 07:30-08:30 08:30-09:30

09:30-10:00 10:00-11:30 10:00-10:20 10:20-10:40 10:40-11:00 11:00-11:15 11:15-11:30 11:30-13:00 11:30-11:50 11:50-12:05 12:05-12:20 12:20-12:35 12:35-12:50 12:50-13:00 13:00-14:00

Activity May 5, 2018

Speaker

Evening registration May 6, 2018 Registration Opening Session (Venue: Royal Ballroom) WA01: ICARDA WA02: ICARDA WA03: ICRISAT WA04: INRA WA05: FAO WA06: IFLRC Vote of thanks Group Photo & Coffee break Plenary Session 1: Global Food Legumes Scenario – production, consumption and trade (Venue: Royal Ballroom) KN01: A global research initiative on grain legumes: priorities, programs and partners KN02: Global pulses Scenario – Production, consumption &Trade KN03: Technologies for African agricultural transformation OP01: Pulses for a sustainable and nutrition sensitive agriculture OP02: Plausible future outlook of pulses in Asia and Africa Plenary Session 2: Marketing, promotion and policies (Venue: Royal Ballroom) KN04: A new era for an old challenge: legume supported food and feed chains in Europe OP03: Chickpea seed system and farmers’ commercial behavior in seed: actors, challenges and implications OP04: What strategy for the revitalization of the Moroccan legumes sector? OP05: Legume seed systems for better livelihoods of smallholder farmers: lessons from TL projects OP06: Role of extrinsic and intrinsic factors in the uptake of best agricultural practices among food legume farmers of Afghanistan OP07: Trends and determinants of the adoption of improved chickpea varieties in Ethiopia Lunch

Margret Thalwitz, Board Chair Aly Abousabaa, DG Peter Carberry, DG (Acting) Rachid Dahan, DDG Abdelhak Laiti, PO in Morocco Pooran Gaur, Chair, ISC Michael Baum, Chair, LOC Chair: Aly Abousabaa, DGICARDA

Peter Carberry, ICRISAT Pramod K Joshi, IFPRI Jonas N Chianu, AfDB Calles Teodardo, FAO Kumara Charyulu Deevi, ICRISAT Co-Chairs: Pramod K Joshi, IFPRI & Brent Kaiser, Australia Frederic Muel, France Zewdie Bishaw, ICARDA Aziz Fadlaoui, INRA Chris Ojiewo, ICRISAT Srinivas Tavva, ICARDA Dawit Alemu, Ethiopia

2


14:00-15:30 14:00-14:20 14:20-14:40 14:40-14:55 14:55-15:10 15:10-15:25 15:25-15:40 15:40-15:55 16:00 -16:30 16:30-18:30 16:30-16:50 16:50-17:10 17:10-17:30 17:30-17:45 17:45-18:00 18:00-18:15 18:15-18:30 19:30-22:00 08:30-10:30 08:30-08:50 08:50-09:10 09:10-09:30 09:30-09:45 09:45-10:00 10:00-10:15 10:15-10:30 08:30-10:30 08:30-08:50 08:50-09:10

Plenary Session 3: Nutritional quality, post-harvest management and value addition (Venue: Royal Ballroom) KN05: Pulses linking to global food security and human health KN06: Breeding for nutritional quality with emphasis on biofortification OP08: Analysis of seed quality traits in chickpea OP09: Enhancing mineral concentration and bioavailability in pea OP10: Faba bean flour as an essential compound in cereal product formulation OP11: The role of legumes in an environmentally optimized diet for the Swiss population OP12: Relative bioavailability of iron in Bangladeshi traditional meals prepared with iron-fortified lentil dal Coffee break Plenary Session 4: Breeding improved germplasm (Venue: Royal Ballroom) KN07: Making the most of rapid selfing to accelerate genetic progress in grain legumes KN08: Modernizing food legume breeding programs: the contribution of the integrated breeding platform KN09: Common bean breeding for yield stability and nutrition OP13: Breeding and development of food quality winter peas OP14: The shiny green revolution: Dissecting grain yield components in green gram and black gram OP15: Extra short duration lentils open up an opportunity for horizontal expansion in rice-based cropping systems OP16: Demand-led variety design: Make plant breeding in Africa a business model responsive to market demand Cultural Program & Gala dinner May 7, 2018 Parallel Session 5: Biotic stresses and their management (Venue: Fez Theatre-1) KN10: Aphanomyces root rot of legumes: research advances for breeding resistant varieties and integrated disease management KN11: Managing diseases and Orobanche in food legumes KN12: One step behind: Why an integrated approach is more important than ever for managing Ascochyta blight in the Australian chickpea industry OP17: Fungicide management of faba bean rust in Morocco OP18: Review of epidemiology, fungicide control and host resistance for management of lentil anthracnose in Canada OP19: Identification of novel Ascochyta lentis resistance in the global lentil collection using FIGS OP20: Research advances on broomrape (Orobanche crenata Forsk.) resistance in food legumes Parallel Session 6: Agronomy, physiology, and abiotic stresses (Venue: Royal Ballroom) KN13: Balanced nutrient management in legumes for enhancing yields and eco-system services KN14: Evaluation of heat sensitivity in food legumes and approaches to improve heat tolerance

Co-Chairs: Fernand Lambein, Ghent Uni. & Ram M Nair, WVC Dil Thavarajah, USA Ashutosh Sarker, ICARDA Monica Baga, Canada Tom Warkentin, Canada Dorra Sfayhi, INRAT, Tunisia Thomas Nemecek, Switzerland Rajib Poddar, Canada Co-Chairs: Ahmed Amri, ICARDA & Kirstin Bett, Canada Willie Erskine, UWA, Australia Jean-Marcel Ribaut, IBP, Mexico Bodo Raatz, CIAT Rebecca McGee, USA Colin Douglas, DAF, Australia Shiv Kumar Agrawal, ICARDA Koaudio Nasser Yao, ILRI

Co-Chairs: Tom Warkentin, Canada & Martin Barbetti, Australia Marie-Laure Pilet-Nayal, France Diego Rubiales, Spain Rebecca Ford, Australia Seid Ahmed, ICARDA Lone Buchwaldt, Canada Rama Harinath Reddy Daadu, Australia Rachid Mentag, INRA, Morocco Co-Chairs: Jacques Wery, ICARDA & Rachid Dahan, INRA Suhas Wani, ICRISAT Harsh Nayyar, PU, India

3


09:10-09:30 09:30-09:45 09:45-10:00 10:00-10:15 10:15-10:30 10:30-11:00 11:00-13:00 11:00-11:20 11:20-11:40 11:40-12:00 12:00-12:15 12:15-12:30 12:30-12:45 12:45-13:00 11:00–13:00 11:00-11:12 11:12-11:24 11:24-11:36 11:36-11:48 11:48-12:00 12:00-12:12 12:12-12:24 12:24-12:36 12:26-12:48 12:48-13:00 13:00-14:00 14:00-17:30 14:00-14:10 14:10-14:20 14:20-14:30 14:30-14:40 14:40-14:50

KN15: Identification of heat resistant traits for pea OP21: Tillage and crop establishment practices in diversifiedcereal-legume based cropping systems in vertisol soil: crop productivity and soil health OP22: Diversifying with legumes: concepts and methods to design efficient systems OP23: Designing eco-efficient crop rotations with legumes and optimized N management by using life cycle assessment OP24: Integrated cropping-systems research at ICRISAT – phenotyping for environmental adaptations Coffee break Parallel Session 7: Ecosystem services (biological nitrogen fixation, and carbon, water and nutrient footprints) (Venue: Royal Ballroom) KN16: Tapping wild species of plants and microbes to improve nitrogen fixation in the chickpea crop KN17: Genotypic variation in phosphorus-use efficiency among a large set of chickpea germplasm and physiological mechanisms KN18: Shift focus on a neglected ecosystem service - Farming with Alternative Pollinators highly increases yields of faba bean OP25: Genetic variability for nodulation among lentil advanced lines: implications for nitrogen fixation ability OP26: Nodular diagnosis to assess the symbiotic nitrogen fixation of cowpea under low-P soils of Mediterranean agroecosystem OP27: Food Legumes and Conservation Agriculture for Sustainable Cereal Systems OP28: Soil health – a necessary linkage to augment pulse production of India Workshop on Harmonization of Data Management Systems & Big Data Analytics (Venue: Fez Theatre-1) Big Data & Informatics Platforms at ICRISAT & future strategies CGIAR Platform for Big Data in Agriculture: Beyond the Census of Things CGIAR’s geospatial data management CGIAR’s socio-economic data harmonization Digital revolution using the Breeding Management System Building the Computational Infrastructure to Implement Genomic Selection Semantics and Plant Phenotyping Data Structuration for Data Analytics Breeding Information Management Novel Tool to Support Accelerated Breeding Scheme in Clonal Crops Building Cyberinfrastructure for Multidisciplinary Multiscale AgroInformatics General Discussions & Questions Lunch Workshop: Chickpea (Venue: Royal Ballroom) WS01: Global scenario of chickpea research and development WS02: Chickpea breeding in India WS03: Chickpea breeding in Ethiopia WS04: Chickpea research and production in Iran WS05: Chickpea breeding in Turkey

Rosalind Bueckert, Canada Yashpal Singh Saharawat, ICARDA Helene Marrou, CIRAD, France Thomas Nemecek, Switzerland Jana Kholova, ICRISAT Co-Chairs: Kadambot Siddique, UWA & Suhas Wani, ICRISAT Doug Cook, UC-Davis, USA Kadambot Siddique, UWA, Australia Stefanie Christmann, ICARDA Omar Idrissi, INRA, Morocco Billal Kirdi, INRAT, Tunisia Ravi Gopal Singh, CIMMYT Ashok K Patra, IISS, India Moderators: Abhishek Rathore, ICRISAT & Brian King, CIAT Abhishek Rathore, ICRISAT, India Brian King, CIAT, Colombia Jawoo Koo, IFPRI, USA Carlo Azzarri, IFPRI, USA Jean-Marcel Ribaut, IBP, Mexico Peter Selby, Cornell Univ., USA Pierre-Etienne Alary, INRA, France Jazmin Molano, CIP, Peru James Wilgenbusch, Univ. of Minnesota, USA Moderator: Pooran Gaur, ICRISAT Pooran Gaur, ICRISAT GP Dixit, IIPR, India Asnake Fikre, Ethiopia Homayoun Kanouni, Iran Cengiz Toker, Turkey

4


14:50-15:00 15:00-15:10 15:10-15:20 15:20-15:30 15:30-16:00 16:00-16:10 16:10-16:20 16:20-16:30 16:30-16:40 16:40-16:50 16:50-17:00 17:00-17:10 17:00-17:30 14:00-17:30 14:00-14:10 14:10-14:20 14:20-14:30 14:30-14:40 14:40-14:50 14:50-15:00 15:00-15:10 15:10-15:20 15:20-15:30 15:30-16:00 16:00-16:10 16:10-16:20 16:20-16:30 16:30-16:40 16:40-16:50 16:50-17:00 17:00-17:30 14:00-17:30 14:00-14:10 14:10-14:20 14:20-14:30 14:30-14:40 14:40-14:50 14:50-15:00 15:00-15:10

WS06: Chickpea breeding in Spain WS07: Chickpea breeding in the USA WS08: Chickpea breeding in Canada WS09: Chickpea breeding in Myanmar Coffee break WS10: Chickpea quantitative trait loci that contribute to Ascochyta blight resistance across multiple environments WS11: Whole genome resequencing based trait mapping in chickpea WS12: Genome-wide association study of carotenoids concentration in chickpea using 50K Chickpea SNP chip WS13: Herbicide tolerance in chickpea WS14: Nematode resistance in chickpea WS15: Opportunities to improve nutritional quality traits in chickpea WS15a: Profligate and conservative water use patterns found in wild Cicer General Discussion Workshop: Lentil and Grass pea (Venue: Fez Theatre-1) WS16: Grass pea (Lathyrus sativus L.) - boon or bane? WS17: Lathyrus diversity: Available resources with relevance to crop improvement WS18: Indian perspective on lentil and grass pea improvement WS19: Lentil and grass pea Improvement in Bangladesh WS20: Lentil and grass pea improvement in Nepal WS21: Lentil and grass pea improvement in Ethiopia WS22: Lentil breeding efforts in the USA WS23: Progress in lentil improvement in Morocco WS24: Taking lentils out of their comfort zone Coffee break WS25: Combining resistance to multiple diseases in lentil WS26: Association mapping of iron and zinc content in lentil WS27: QTL mapping of milling quality traits in cultivated lentil WS28: Development of AB QTL Mapping Population and Variability for Yield Traits in Lentil WS29: My lentils are bigger than your lentils: Phenotyping lentil canopy growth in four dimensions. WS30: Spatial big data analytics for sustainable intensification of pulse crops in South Asia General Discussion Workshop: Faba bean (Venue: Karam Hall-1) WS31: Improving faba bean for sustainable agriculture in drylands WS32: Faba bean in China WS33: Recent results on Orobanche resistance in Ethiopia WS34: Moroccan perspective in improving faba bean productivity WS35: Major achievements in breeding faba bean in Tunisia WS36: Recent advances in marker assisted selection in faba bean WS37: Genetic diversity of faba bean landraces in Morocco: conservation and valorization

Juan Gil, Spain George Vandemark, USA Bunyamin Tar’an, Canada Mar Mar Win, Myanmar Aladdin Hamwieh, ICARDA Mahendar Thudi, ICRISAT Mohammad K Rezaei, Canada Sushil Chaturvedi, IIPR, India Rebecca Zwart, Australia Ravindra Chibbar, Canada P Raju, Australia Moderator: Ashutosh Sarker, ICARDA Fernand Lambein , Belgium Maria Carlota Vaz Patto, Portugal Sanjeev Gupta, IIPR, India Md Omar Ali, BARI, Bangladesh Rajendra Darai, NARC, Nepal Seid Kemal, ICARDA Kevin McPhee, USA Omar Idrissi, INRA, Morocco Rajeev Dhakal, Li Bird, Nepal Sarvjeet Singh, PAU, India Harsh Kumar Dikshit, IARI, India Maya Subedi, Canada Jitendra Kumar, India Steve Shirtliffe, Canada Chandrasekhar Biradar, ICARDA

Moderator: Donal O’Sullivan, UK Fouad Maalouf, ICARDA Xuxiao Zong, CAAS, China Teferi Teklay Abebe, EIAR, Ethiopia Zain El Abidine Fatemi, INRA, Morocco Mohamed Kharrat, INRAT, Tunisia Ana M. Torres, Spain Lamiae Ghaouti, IAV-HII, Morocco

5


15:10-15:20 15:20-15:30 15:30-16:00 16:00-16:10 16:10-16:20 16:20-16:30 16:30-16:40 16:40-16:50 16:50-17:00 17:00-17:30 14:00-15:30 14:00-14:10 14:10-14:20 14:20-14:30 14:30-14:40 14:40-14:50 14:50-15:00 15:00-15:10 15:10-15:20 15:20-15:30 15:30-16:00 16:00-17:30 16:00-16:10 16:10-16:20 16:20-16:30 16:30-16:40 16:40-16:50 16:50-17:00 17:00-17:10 17:10-17:20 17:20-17:30 17:30-18:30 08:30-10:30 08:30-08:50 08:50-09:10 09:10-09:30 09:30-09:50 09:50-10:10

WS38: Faba bean genotypes differ in their contribution as pollen donor to cross-fertilized seed WS39: Enhancing faba bean germplasm for resilience to temperature extremes Coffee break WS40: Faba bean resistance to pests and diseases WS41: Faba bean Galls in Ethiopia: current situation and possible solution WS42: Screening faba bean germplasm for resistance to persistently aphid transmitted viruses WS43: New SSR markers related to heat tolerance in faba bean under diverse environments WS44: First Sources of Resistance in faba bean to the Stem borer weevil, Lixus algirus L. (Coleoptera: Curculionidae) WS45: Analyzing faba bean autofertility under the Scanning Electron Microscope General discussion Workshop: Pigeonpea (Venue: Karam Hall-2) WS46: Current status and future prospects of pigeonpea in South Asia WS47: Pigeonpea breeding for Eastern and Southern Africa: Achievements and Prospects WS48: Prospects for pigeonpea in Australia WS49: Exploitation of wild species for pigeonpea improvement WS50: Impacts of hybrid pigeonpea technology in India WS51: Advances in resistance to diseases in pigeonpea WS52: Host-plant resistance to insect-pests and influence of natural enemies in pigeonpea ecosystem WS53: Prospects of Super Early Pigeonpea WS54: Advances in pigeonpea genomics Coffee break Workshop: Pea (Venue: Karam Hall-2) WS55: Pea breeding in Canada WS56: Vegetable pea breeding internationally WS57: Field pea breeding in USA WS58: Prospects of using wild Pisum species in breeding WS59: Seeking heat tolerance in pea WS60: Improving pea agronomy: Effectively managing weeds without herbicides WS61: Waterlogging tolerance at germination in pea WS62: Improving the nutritional quality of pea WS63: Identification of a leaf morphology mutant, Stipules reduced, using a Fast Neutron mutant population of pea Poster Session 1 May 08, 2018 Plenary Session 8: Genomics, genetics, and genetic resources (Venue: Royal Ballroom) KN19: A journey of genes from genomes to fields in legumes KN20: Harvesting Legume Genomes: Plant Genetic Resources KN21: Ecological genomics to uncover the adaptive significance of seed dormancy in legumes KN22: Advances in understanding pea traits KN23: Gene identification in faba bean – to synteny and beyond

Lisa Brünjes, Germany Jinguo Hu, WSU, USA Diego Rubiales, Spain Tadesse Negussie, EIAR, Ethiopia Safaa Kumari, ICARDA Zayed Babiker, ARI, Sudan Mustapha El Bouhssini, ICARDA Ana M. Torres, Spain Moderator: Rao (RCN) Rachaputi, Australia CV Sameer Kumar, ICRISAT Ganga Rao NVPR, ICRISAT Rao Rachaputi, Australia Shivali Sharma, ICRISAT Kumara Charyulu Deevi, ICRISAT Mamta Sharma, ICRISAT Jagdish Jaba, ICRISAT Anupama J Hingane, ICRISAT Rachit Saxena, ICRISAT Moderator: Tom Warkentin, Canada Dengjin Bing, Canada Rebecca McGee, USA Kevin McPhee, USA Petr Smykal, Czech Republic Rosalind Bueckert, Canada Steve Shirtliffe, Canada Md Shahin Uzzaman, Australia Claire Domoney, UK Noel Ellis, New Zealand

Chair: Doug Cook, UC-Davis, USA & Roberto Papa, Italy Rajeev Varshney, ICRISAT Clare Coyne, USA Petr Smykal, Czech Republic Noel Ellis, New Zeeland Donal O'Sullivan, UK

6


10:10-10:30 10:30-11:00 11:00-12:30 11:00-11:15 11:15-11:30 11:30-11:45 11:45-12:00 12:00-12:15 12:15-12:30 12:30-12:45 11:00-12:30 11:00-11:15 11:15-11:30 11:30-11:45 11:45-12:00 12:00-12:15 12:15-12:30 12:45-13:45 13:45-14:30 14:30-15:30

KN24: Efficient conservation, mining and use of temperate food legumes genetic resources Coffee break Concurrent Session 8a: Genomics and Genetics (Venue: Royal Ballroom) OP29: Bean Adapt: the genomics of adaptation during crop expansion of common bean OP30: Lots of diversity in lentil genomic resources OP31: Post-transcriptional regulation of seed development in Phaseolus vulgaris L. OP32: Bulk segregant sequencing, a quick approach to identify markers associated wrt ascochyta blight in chickpea OP33: A Genome wide association study of symbiotic nitrogen fixation in the Mesoamerican genepool of common bean OP34: High throughput Axiom SNP array genotyping of Vicia faba OP35: Identification of function-associated pathogenicity markers in Ascochyta rabiei through whole-genome-sequencing Concurrent Session 8b: Genetic Resources (Venue: Fez Hall-1) OP36: Enhanced use of germplasm to accelerate genetic gains in food legumes OP37: New opportunities for chickpea improvement by the exploitation of wild Cicer OP38: Mungbean mini-core collection: a treasure trove for resistance to pests and diseases OP39: Has domestication altered the response of chickpea to mineral nitrogen? OP40: Pisum sativum and P. fulvum Sibth. reciprocal interspecific crosses unearths hidden genes for extreme earliness OP41: Bean in Turkey: diversity, characterization, inter-gene pool hybridization and breeding Poster Session 2 Lunch Concluding Session (Royal Ballroom) Media Q&A/Open forum

15:30-16:30

Ahmed Amri, ICARDA

Co-Chairs: Maria Carlota Vaz Patto & Noel Ellis, New Zealand Roberto Papa, Italy Kirstin Bett, Canada Susana Araujo, Portugal Bunyamin Tar’an, Canada Jennifer Wilker, Canada Deepti Angra, UK Ido Bar, Australia Co-Chairs: Clare Coyne, USA & Sanjeev Gupta, India Hari D Upadhyaya, ICRISAT Jens Berger, Australia Ramakrishna Nair, WVC Eric von Wettberg, USA Cengiz Toker, Turkey Faheem Shehzad Baloch, Turkey

Co-Chairs: Peter Carberry, ICRISAT & Michael Baum, ICARDA Co-Chairs: Pooran Gaur, ICRISAT & Shiv Kumar, ICARDA

May 09, 2018 Field visit to ICARDA food legumes research program and lab visits at Marchouch and Rabat for the interested participants

7


KEYNOTE PRESENTATIONS KN# Session

Speaker

1

Session 1

Peter Carberry, ICRISAT

2

Session 1

Pramod K Joshi, IFPRI

3

Session 1

Jonas N Chianu, AfDB

4

Session 2

Frederic Muel, France

5

Session 3

Dil Thavarajah, USA

6

Session 3

Ashutosh Sarker, ICARDA

7

Session 4

Willie Erskine, UWA, Australia

8

Session 4

Jean-Marcel Ribaut, IBP, Mexico

9

Session 4

Bodo Raatz, CIAT

10

Session 5

Marie-Laure Pilet-Nayal, France

11

Session 5

Diego Rubiales, Spain

12

Session 5

Rebecca Ford, Australia

13

Session 6

Suhas Wani, ICRISAT

14

Session 6

Harsh Nayyar, PU, India

Topic KN01: A global research initiative on grain legumes: priorities, programs and partners KN02: Global pulses Scenario – Production, consumption &Trade KN03: Technologies for African agricultural transformation KN04: A new era for an old challenge: legume supported food and feed chains in Europe KN05: Pulses linking to global food security and human health KN06: Breeding for nutritional quality with emphasis on bio-fortification KN07: Making the most of rapid selfing to accelerate genetic progress in grain legumes KN08: Modernizing food legume breeding programs: the contribution of the integrated breeding platform KN09: Common bean breeding for yield stability and nutrition KN10: Aphanomyces root rot of legumes: research advances for breeding resistant varieties and integrated disease management KN11: Managing diseases and orobanche in food legumes KN12: One step behind: Why an integrated approach is more important than ever for managing Ascochyta blight in the Australian chickpea industry KN13: Balanced nutrient management in legumes for enhancing yields and ecosystem services KN14: Evaluation of heat sensitivity in food legumes and approaches to improve heat tolerance

8


15

Session 6

Rosalind Bueckert, Canada

16

Session 7

Doug Cook, UC-Davis, USA

17

Session 7

Kadambot Siddique, UWA, Australia

18

Session 7

Stefanie Christmann, ICARDA

19

Session 8

Rajeev Varshney, ICRISAT

20

Session 8

Clare Coyne, USA

21

Session 8

Petr Smykal, Czech Republic

22

Session 8

Noel Ellis, New Zeeland

23

Session 8

Donal O'Sullivan, University of Reading, UK

24

Session 8

Ahmed Amri, ICARDA

KN15: Identification of heat resistant traits for pea KN16: Tapping wild species of plants and microbes to improve nitrogen fixation in the chickpea crop KN17: Genotypic variation in phosphorus-use efficiency among a large set of chickpea germplasm and physiological mechanisms KN18: Shift focus on a neglected ecosystem service - Farming with Alternative Pollinators highly increases yields of faba bean KN19: A journey of genes from genomes to fields in legumes KN20: Harvesting Legume Genomes: Plant Genetic Resources KN21: Ecological genomics to uncover the adaptive significance of seed dormancy in legumes KN22: Advances in understanding pea traits KN23: Gene identification in faba bean – to synteny and beyond KN24: Efficient conservation, mining and use of temperate food legumes genetic resources

9


KN01: A global research initiative on grain legumes: priorities, programs and partners Carberry P International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Patancheru, India *Email: [email protected] Dr Peter Carberry joined ICRISAT as Deputy Director General Research in January 2015 and is also the Director of the CGIAR Research Program on Grain Legumes & Dryland Cereals from January 2018. Prior to joining ICRISAT, he was a Chief Research Scientist in CSIRO, Australia and led the CSIRO team within the Agricultural Production Systems Research Unit (APSRU). Dr Carberry's research expertise is in crop physiology and the development and application of farming systems simulation models. He is a key developer and driver of the Agricultural Production Systems SIMulator (APSIM) modelling framework. The Grain Legumes and Dryland Cereals Agri-food Systems CGIAR Research Program (CRPGLDC) is a new investment in agricultural research for development that will increase the productivity, profitability, resilience and marketability of critical and nutritious grain legume (chickpea, cowpea, pigeonpea, groundnut, lentil and soybean) and cereal (sorghum, pearl millet and finger millet) crops grown within the semi-arid and sub-humid dryland agroecologies of sub-Saharan Africa and South Asia. CRP-GLDC commenced on 1 st January 2018 and represents an investment of circa US$400 million over five years (2018-2022). GLDC is logically structured on five Flagship Programs (FPs) where research planning is driven by the analyzed needs of relevant agri-food systems (FP1: Priority Setting and Impact Acceleration). Through strategic partnerships, sector intelligence will identify and leverage value chain interventions that support dryland cereals and grain legume markets (FP2: Transforming Agri-food Systems). These analyses and innovation system engagements can inform and direct the cultivar requirements from crop improvement programs, seed and input supply systems (FP4: Variety and Hybrid Development) and the farming systems practices (FP3: Integrated Farm and Household Management) that lead to resilience and sustainable intensification outcomes. Modern breeding approaches will both underpin and increase the efficiency and effectiveness of crop improvement innovations that meet market demands (FP5: Pre-breeding and Trait Discovery). The logic is that improved innovation capacities within agri-food systems of key cereal and grain legume crops will enable coherent and integrated research and development, production, market and policy reforms that deliver resilience, inclusion, poverty reduction, nutritional security, environmental sustainability and economic growth.

10


KN02: Global pulse scenario: production, consumption and trade Joshi PK* and Parthasarathy Rao P International Food Policy Research Institute (IFPRI), New Delhi, India. *Email: [email protected] Dr Pramod K. Joshi is the director for South Asia, International Food Policy Research Institute. Previous to this, he held the position of the director of the National Academy of Agricultural Research Management, Hyderabad, India. His areas of research include technology policy, market, and institutional economics. Dr Joshi has received the Professor R.C. Agrawal Lifetime Award of Indian Society of Agricultural Economics and Dr MS Randhawa Memorial Award of the National Academy of Agricultural Sciences. He is the fellow of National Academy of Agricultural Sciences and Indian Society of Agriculture Economics. Dr Joshi has also served as the chairman of the SAARC Agricultural Centre’s governing board in Dhaka, Bangladesh and UN-CAPSA governing board in Bogor. He served as the member of the intergovernmental panel on the World Bank’s International Assessment of Agricultural Science and Technology for Development; International Steering Committee for the Climate Change, Agriculture and Food Security Challenge Program of CGIAR. Pulse-based food is an important source of dietary protein and micro-nutrients, particularly for the vegetarian population. At the global level, the average share of pulses is only 5% of the total protein consumption but their contribution in some developing countries ranges from 10 to 40%. Global pulse production during last four decades grew at 100 conference proceedings. She has been a recipient of USDA-NIFA Foundation, NSF, Bill and Malinda Gates Foundation, HarvestPlus, ICARDA, Northern Pulse Growers Association, USA Dry Pea Lentil Council, American Pulse Association, and SC State Department of Agriculture. She has been recognized as “Clemson University School of Health Faculty Research Scholar”. Millions of global populations are now suffering from food caused health issues. To feed the nine billion people who will be living on this planet by 2050 requires protein- and micronutrientrich foods. In the late 1960s, the “Green Revolution” increased the production of cereals (rice, wheat, and maize) to combat global hunger. Today, millions of people around the world suffer from obesity, overweight, and micronutrient malnutrition. Health experts are now recommending a second revolution—a “greener” revolution—to provide not just food but more nutritious foods such as pulses: lentil, field pea, and chickpea. Food legumes are a central part of the diet for many communities around the world, and therefore pulse crops could be an excellent whole food solution to combat global food insecurity and food related human health issues.

14


KN06: Breeding lentil for nutritional quality with emphasis on biofortification Sarker A1*, Kumar S1, Kumar J2, Darai R3, Alam, J4 and Dikshit HK5 1

International Center for Agricultural Research in the Dry Areas (ICARDA), Lebanon; 2ICARIndian Institute of Pulses Research, UP, India; 3National Grain Legume Research Program, Nepalgunj, Nepal; 4Bangladesh Agricultural Research Institute (BARI), Joydebpur, Bangladesh; 5 Indian Agricultural Research Institute (IARI), New Delhi, India. *Email: [email protected] Dr. Ashutosh Sarker, presently Regional Coordinator of ICARDA’s South Asia & China regional research program based in New Delhi, India has been serving ICARDA for the last 22 years. In his 38 years of research experience in food legume breeding and genetics, Dr Sarker has been directly involved in the development of >47 pulse varieties, majority of them in lentil which have including, Bangladesh, Nepal, Syria, Turkey, and India. He is also involved in up-scaling of improved varieties and production technologies of pulses which led to faster adoption and impact in improving farm-income and attaining nutritional security at house-hold level. Dr. Sarker is author of >200 scientific articles in reputed international journals, symposia proceedings, popular articles and book chapters. Dr. Sarker is recipient of several national and international awards in recognition of his contribution to legume science and in improving livelihoods of farmers. Lentil (Lens culinaris Medikus subsp. culinaris) is important in food and farming systems of South and West Asia, and North and East Africa. It provides good quality carbohydrate, protein, fiber, macro-and micronutrients, and vitamins to support human health. Over 2 billion people in the developing world suffer from iron and zinc deficiencies, the ‘hidden hunger’, prevailing among women and pre-school children, mostly in South Asia and Sub-Saharan Africa. Lentil is a staple pulse in the diet in these regions, thus providing nutritious lentils with high Fe and Zn contents can address micro-nutrient malnutrition syndrome. Screening of >2200 landraces, breeding lines and wild relatives show enormous variability for Fe (43 to 168 ppm) and zinc (22 to 103 ppm), thus encouraged breeders for genetic enhancement for these traits. The International Center for Agricultural Research in the Dry Areas (ICARDA) and its national partners has developed Fe- and Zn-rich lentils through classical breeding. Parents with high Fe (>80 ppm) and Zn (>65 ppm) are being used in breeding programs and primary, secondary and final products have been developed. Lentil varieties with high Fe (71-102 ppm) and high Zn (51-64 ppm) are in ‘fast tracking’ and adopted by farmers in Bangladesh, India, Ethiopia, Nepal and Syria. Recently, Nepal released Khajurah-3 lentil variety with 81.5 ppm Fe and 65.2 ppm Zn and India released IPL-220 having 73-114 ppm Fe and 51-63 ppm Zn contents using ICARDA parents. Thus, lentils with high Iron and Zinc contents are available to consumers to address micronutrient deficiency.

15


KN07: Making the most of rapid selfing to accelerate genetic progress in grain legumes Erskine W*, Croser J and Cowling WA The University of Western Australia, Crawley WA 6009, Australia *Email: [email protected] William Erskine is Director of the Centre for Plant Genetics and Breeding (PGB) at The University of Western Australia (UWA). He currently leads major projects in Timor Leste and Bangladesh on agricultural intensification funded by the Australian Centre for International Agriculture Research (ACIAR). He is also involved in annual pasture legume improvement in Australia with PGG Wrightsons. At UWA he undertakes research supervision and the teaching of postgraduates. He was at the International Center for Agricultural Research in the Dry Areas (ICARDA) in Syria as Assistant Director General (Research) from 2001-2007, Leader of the Germplasm Improvement Program (1998-2001), and Lentil Breeder from 1980 for 18 years. Scottish born, William completed a BA (University of Cambridge) in 1973, a MAg in 1976 in Papua New Guinea, and a PhD from Cambridge in 1979. Methods for rapid generation cycles of selfing are valuable in the breeding of autogamous crops such as grain legumes. Breeding can be divided into two phases, the population improvement phase, and the product development phase. Selfing is not mandatory in the population improvement phase, especially with genomic selection tools available today. However, accelerated Single Seed Descent (aSSD) can be employed in both phases, and is normally followed by phenotyping/yield testing on near homozygous lines. The principles of aSSD are rapid floral initiation (optimizing temperature; photoperiod and light quality); miniaturisation for controlled environment space; embryo harvest and precocious germination; and finally integrated abiotic screening (eg: boron, salt, and chilling responses). Major reductions in the duration of the generation cycle length are now routinely possible in a range of grain legumes (chickpea, faba bean, lentil, narrow-leaf lupin and field pea) from F2 to F6 generations (4 gen.) of 240 – 300 days. We modelled a rapid recurrent selection programme in field pea with data accumulating over cycles as in the animal model, and showed major improvements in an economic index including grain yield and resistance to ascochyta blight over 30 cycles of recurrent selection (Cowling et al. 2017 J Exp Bot 68:1927). Selection occurred on S0-, S3- or S5-derived progeny after aSSD, and showed a valuable role for aSSD in the population improvement phase. aSSD provides a way to harness new genetic diversity in both the population improvement phase and in the development of new commercial pure lines.

16


KN08: Modernizing food legume breeding programs: the contribution of the integrated breeding platform Jean-Marcel Ribaut* Integrated Breeding Platform, c/o CIMMYT, Km 45 Carretera Mexico-Veracruz, El Batan, Estado de Mexico, Mexico; *Email: [email protected] Dr. Jean-Marcel Ribaut is the Director of the Integrated Breeding Platform (https://www.integratedbreeding.net), an initiative aiming at improving the efficiency of plant breeding programmes by enabling breeders to access modern technologies, analytical pipeline, and breeding materials and related information in a centralised, integrated and practical manner. Prior to becoming IBP Director in 2015, Jean-Marcel was the Director of the Generation Challenge Program (GCP), a 10-year initiative of the Consultative Group on International Agricultural Research (CGIAR) with a total budget of US$ 170 million, leading a large and international network of partners on translational research in plant science. JeanMarcel has a particular interest in increasing yields and quality of cultivated crops in developing countries through the development of improved cultivars adapted to local environments and market demands. He believes in true partnership, from both public and private sectors, and solid capacity building to overcome some of the bottlenecks in R4D, with developing-country partners as key actors in the research arena and along the crop value chain. Crop production is under pressure to increase yields and quality through the development of improved cultivars adapted to local environments and market demands. The digital revolution, as reflected through the proliferation of digital record keeping and applications, is a critical, and necessary, step to modernize breeding programmes through the adoption of: 1) electronic data capture devices, 2) relational databases for data storage and retrieval and 3) integrated analytical pipelines to optimize data analysis and decision making at different stages in the breeding process. The Breeding Management System (BMS) is the core product of the Integrated Breeding Platform (IBP, https://www.integratedbreeding.net), and an example of an existing analytical pipeline that provides breeders across a broad range of crops and in particular legumes with access to the digital revolution. Building on the tools and services available through the IBP, and using examples from food legume breeding programmes already using the BMS, I will illustrate how bottlenecks in data management may be overcome. I will also underline the importance of crop ontology and meta-data, enabling plant breeders to run analyses across locations, projects and institutes. The value of using molecular markers, and in particular “traitlinked markers”, to effectively complement phenotypic selection will also be discussed now that those markers are becoming available for several legumes. Finally, I will highlight the importance of understanding the human element in this “modernization” especially the need to nurture and support the deployment and use of digital tools and services; this is essential to maintain the momentum and appetite for change.

17


KN09: Common bean breeding for yield stability and nutrition at CIAT Raatz B*, and Beebe SE Centro Internacional d’Agricultura Tropical (CIAT), Cali, Colombia *Email: [email protected] Bodo Raatz works at the CIAT bean program (Centro Internacional de Agricultura Tropical) in Colombia as the leader of the Andean bean improvement program. Graduated from University of Bielefeld, Germany in 2005, studying biochemistry. Obtained PhD in plant genetics at the Max Planck Institute for Plant Breeding Research, Cologne in 2009. Since 2011 active as a breeder and geneticist in the bean program at CIAT, working on bush and climbing beans mainly directed at African smallholder farmers. Breeding traits of interest include abiotic resistance (drought, heat, poor soil fertility), resistance to biotic stresses (viral, bacterial, fungal diseases and pests) and biofortification (increased Fe and Zn) to alleviate malnutrition. Molecular markers are developed and applied in molecular breeding to increase breeding efficiency. In cooperation with the Pan African Bean Research Alliance (PABRA) germplasm is delivered and researchers trained to create impact by improving the livelihood of smallholder farmers. The bean breeding program (Phaseolus vulgaris) at CIAT has a long standing history in germplasm improvement, leading to the release of hundreds of improved varieties in Eastern and Southern Africa, Latin America and the Caribbean. To meet the producer’s demands for improved germplasm the major targeted breeding goals are yield stability and nutrition. Major selection traits are abiotic stress tolerance to drought, heat and low soil fertility. As Phaseolus beans are adapted to a wide range of climates and ecologies, CIAT employs a broad use of genetic resources. Interspecific crosses have allowed major advances in abiotic stress tolerance. Yield stability in low input farming systems is also strongly affected by pests and diseases. Resistance breeding introduced resistances to several fungal leaf pathogens and viral diseases into elite bean germplasm. Next to field resistance evaluations, molecular markers are developed and employed in marker assisted selection. Nutritional content is an important attribute of common bean. The biofortification breeding program aims to alleviate micro mineral malnutrition which is a major health threat affecting one third of the world’s population. Breeding for high iron beans was particularly successful in the small red grain class and climbing beans. Biofortified bean was shown to have a positive effect on anemia and cognitive performance. The Pan African Bean Research Alliance (PABRA) is an important partner for successful dissemination and impact. To improve the whole value chain of bean the “bean corridor” approach has been developed, aiming to support all stakeholders from the producer to consumer to increase productivity, marketability and impact.

18


KN10: Aphanomyces root rot of legumes: research advances for breeding resistant varieties and integrated disease management Pilet-Nayel M-L1,2*, Lavaud C1,2, Quillévéré-Hamard A1,2, Lesné A1,2, Even M-N2,3, Desgroux A1,2, Boutet G1,2, Baranger A1,2, Le May C2,4 and Moussart A2,3 1 Institut National de la Recherche Agronomique (INRA), 35160 Le Rheu, France ; 2Technological Mixed Unit - Pea: Ideotypes, Systems, Surveys of pea and faba bean Main diseases (PISOM), 35160 Le Rheu, France; 3Terres Inovia, 78850 Thiverval Grignon, France ; 4Agrocampus-Ouest, 35000 Rennes, France; *Email: [email protected] Dr Marie-Laure Pilet-Nayel is a Research Scientist at INRA IGEPP, Rennes, France, graduated with a PhD degree in genetics and plant breeding since 1999. She has developed expertise in quantitative genetics, genomics, marker-assisted-selection and disease resistance in plants. After her post-doc position at USDA-ARS, WA, USA (19992000), she has managed research programs in genetics and genomics of Aphanomyces root rot resistance in legumes for the past 18 years, in tight collaborations with pathologists, physiologists and breeders. Her recent accomplishments are the development of NILs and GWA studies to validate QTL involved in partial resistance to Aphanomyces root rot in pea and to study the QTL-underlying mechanisms. Aphanomyces root rot, caused by the oomycete Aphanomyces euteiches, is a serious soil-borne disease in main pea-growing countries worldwide. Recent advances on genetics of polygenic partial resistance allowed to accurately identify markers associated with resistance using GWAS (Genome-Wide Association Mapping), QTL (Quantitative Trait Locus) re-detection and finemapping approaches. Several QTL combinations, identified from multi-local and –year evaluations of QTL-NILs (Near Isogenic Lines) in French Aphanomyces nurseries, significantly reduced disease severity. Genetic and phenotypic diversity analysis of French populations of A. euteiches in main pea growing regions identified low genetic diversity and representative isolates were selected to test for aggressiveness towards QTL in QTL-NILs. The effect of agricultural practices was studied to reduce the disease risk in the field, based on knowledge of disease epidemics. A preliminary determination of the soil inoculum potential (IP) and knowledge of environmental and cultural risk factors at the plot level are recommended to avoid sowing in highly infested fields. Winter pea sowing can be considered in soils with low IP as it would escape conducive conditions to the disease at young plant stages and therefore suffer limited yield losses. Rotations with non-host or resistant legume species and cultivars can also prevent pathogen multiplication in lightly infested fields. Combination of genetic and agricultural practises proves to be a key strategy for managing Aphanomyces root rot of pea.

19


KN11: Integrated management of diseases of legume crops: Mediterranean perspective Rubiales D* Institute for Sustainable Agriculture, CSIC, Córdoba, Spain; *Email: [email protected] Prof. Diego Rubiales is a Professor at the Institute for Sustainable Agriculture, CSIC, Córdoba, Spain. He has been working on resistance to diseases in legumes during the past 20 years, having worked before on diseases of cereals. During this period, he served as President first of the European Grain Legume Association and then of the International Legume Society. He has co-authored 300 major publications, reaching H=40. He has directed 27 successful PhD. In addition to these research activities, he runs pea and faba bean breeding programs, resulting in 3 faba bean and 4 pea cultivars registered. Prof. Rubiales paid particular effort to in participation and coordination of research both at EU and Mediterranean level. He was coordinator of a European projects EUFABA, MEDILEG and COST849, and WP leader in GLIP, LEGRESIST, ABSTRESS, LEGATO and DIVERSify. He also leads 17 Spanish research projects and 13 projects for bilateral projects with North African countries and participate in one Australian and two Canadian projects. Legume crops can be damaged by a number of diseases worldwide that will be reviewed. However, as the conference is in a Mediterranean country, more detailed attention with be paid to diseases that are specific of Mediterranean environments. Among these, fusarium wilts, ascochyta blights, rusts and powdery mildews will be covered, but particularly the broomrapes (Orobanche spp.), that are often neglected. The most desirable control option for low input legumes is the use of resistant cultivars. Availability of sources of resistance and their undelaying mechanisms and genetic basis on the various legume crops will be reviewed and implications in resistance breeding will be critically discussed. Also, as unfortunately only cultivars with moderate levels of resistance are available in most instances, there is need to complement resistances available with other control measures in an integrated approach. The relative value of each measure varies with each disease, being prevention of movement into uninfested areas a crucial component of control. Chemical control is feasible for a number of diseases, although not always economic for low input legume crops. A number of cultural practices, from delayed sowing, intercropping or rotations can contribute to disease reduction, together with strategies such as activation of systemic acquired resistance, biocontrol or others are being explored, but are not yet ready for direct application. Perspectives for adoption in an integrative manner of such control strategies will be discussed.

20


KN12: One step behind: why an integrated approach is more important than ever for managing Ascochyta blight in the Australian chickpea industry Ford R1*, Sambasivan P1, Mehmood Y1, Bar I1, Hobson K2, Walela C3, Brand J4, Davidson J5 and Moore K2 1

Griffith University, Nathan, Queensland, Australia; 2New South Wales Department of Primary Industry, Tamworth, New South Wales, Australia; 3South Australian Research and Development Institute, Clare, South Australia, Australia; 4Department of Economic Development, Jobs, Transport and Resources, Horsham, Victoria, Australia; 5South Australian Research and Development Institute, Urrbrae, South Australia, Australia; *Email: [email protected]

Rebecca completed her BSc at Griffith University, Australia in 1989 and then spent six formative years working for the sugar industry developing transgenic disease resistant sugarcane varieties. She undertook her PhD at The University of Melbourne, Australia within an ARC-Linkage project with the lentil industry, graduating in 2000. From there, she built on her broad acre cropping industry networks and connections to win and lead four more ARC-Linkage projects and many grains and horticultural industry programs. Moving to Griffith University in 2014, she brought with her and continues to lead the national chickpea pathology program for the Grains Research and Development Program, underpinning Australia's $1.2b chickpea industry. She also leads the national papaya breeding program, in its infancy but about to release six new cultivars. To date, Rebecca has gained in excess of $14m in industry and government funding, mostly directed towards security of staple and desirable food crops through improved sustainable production practices. This has led to >125 HERDC publications, and the successful completion of 29 PhD and 7 MSc candidates, many of whom now occupy senior roles in industry and governmental departments worldwide. Ascochyta Blight (AB), caused by the fungus Ascochyta rabiei (syn Phoma rabiei), is a major endemic disease of the Australian chickpea industry, resulting in significant crop losses and management costs. In Australia, we have a large and growing knowledge base on the spatial and temporal variation and aggressiveness in the pathogen population across growing regions. This information is used to improve disease management strategies, including using the worst (most aggressive) isolates for screening for resistance in advanced breeding material destined for the southern or northern growing regions. Recently, higher frequencies of aggressive isolates have resulted in increased disease severity, including on the most recently released northern cultivar, PBA Seamer. The Australian chickpea industry is currently experiencing erosion of resistance in several widely grown cultivars. We believe the increase in highly aggressive isolates results from selective evolution caused by inappropriate choice of cultivar, non-optimal fungicide use, planting untreated seed and exposure to high levels of Ascochyta inoculum in short (chickpeacereal-chickpea) or nil (chickpea-chickpea) rotations. The bumper profits realised in some regions in 2016 (>$40M AUD for one grower alone) certainly led to non-adherence of best management practice, with crops in 2016 and 2017 sown directly into the previous season’s Ascochyta infected stubble. Hope does prevail; the Pulse Breeding Australia (PBA) chickpea program has developed material with better resistance than PBA Seamer to the aggressive northern isolate population. We remain as ever one step behind the pathogen, but to prolong cultivar lifespan and maintain profitability, best management practices must be followed by all growers. The Australian chickpea industry must now decide on the best ways to enforce these practices, particularly in the northern growing regions, given that lucrative returns are tempting growers to break recommended management guidelines.

21


KN13: Balanced nutrient management for enhancing yields and eco-system services thru legumes Wani SP* International Crops Research Institute for the Semi-Arid Tropics (ICRISAT, P.O. Patancheru, 502 324, Telangana, India

*Email: [email protected] Suhas P. Wani, Research Program Director – Asia and Director, ICRISAT Development Center (IDC) at International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Patancheru, India. His area of specialization is scaling-up science-based interventions to benefit millions of farmers in Asia and Africa particularly in the area of sustainable agriculture for improving rural livelihoods. His expertise spans thru integrated watershed management and water use efficiency (Green, blue and grey) in field to catchment scale, wasteland development, wastewater management, biodiesel plantation, integrated nutrient management and carbon sequestration for the conservation of natural resources and their sustainable use for improving livelihoods of farmers. Livelihoods improvement for small farm holders is the main thrust of his research for development (R4D). Dr. Wani has received Gold medal from Government of Vietnam for the improvement of agriculture and rural development in Vietnam, Fellowship from Yunnan Academy of Agricultural Sciences (YAAS), Kunming, China; Doreen Mashler Award; Best Team Award, Best ICAR Award and Outstanding scientific article award. He received Krishi Sanman Award by ABP Majha, Abhinav – Innovative Practices in IWMP” by Ministry of R&D, Government of India, Asian CSR Leadership Award for the year 2015, 50 most impactful leaders in water and water management. World water leadership congress, 3 rd CSR Impact award in Livelihood category for 'ICRISAT – JSW Energy’s project - ICRISAT-JSW @ Bellary: Improving Rural Livelihoods through Integrated Watershed Management. In his credit, 575 research papers published in national and international journals, books and conference proceedings Legumes are the main source of protein in the vegetarian diet and are also endowed with nitrogen fixing ability and drought tolerance traits for which these are referred as smart foods. However, legumes are generally grown under rainfed situation in poor soils, continued cultivation of crops over the decades and due to change in the management practices because of open food cycle, soils have developed micro and secondary nutrient deficiencies. Poor soil fertility results into poor nitrogen fixation ability and also lower yields with lesser quality of the grains and fodder. Assessment of soil fertility of farmers’ fields in different states of India and parts of Thailand, Vietnam and China have shown wide spread deficiencies of zinc, born, sulphur and in some cases, molybdenum and iron also. In such a case, soil test-based balance nitrogen application has resulted in substantial increase (20 to 30%) in the yields as well as quality of the grains and fodder due to increased nitrogen fixation by the legumes. In order the harness the full potential of legumes for addressing the issues of food security, mal-nutrition and eco system services, there is an urgent need to ensure healthy soils for healthy food particularly legumes resulting into healthy people. Results of large scale-up program of Bhoochetana in Karnataka and states of Andhra Pradesh demonstrating increased yields will be presented. In Karnataka during seven years of Bhoochetana initiative benefitted 4.75 millions of farming families and resulted in increased net incomes of US $ 453 million due to increased productivity and incomes for the farmers.

22


KN14: Evaluation of heat sensitivity in food legumes and approaches for heat tolerance Nayyar H*1, Gaur P2, Kumar S3, Bindumadhava H4, Nair RM4, Kumar J5, Siddique KHM6, Vara Prasad PV7 and Singh S8 1 Department of Botany, Panjab University, Chandigarh, India; 2ICRISAT, Patancheru, India; 3 ICARDA, Rabat, Morocco; 4World Vegetable Center, South Asia, ICRISAT campus, Patancheru, India; 5Indian Institute of Pulses Research, Kanpur, India; 6The UWA Institute of Agriculture, University of Western Australia, Perth, WA, 6009 Australia; 7Kansas State University, Kansas, Manhattan, USA; 8Punjab Agricultural University, Ludhiana, India; *Email: [email protected] Dr. Harsh Nayyar is a Professor of Stress Biology at Panjab University, Chandigarh, India. He teaches Plant Anatomy and Plant Physiology to graduate and post-graduate students at his University. His primary research interests include screening the core germplasm of various food legumes such as Lentil, Chickpea, Mungbean and Urdbean for heat, cold and drought tolerance, involving several traits related to growth, physiology, anatomy, reproductive biology and yield. He is investigating the mechanisms associated with imparting tolerance against various abiotic stresses, connecting reproductive biology, physiology and molecular biology. He is working on pulses in collaboration with ICARDA, ICRISAT, World Vegetable Center and Indian Agricultural Universities in North part of the India. He has identified promising heat tolerant lines of chickpea, lentil and mungbean. He has published about 100 research papers on stress biology in peer-reviewed research journals. His research on food legumes has been funded by many national and international agencies. The rising temperatures are a major concern for the productivity of food legumes, grown in winter as well as summer-season, especially in tropical and sub-tropical regions. Our studies have indicated a marked damage to reproductive stage resulting in reduction in pod set and seed yield of chickpea, lentil (cool-season legumes) and mungbean (warm-season legume) under high temperatures. Studies done in controlled and outdoor environments (late sowing) revealed that temperatures >35/20°C (as day and night) were highly detrimental, night temperatures were more damaging. The degree of heat injury varies depending upon the duration and severity of stress. Among the reproductive components, pollen grains were more sensitive, became deformed and showed reduction in pollen viability, reduced germination and pollen tube growth. Stigma receptivity and ovule viability were also inhibited, which affected the pollen germination on stigma surface and restricted tube growth through style, impaired fertilization to cause flower abortion. Assessment of the physiology of leaves and anthers indicated decrease in sucrose production in both the organs due to inhibition of enzymes, which possibly affected the structural and functional aspects of the pollen grains. Seed filling is another stage, which becomes impaired as a result of inactivation of enzymes related to sucrose production causing inhibition in sucrose translocation into seeds. Additionally, the composition of the seeds is adversely affected resulting in small sized and poor quality of seeds. The data related to these processes would be presented. Genetic variation for heat tolerance exists in our target legume crops, which needs further probing and use of heat tolerant germplasm in breeding programs. Screening for high temperature tolerance has led to identification of few heat-tolerant genotypes, which are able to maintain their gamete function at high temperature (40/30°C), unlike the sensitive genotypes. Future studies would focus on high throughput phenotyping techniques and/or physiological, biochemical or genetic markers that control the reproductive function. Information about the effects of heat stress on reproductive biology and seed filling events of chickpea, lentil and mungbean will be discussed.

23


KN15: Identification of heat resistant traits in pea Bueckert R1*, Jiang Y2, Davis A1, Tafesse E1, Osorio E1, Huang S1 and Warkentin T1 1

University of Saskatchewan, Saskatoon, SK S7N 5A8, Canada; 2University of Guelph, Guelph, ON N1G 2W1, Canada; *Email: [email protected] Dr. Rosalind Bueckert received a BSc degree from the University of Reading (UK), and MSc, PhD and post doc research from the University of Arkansas, USA- specializing in drought physiology and crop nutrition in cotton and soybean. She is a Professor in the Department of Plant Sciences, University of Saskatchewan, Canada, specializing in field level crop physiology, abiotic stress, legume crops, and yield formation. Current research activities include high throughput plant phenotyping in lentil, canola, and wheat. For the last ten years she has focused on assessing heat resistant traits in pea. Pea crops experience short cycles of heat stress in the field, leading to large yield losses in warm years. Our goals are to understand the impact of heat stress, to manage a crop to reduce yield loss, and to identify heat resistant traits to improve crop performance. For western Canada, early seeding allows escape from high temperature during reproduction, plus moderately indeterminate cultivars (19 nodes, 8+ reproductive nodes) with the semi-leafless trait, less vining or branching, and a blue-ish leaf color. Semi-leafless cultivars have thicker stipule and petiole wax which reflect heat and maintain cooler canopies. Lodged, diseased and bright green canopies absorb more heat. The hottest part of the plant is at the top, where flowers and young pods are situated. Frosty wax helps with heat reflection, but shiny wax surfaces (pods) absorb more heat and pods become several degrees higher than leaves. Pea flowers are self-pollinated in flower buds, before flowers open. We found a range in pollen viability, pollen hydration and tube growth into the style to pollinate ovules, and the length of the ovary may discourage successful pollination of ovules furthest from the style. Pods also balance maternal resources which impacts seed abortion according to position within pods. Agronomy is moving to big data, so we also measured spectral reflectance for vegetation indices (like NDVI) to indicate crop health in stress. We likely have at least 20 traits that can be exploited although no single cultivar appears robust in all features.

24


KN16: Tapping wild species of plants and microbes to improve nitrogen fixation in the chickpea crop Greenlon A, Perilla-Henao L, Alford BA and Cook DR* University of California, Davis, California, 95616 USA *Email: [email protected] Professor Douglas R. Cook is a Professor in the Department of Plant Pathology at the University of California-Davis. He is Director of the Feed the Future Innovation Lab for Climate Resilient Chickpea. He received his doctoral degree from the University of Wisconsin-Madison as a bacterial geneticist and has spent the majority of his professional career working on legume biology at both the fundamental and applied levels. He was among a small group of colleagues who together pioneered the use of Medicago truncatula as a model genetic and genomic system for investigation of legume biology. For the past decade has been a leading advocate for the application of basic legume science towards pressing agricultural needs in the developing world. He currently leads an international consortium focused on the collection and characterization of crop wild relatives of cultivated chickpea, including both culture independent and living collections of the wild and cultivated species’ microbiome. Legume species are key components of both natural and agricultural ecosystems. Their importance derives in large part from their capacity for symbiotic nitrogen fixation with soil bacteria, enabling them to return vital nitrogen to the soil environment and to create seed and forage of high protein content. Two decades of molecular and genomic studies in model systems have revealed the presence of exquisite genetic pathways that initiate symbiosis, but despite these advances we have essentially no understanding of genes that regulate symbiotic performance in the natural or agricultural environment. Here we aim to understand the evolution of symbiotic performance in the wild progenitors of chickpea and the ways in which human selection has reshaped this potential during domestication. Sequencing the genomes of >1,000 chickpea symbionts from a systematic global survey of wild and cultivated systems reveals a domestication-driven network of horizontal gene transfer that has expanded the species capable of fixing nitrogen with chickpea from three to greater than fifteen. In parallel, we are characterizing the nodule-associated microbiome to identify non-rhizobia that provide services to the symbiotic organ. By analyzing a matrix of bacterial genotypes x host genotype combinations we infer impacts of domestication on the host’s capacity for nitrogen fixation. Current data indicates that cultivated species have a broader range of effective symbiotic partner species, but with lower average benefit from symbiosis, consistent with a selection trade-off during domestication. We will present strategies to leverage such information to improve the effectiveness of nitrogen fixation in legume agricultural systems.

25


KN17: Genotypic variation in phosphorus-use efficiency among a large set of chickpea germplasm and underlying physiological mechanisms Pang J1, Zhao H2, Bansal R3, Bohuon E4, Lambers H1, Ryan MH1, and Siddique KHM1* 1 University of Western Australia, Perth, WA, Australia; 2 Institute of Mountain Hazards and Environment, Chinese Academy of Sciences, Chengdu, China; 3Division of Germplasm Evaluation, National Bureau of Plant Genetic Resources, New Delhi, India; 4The Institut Polytechnique UniLaSalle, Beauvais Cedex 60000, France. *Email: [email protected] Professor Kadambot Siddique is the Hackett Professor of Agriculture Chair and Director of the University of Western Australia’s Institute of Agriculture. He has more than 30 years’ experience in agricultural research, teaching and management in both Australia and overseas. Professor Siddique has an international reputation in agricultural science especially in the fields of crop physiology, production agronomy, farming systems, genetic resources, breeding research in cereal, grain and pasture legumes and oilseed crops. He has published more than 380 scientific papers and book chapters. He is a Fellow of the Australian Academy of Technological Sciences and Engineering, Australian Agricultural Institute and Indian National Academy of Agricultural Sciences. In 2017 Professor Siddique received the Global Agricultural Research Leadership from the Indian Council of Food and Agriculture (ICAF) for his contribution to Dryland Agriculture. In December 2016 Government of India Minister for Agriculture honoured Professor Siddique for his outstanding contributions to global pulses research and development. In 2016 Professor Siddique received the Grains Industry Association of Western Australia (GIWA) award for his life time contribution to the pulse industry. Professor Siddique was the UN FAO Special Ambassador for the International Year of Pulses 2016, and is the recipient of national and international awards including: Urrbrae Memorial Award, Member of the Order of Australia (AM), 2014 Western Australian Year of the Award (CitWA) and the Dunhunag Award by China's Gansu Provincial Government. Phosphorus deficiency is considered a major constraint for crop production worldwide. In this study, a unique chickpea reference set consisting of 266 genotypes originating from 29 countries with diverse genetic background was used to study the genotypic variation in P acquisition and P utilisation. Plants were grown for 7 weeks in pots with 1.2 kg sterilised river sand in each pot with low level of P. Additional P at a rate of 10 µg P g-1 soil as FePO4 (a sparingly-soluble form of P) was mixed into the soil. The results show large genotypic variation in plant growth, shoot P content, physiological P-use efficiency and P-utilisation efficiency in response to low P supply. Shoot P content is strongly correlated with shoot dry weight (DW, r = 0.86, P < 0.001), root DW (r = 0.57, P < 0.001), total root length (r = 0.74, P < 0.001), root surface area (r = 0.79, P < 0.001) and rhizosphere carboxylates (r = 0.62, P < 0.001). A 6-fold difference in rhizosheath carboxylate amount was present. Our results also show that carboxylates mobilise Mn from the soil with a strong correlation between Mn concentration in mature leaves and rhizosheath carboxylates (r = 0.61, P < 0.001). For the first time in crop plants, this finding demonstrates that leaf [Mn] can provide vital information on belowground functioning as a time-integrated proxy for P acquisition via carboxylate release, providing a valuable screening tool in breeding for high P-acquisition efficiency.

26


KN18: Shift focus on a neglected ecosystem service - Farming with Alternative Pollinators (FAP) highly increases yields of faba bean Christmann S1*, Maalouf F2 and Smaili MS3 1

International Center for Agricultural Research in the Dry Areas (ICARDA), Rabat, Morocco; 2 ICARDA, Terbol, Lebanon; 3 Institut National de la Recherche Agronomique (INRA), Kenitra, Morocco; *Email: [email protected] Dr. Stefanie Christmann worked on Environmental Governance in various positions. She joined ICARDA in 2009, first with duty base in Central Asia, since 2015 in Morocco. Based on the TEEB-approach (show the value of ecosystem services and use it to trigger intrinsic motivation for better protection of ecosystem services), she developed several economically self-sustaining environmental governance approaches to protect biodiversity in the course of climate change. "Farming with Alternative Pollinators (FAP, 2012)" is her most important innovation. Based on different planting instructions, farmers gain higher net income per surface by pollinator protection. FAP obviates rewarding schemes. FAP also includes cross-sector policy instruments affordable for Low and Middle Income Countries. Different to the costly strategies for pollinator protection, which have been recently developed by some countries in the Northern hemisphere, FAP has potential to become a globally scalable model for pollinator protection. The environmental governance approach Farming with Alternative Pollinators (FAP) was developed in 2012. One target of FAP is economically self-sustaining on-farm protection of pollinators. FAP shall obviate costly rewarding schemes for farmers as used by the European Union, because such schemes are not scalable in Low and Middle Income Countries. Three pilot projects in Central Asia and Morocco tested FAP with different main crops and proved its replicability. In 2017, trials with faba bean as main crop were conducted in Shkirat and Kenitra (adequate rainfall) and Sefrou (mountainous) areas in Morocco. FAP fields used 75% of the area for the main crop and 25% for habitat enhancement by other marketable plants. Control fields produce the main crop on 100% of the area. FAP and control fields are compared concerning diversity and abundance of pollinators, predators, pests and net income. In 2016/17 cropping season, the net income per surface was at least double in FAP faba bean fields compared to control faba bean fields, mainly due to better pollination, but also owing to more predators. The number of seeds per pod was significantly higher in FAP fields than in control fields. Habitat enhancement does not require high investment, but planting instructions and knowledge. Farmers quickly started experimenting on their own farms. The results of the FAP faba bean project can contribute to pollinator protection, better farm income and high food security. Moreover, FAP enhances the comparative advantages of faba bean as an alternative and climate friendly protein provider.

27


KN19: A journey of genes from genomes to fields in legumes Varshney RK* Center of Excellence in Genomics and Systems Biology, International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Patancheru, India;

*Email: [email protected] Dr. Rajeev Varshney, presently Global Research Program Director, Genetic Gains and Founding Director, Center of Excellence in Genomics & Systems Biology, has been serving ICRISAT since 2005. Varshney is a recognized leader in the area of applied genomics and genomics-assisted breeding and an effective research leader/ manager in the area of translational genomics in international agriculture. He has genome sequences of 8 crops including pigeonpea, chickpea, peanut and pearl millet and several molecular breeding products in chickpea, peanut and pigeonpea to his credit. Varshney’s research is focused on developing genomic tools, understanding genome architecture, dissecting genetic basis of trait variation, and using this natural variation to improve crops in marginal environments in Asia and Africa. His research has provided insights into the genetic diversity of germplasm collections, the genetic architecture of complex traits, hybrid vigor, and the genes associated with tolerance to biotic and abiotic stress as well as nutritional traits. Varshney is an elected fellow/ member/ academician of Leopoldina- German National Academy of Sciences, The World Academy of Sciences, American Association of Advancement in Sciences (USA), Crop Science Society of America (CSSA), Indian National Science Academy and several other Indian science academies. Varshney has received the Bhatnagar Prize, the most coveted science and technology award from Government of India. He is recipient of numerous other prestigious awards including the Qilu Friendship Award from Shandong Province of Republic of China, the Young Crop Scientist Award of CSSA, the Illumina Agricultural Greater Good Initiative Award, Research Excellence India Citation Award of Thomson Reuters. Varshney is a prolific author and has been recognized as a Highly Cited Researcher by Thomson Reuters for the last four years. Legume crops such as chickpea, pigeonpea and groundnut contribute to livelihood as well as human nutrition as a rich source of protein and are mostly grown in semi-arid and tropical regions of many Asian and African countries. Exposure of these crops to different biotic and abiotic stresses in marginal environments results in low crop productivity in developing countries. Until recently, very limited genomic resources were available in these crops and these crops used to be called “orphan crops”. Traditional breeding approaches, however, could not be effective for enhancing crop productivity to feed the growing global population that too under limited resources and changing climate scenario. Recent advances in sequencing, automation/robotics and computational biology have started an era of –omics sciences in legumes. A number of –omics approaches have been deployed to understand the genome architecture, complexity of trait and apply genome diversity in breeding. For instance, various genomic resources including high-density genetic maps, reference genomes have been developed in these legume crops. In each legume crop, 300-500 lines including reference set, elite lines, and parents of several mapping populations have been re-sequenced to identify millions of sequence variants. Modern trait mapping approaches such as genotyping-by-sequencing, QTL-Seq have been used to map a number of agronomic traits. RNA-seq approach has been used to develop gene expression atlas and identify differentially expressed genes for several traits. Efforts are underway to develop ‘proteome map’ and ‘metabolome map’ in each of these legume crops. Molecular markers and genes identified through various` –omics approaches have been moved to fields through molecular breeding for improving several agronomic and nutritional traits in these legume crops. In summary, translation of genome information to fields has come of the age in legumes. These genomic interventions in breeding together with faster varietal replacement are expected to deliver genetics gains in farmers’ fields.

28


KN20: Harvesting legume genomes: Plant genetic resources Coyne CJ* United States Department of Agriculture, Pullman, Washington, USA; *Email: [email protected] Dr. Clarice Coyne is the Curator and Geneticist of the Cool Season Food Legume Germplasm Collection held by the USDA at the Western Regional Plant Germplasm Introduction and Testing Station on the campus of Washington State University, Pullman. Dr. Coyne earned her B.S. degree in Plant Science from the University of California, Davis and M.S. and Ph.D. degrees in Horticulture, with an emphasis on Plant Breeding and Genetics, from Oregon State University, Corvallis. Over the last 22 years, Dr. Coyne authored or co-authored 83 publications and 8 book chapters. Dr. Coyne’s research focuses on enhancing the utilization of food legume genetic resources for crop improvement. Genomics and high through-put phenotyping are ushering in a new era of accessing genetic diversity held in plant genetic resources, the cornerstone of both traditional and genomicsassisted breeding efforts of food legume crops. Acknowledged or not, yield plateaus must be broken given the daunting challenges we face as plant scientists. Solutions will stand on many pillars of scientific discovery - the increased utilization of genetic diversity reservoir of food legume germplasm resources is just one pillar. What is holding us back? We need robust genomic/genetic databases, open access to phenotypic data, and human capital development. The future is very bright if we embrace the value of transparency ushering in the age of big data, data mining and meta-analyses. Examples will be presented on databases of germplasm, genomics and open access data available to the food legume research community.

29


KN21: Ecological genomics to uncover the adaptive significance of seed dormancy in legumes Smýkal P1*, Hradilová I1, Trněný O2, Duchoslav M1, Hýbl M3, Kopecký P3, Rathore A4, Brus J5, and Pechanec V5 1

Department of Botany, Palacký University in Olomouc, Olomouc, Czech Republic, 2 Agricultural Research Ltd. Troubsko; 3Crop Research Institute, The Centre of the Region Haná for biotechnological and Agricultural Research, Olomouc, Czech Republic; 4ICRISAT, Hyderabad, India; 5Department of Geoinformatics, Palacký University in Olomouc, Olomouc, Czech Republic. *Email: [email protected] Dr. Petr Smýkal is presently Associate Professor in the Department of Botany, Palacky University in Olomouc, Czech Republic. Having studied a combination of agronomy, plant biotechnology and genetics, I have been working over the 25 years of my scientific carrier on various topics of both theoretical and applied plant biology ranging from pollen embryogenesis, flowering to transgenosis. However, the most exciting part in last 15 years has been devoted to work on legumes, particularly on pea, an iconic plant of genetics. Starting from germplasm diversity assessment I went to phylogeny and lately especially into legumes domestication. Focusing on the study of legumes (wild pea and Medicago model) seed dormancy from various angles (genomics, transcriptomic, metabolomic and anatomical) including its adaptive values in natural conditions. Having studied legumes CWR diversity, I have applied this knowledge into development of pea introgression lines to broaden pea crop diversity. My recorded scientific outcome is 56 WoS listed publications with over 900 citations. Timing of seed germination is one of the key steps in plant life. It determines when plants enter natural or agricultural ecosystem. Understanding of the genetic basis of local adaptation has relevance to climate change, crop production as well as understanding of the speciation. The objective of the study is to understand the genetic basis of adaptation to environmental conditions influencing dormancy release and the timing of legume seed germination, using two annual legume species: wild pea (Pisum sp.) with relevance to crop and Medicago truncatula. 150 pea lines were subjected to next generation sequencing. For the 262 accessions of Medicago the sequences were retrieved from HapMap project. Selected bioclimatic, topographic and humidity conditions were extracted based on geographical coordinates. Sets of data layers for particular environmental factors were obtained with using TanDEM-X datasets (German Aerospace Center). The quality of the acquired elevation model is very precise (12-metre and an elevation accuracy of a single metre). Principal Component analysis identified main gradient correlated with altitude and is related to the temperature variation. Discriminant analysis showed that genotypes highly responsible to temperature are representative of environments with higher precipitation, especially during driest conditions and lower temperatures while highly dormant are typical of higher isothermality and higher temperatures. Seed germination experiments were conducted at fluctuating temperatures of 35/15°C, 25/15°C and 7°C regimes and significant differences were found. Genome-wide association analysis of Medicago dataset identified about 15 genes across all chromosomes. The haplotype association with dormancy level is in progress.

30


KN22: Advances in understanding pea traits Ellis THN* University of Auckland, Auckland, 1142, New Zealand. *Email: [email protected] Prof. Noel Ellis has more than 30 years’ experience in plant molecular genetics. Before coming to New Zealand, he was Director of the CGIAR Research Program on Grain Legumes based in Hyderabad, Professor of Crop Genetics at IBERS Aberystwyth and Associate Head of Crop Genetics at the John Innes Centre in Norwich. He moved to the John Innes directly after completing his PhD at the MRC Mammalian Genome Unit at the University of Edinburgh. Research interests of Prof. Noel Ellis have focused on the genetic basis of the inter- and intra-specific evolution and diversification of legumes at both genomic and phenotypic levels. A core activity has been to develop approaches for the isolation of genes identified by their phenotype. Dr. Ellis established and coordinated an EU FP6 integrated project ‘Grain Legumes’ (2004-2008 involving 80 labs in 25 countries) which ranged from life cycle analysis of economic and environmental impact to genome sequencing as research networks are needed in science, for economies and to combine disparate disciplines. His pioneering work in genetics particularly in pea has been well recognized. I will discuss and give examples of the molecular genetic characterization of pea traits. The presentation will focus on the nature of the constraints in this process and discuss the relationship between a genetically defined phenotype and a physiologically defined trait.

31


KN23: Gene identification in faba bean – to synteny and beyond O'Sullivan DM1*, Angra D1, Khamassi K2, El-Rodeny W3 and Zeid MK4 1

School of Agriculture, Policy and Development, University of Reading, Reading, UK; 2INRAT, Rue Hedi Karray, Ariana, Tunisia; 3Agricultural Research Centre-Sakha, Food Legumes Section, Kafr-El-Sheikh, Egypt;4Alexandria University, El-Shatby, Alexandria, Egypt *Email: [email protected] Donal’s field is crop genetics and he have pursued this topic in various guises for 24 years in Ireland, France and the UK in three Universities and both public and private research institutions. His PhD in molecular plant pathology (specifically genome variability of the common bean anthracnose fungal pathogen) was followed by postdoctoral work on maize and bean structural genomics, and then 10 years as a group/programme leader at NIAB in Cambridge, UK, where he developed a sequence of pioneering cereal association genetics research projects and a toolkit (markers, germplasm) for faba bean genetic and pre-breeding research. In 2013, he took up a research Chair in Crop Science at the University of Reading and currently leads a research group with one over-arching aim: to reveal the subtle genetic architecture of complex, quantitative traits underpinning production of resilient, nutritious crops, primarily wheat and the pulses faba bean and common bean. In this talk, I will outline progress in the further exploitation of the syntenic relationships between Vicia faba and Medicago truncatula established in earlier work [1] in pursuit of genes underlying a series of faba bean traits of interest.The first example is Dwarf1 (Dwf1) gene, a gibberellic acid-sensitive dwarfing gene, where synteny was used to identify a candidate gene, whose causative role was further confirmed by fine-mapping, allele re-sequencing and metabolite analysis. The second example is the VC gene controlling a 10-fold reduction in the anti-nutritional factors vicine and convicine. The trait maps in a segment of Vf chr 1 which shows strong colinearity with Mt chr 2. Since only a handful of spp in the genus Vicia make these secondary metabolites, it is possible that the Medicago genome does not contain a strict orthologue of the VC gene. Therefore, the role of synteny in this case is to saturate the interval with markers which is being used as a basis for the ongoing fine-mapping and positional cloning of the gene. Ultimately, whilst synteny has been a useful framework to translate knowledge of gene function from model to crop species, traits such as VC and tolerance to the parasitic weed Orobanche challenge us to move beyond a dependency on generating marker coverage and causal gene hypotheses exclusively based on synteny. With this in mind, we have recently developed a 50K Axiom SNP genotyping array and will present validation of its use in greatly narrowing the vc region and present plans for a major new initiative to map Orobanche tolerance.

32


KN24: Efficient conservation, mining and use of temperate food legumes genetic resources Amri A, Kehel Z, Shehadeh A, Tsivelikas A, Yazbek M, Amri M and Kumar S International Center for Agricultural Research in the Dry Areas (ICARDA, Rabat, Morocco *Email: [email protected] Ahmed Amri has PhD in Genetic and Plant Breeding from Kansas State University (1989). He worked at INRA-Morocco for 20 years as cereal breeder and release of 17 barley varieties, 5 triticale and 7 bread wheat and durum varieties resistant to Hessian fly. He worked at ICARDA since 1999 as regional coordinator for a GEF West Asia Dryland Agrobiodiversity project (1999-2005), ICARDA Regional Coordinator for West Asia (2001-2008), Coordinator Iran-ICARDA office (2005-2009) and since 2008, appointed as the Head of Genetic Resources Unit and Deputy Director of the Biodiversity and Integrated Gene Management Program. He has a total of 132 publications including 72 in the refereed journals and advised 27 PhD and MSc students. Food legume crops are important component of agriculture not only for food security and nutrition but also for diversification at crop and variety levels. Around 15% of the 7.5 million accessions held in the genebanks around the world are food legumes with the International Centre for Agriculture Research in the Dry Areas (ICARDA), the International Crops Research Institute for the Semi-Arid Tropics (ICRISAT) and the Kirkhouse Trust having large collections. ICARDA holds in-trust a total of 156,909 accessions belonging to 872 taxa among which 50,963 belong to genera Cicer, Lens, Lathyrus Pisum and Vicia faba and 27,063 accessions belonging to forage legume species, and collected from more than 125 countries. ICARDA is striving to add novel diversity by collecting and acquiring new accessions based on the gap analysis and adaptive trait-based collecting. In order to increase the use of germplasm in breeding program, we use the Focused Identification of Germplasm Strategy (FIGS, www.icarda.org/figs) to better target the traits sought by researchers. FIGS has demonstrated utility of identifying resistance to major biotic and abiotic stresses for Lentil, chickpea and faba bean. Landraces and wild relatives mainly in primary and secondary genepools have been utilized to introgress traits of interest in the cultivated genepool. Screening of wild Lens has resulted in identification of resistance/tolerance for key stresses including drought, cold, salinity, Ascochyta blight, Stemphylium bight, rust, Fusarium wilt, Sitona weevil, Orobanche, powdery mildew and Anthracnose. Sources of extra earliness in ILWL118 and high iron and zinc content in ILWL74 and ILWL80 have encouraged breeders to biofortify short-duration lentil through pre-breeding. ICARDA in collaboration with NARS partners in India has implemented a prebreeding project in lentil and chickpea, which has been instrumental in introgressing useful genes in mainstream breeding. Evaluation of Lathyrus species for ODAP content and Orobanche revealed significant variation for these traits.

33


ORAL PRESENTATIONS OP#

Session#

Speaker

1

Session 1

Calles Teodardo, FAO

2

Session 1

Kumara Charyulu Deevi, ICRISAT

3

Session 2

Zewdie Bishaw, ICARDA

4

Session 2

Aziz Fadlaoui, INRA

5

Session 2

Chris Ojiewo, ICRISAT

6

Session 2

Srinivas Tavva, Afghanistan

7

Session 2

Dawit Alemu, Ethiopia

8

Session 3

Ravindra Chibbar, Canada

9

Session 3

Tom Warkentin, Canada

10

Session 3

Dorra Sfayhi, INRAT, Tunisia

11

Session 3

Thomas Nemecek, Switzerland

12

Session 3

Rajib Poddar, Canada

13

Session 4

Rebecca McGee, USA

14

Session 4

Colin Douglas, DAF, Australia

Topic OP01: Pulses for a sustainable and nutrition sensitive agriculture OP02: Plausible future outlook of pulses in Asia and Africa OP03: Chickpea seed system and farmers’ commercial behavior in seed: actors, challenges and implications OP04: What strategy for the revitalization of the Moroccan legumes sector? OP05: Legume seed systems for better livelihoods of smallholder farmers: lessons from TL projects OP06: Role of extrinsic and intrinsic factors in the uptake of best agricultural practices among smallholder food legume farmers of Afghanistan OP07: Trends and determinants of the adoption of improved chickpea varieties in Ethiopia OP08: Opportunities to improve nutritional quality traits in chickpea OP09: Enhancing mineral concentration and bioavailability in pea OP10: Faba bean flour as an essential compound in cereal product formulation OP11: The role of legumes in an environmentally optimised diet for the Swiss population OP12: Relative bioavailability of iron in Bangladeshi traditional meals prepared with iron-fortified lentil dal OP13: Breeding and development of food quality winter peas OP14: The shiny green revolution: Dissecting grain yield components in green gram and black gram

34


15

Session 4

Shiv Kumar Agrawal, ICARDA

16

Session 4

Koaudio Nasser Yao

17

Session 5

Seid Ahmed, ICARDA

18

Session 5

Lone Buchwaldt, Canada

19

Session 5

Rama Harinath Reddy Daadu, Australia

20

Session 5

Rachid Mentag, INRA, Morocco

21

Session 6

Yashpal Singh Saharawat, ICARDA

22

Session 6

Ashok K Patra, IISS, India

23

Session 6

Ravi Gopal Singh, CIMMYT

24 25

Session 6 Session 7

Jana Kholova, ICRISAT Helene Marrou, CIRAD, France

26

Session 7

Thomas Nemecek, Switzerland

27

Session 7

Omar Idrissi, INRA, Morocco

28

Session 7

Billal Kirdi, INRAT, Tunisia

OP15: Extra short duration lentils open up an opportunity for horizontal expansion in rice-based cropping systems OP16: Demand-led variety design: Make plant breeding in Africa a business model responsive to market demand OP17: Fungicide management of faba bean rust (Uromyces viciae fabae) in Morocco OP18: Review of epidemiology, fungicide control and host resistance for management of lentil anthracnose in Canada OP19: Identification of novel Ascochyta lentis resistance in the global lentil collection using FIGS OP20: Research advances on broomrape (Orobanche crenata Forsk.) resistance in food legumes OP21: Tillage and crop establishment practices in diversified-cereal-legume based cropping systems in vertisol soil: crop productivity and soil health OP22: Soil health – a necessary linkage to augment pulse production of India OP23: Food Legumes and Conservation Agriculture for Sustainable Cereal Systems OP24: Integrated cropping-systems research at ICRISAT – phenotyping for environmental adaptations OP25: Diversifying with legumes: concepts and methods to design efficient systems OP26: Designing eco-efficient crop rotations with legumes and optimised N management by using life cycle assessment OP27: Genetic variability for nodulation among lentil advanced lines: implications for nitrogen fixation ability OP28: Nodular diagnosis to assess the symbiotic nitrogen fixation of

35


29

Session 8

Roberto Papa, Italy

30

Session 8

Kirstin Bett, Canada

31

Session 8

Susana Araujo, Portugal

32

Session 8

Bunyamin Tar’an, Canada

33

Session 8

Jennifer Wilker, Canada

34

Session 8

Deepti Angra, UK

35

Session 8

Ido Bar, Australia

36

Session 8

Hari D Upadhyaya, ICRISAT

37

Session 8

Jens Berger, Australia

38

Session 8

Ramakrishna Nair, WVC

39

Session 8

Eric von Wettberg, USA

40

Session 8

Cengiz Toker, Turkey

41

Session 8

Faheem Shehzad Baloch, Turkey

cowpea under low-P soils of Mediterranean agroecosystem OP29: Bean Adapt: the genomics of adaptation during crop expansion of common bean OP30: Lots of diversity in lentil genomic resources OP31: Post-transcriptional regulation of seed development in Phaseolus vulgaris L. OP32: Bulk segregant sequencing, a quick approach to identify markers associated wrt ascochyta blight in chickpea OP33: A Genome wide association study of symbiotic nitrogen fixation in the Mesoamerican genepool of common bean OP34: High throughput Axiom SNP array genotyping of Vicia faba OP35: Identification of functionassociated pathogenicity markers in Ascochyta rabiei through wholegenome-sequencing OP35: Enhanced use of germplasm to accelerate genetic gains in food legumes OP36: New opportunities for chickpea improvement by the exploitation of wild Cicer OP37: Mungbean mini-core collection: a treasure trove for resistance to pests and diseases OP38: Has domestication altered the response of chickpea to mineral nitrogen? OP39: Pisum sativum and P. fulvum Sibth. reciprocal interspecific crosses unearths hidden genes for extreme earliness OP40: Bean in Turkey: Diversity, characterization, inter-gene pool hybridization and breeding

36


37


OP01: Pulses for a sustainable and nutrition-sensitive agriculture Calles T* and Xipsiti M Food and Agriculture Organization of the United Nations (FAO), Rome 00153, Italy. *Email: [email protected] Pulses, and food legumes in general, have been an essential part of the human diet for centuries yet, their nutritional and agricultural value is not well recognized and frequently underappreciated. For this reason, the United Nations (UN) General Assembly declared 2016 as the International Year of Pulses (IYP) and mandated the Food and Agriculture Organization of the UN (FAO) with its implementation. FAO has successfully raised awareness during and beyond 2016 on the many benefits of pulses by opening up opportunities for information exchange, improving mutual understanding through education and communication activities, promoting appropriate policies and developing necessary skills to enhance production and trade of pulses. According to FAOSTAT, there is an imbalance between cereal and pulse production in both global harvested area (718 versus 82 million ha) and production quantity (2849 versus 82 million tonnes). This provides an opportunity to enhance crop diversification through promotion of local and novel pulse varieties. Pulses could become the cornerstone of sustainable agriculture due to their ability to biologically fix atmospheric nitrogen and enhance the biological turnover of phosphorous. Additionally, they are nutritionally rich foods that are good sources of protein and dietary fibre and may contribute to reduce the risk of diet-related non-communicable diseases such as type 2 diabetes and cardiovascular diseases. To this end, FAO works towards strengthening pulse/legume-based nutrition-sensitive agricultural systems in order to make agricultural production more sustainable while responding to future food needs and improving the nutrition quality production of smallholder farmers.

OP02: Plausible future outlook of food legumes in Asia and Africa Nedumaran S, Kumara Charyulu D1* and Jyothsnaa P1 1

International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Hyderabad, India,

*Email: [email protected] Food Legumes - poor man’s meat - play an important and diverse role in the diets and in sustaining farming systems of the small and marginal farmers around the world. The burgeoning population and rising per capita incomes are fueling the demand for food legumes, while their sluggish growth in production in Asia and sub-Saharan Africa, is escalating their per unit output prices and ultimately leading to decline in per capita consumption. A long-term outlook is essential for formulating appropriate policy and research investment strategies for increasing food legumes production in order to ensure future food and nutritional security as well as animal feed in both continents. The present paper highlights the projections by the International Model for Policy Analysis of Agricultural Commodities and Trade (IMPACT) model on food legume production, trade, demand, prices, and food security up to 2025 and 2050. The results are used to compare the baseline scenario without climate change with two Shared Socio-economic Pathways (SSPs) (one with high population and less income growth and the other with low population and high income growth) and with two climate change scenarios. The results revealed that the production of

38


legumes in developing world has not been able to meet the demand due to secondary treatment of legumes in Asian countries and low input agriculture systems in Africa. With current technologies and support policies for legumes, the supply-demand gap will increase in the future with climate and farming system changes and the price of these crops will also increase which could have serious consequence on food and nutritional security in the developing countries.

OP03: Chickpea seed system and farmers’ commercial behaviour in seed: Actors, challenges and implications Bishaw Z1* and Alemu D2 1

International Centre for Agricultural Research in the Dry Areas (ICARDA), Addis Ababa, Ethiopia; 2BENEFIT, Addis Ababa, Ethiopia *Email: [email protected] This paper presents the seed commercial behaviour of smallholder producers considering along with the main characteristics of seed value chains of chickpea and key actors. It is based on primary data collected from 612 randomly selected chickpea producers from Amhara and Oromia regions covering 52% and 40% of total area allocated to chickpea nationally. The results of the commercial behaviour study indicated that 55.4% of the farmers were autarkic, did not engage in chickpea seed markets both as buyers or as sellers, whereas 22% used purchased seed, 11.4% sold seed, and the remaining 11.1% were engaged as both buyers and sellers. This implies that the formal seed sector can only target about 33% of chickpea producers who are in seed buying position. The results further indicate that the chickpea seed system is dominated by the informal sector, where only 1.91 thousand tonnes of certified seed was supplied for the 2017 production season. The weighted average age was 17.29 years for Kabuli and 17.55 years for desi varieties. These results imply the need to ensure adequate demand creation for recently released varieties and to influence the seed commercial behaviour and to incentivize to ensure engagement of more actors in the formal seed sector.

OP04: What are the strategies for the revitalization of the Moroccan legume sector? Fadlaoui A1*, Arrach A2, Al Balghitti A1, Dahan R1 and El Mourid M3 1

National Institute for Agricultural Research (INRA), Rabat, Morocco; 2Minister of Agriculture, Maritime Fisheries, Rural Development and Water and Forests (MAPMDREF), Rabat, Morocco; 3International Center for Agricultural Research in the Dry Areas (ICARDA), Rabat, Morocco *Email: [email protected] In Morocco, legumes have been the most important crops in the production system as well as in the food habits. However, recent investigations revealed that no progress has been made to expand the production of legumes. This research was aimed to create a vision of this sector in relation to agricultural policies and identify the determinants of supply and demand. The methodology adopted was based on the analysis of secondary data and interviews with the stakeholders along the value-chain. The review of agricultural policies revealed not only the absence of sector-specific

39


strategies but also identified perverse effects of the support measures to the competing cultures. The sector is characterized by the fragility of the structure of profession and the absence of the inter-profession. The production modes remained traditional and slightly mechanized. The agroindustry is still at the infant stage. Consumption of legumes is rather modest, undiversified, and seasonal. For the recovery of the sector, three areas of action were identified. The first is to improve the governance of the sector through creation of inter-profession and recognition of its specificity through a program contract. The second goal is to sustainably increase the profitability of the crop in the favorable zones through aggregation of projects and to guide the second pillar projects for preservation of natural resources. At the same time, food technology research should target the diversification of alternative uses of legumes. The last axis is to educate consumers about the nutritional benefits of pulse-based food products.

OP05: Legume seed systems for better livelihoods of smallholder farmers: Lessons from TL projects Ojiewo CO1*, Muricho G1, Desmae H2, Boukar O3, Mukankusi C4, Katungi E4, Gaur P5, Okori P6, Mwololo J6, Ajeigbe H7, Fatokun C3, Omoigui L3, Manda J8, Maereka E8, Arega A8, Mausch K1, Bodo R7, Beebe S9, Fikre A10, Kalemera S11, Rubyogo JC11, Akpo E1, Mponda O12, Kadege E12, Okello DK13, Nkalubo S13, Miningou A14, Batieno J14, Oteng-Frimpong R15, Mohammed R15, Sako D16, Diallo S16, Echekwu C17, Olufajo O17, Mekesha C18, Fenta B18, Chaturvedi S19 and Varshney RK5 1

ICRISAT Nairobi, 2ICRISAT Bamako, 3IITA Kano, 4CIAT Kampala, 5ICRISAT India, 6ICRISAT Malawi, 7ICRISAT Kano, 8IITA Malawi, 7CIAT Colombia, 10 ICRISAT Addis Ababa, 11CIAT Arusha, 12DRD Tanzania, 13NARO Uganda, 14INERA Burkina Faso, 15SARI Ghana, 16IER Mali, 17 IAR Nigeria, 18EIAR Ethiopia, 19IIPR India *Email: [email protected] Inadequate seed production and supply systems and limited access to high quality seed of improved varieties by distant smallholder producers are particular bottlenecks to adoption of improved varieties of legumes. Legumes seed sector does not attract heavy investment of the private-sector seed industry noticeable in some cereals and vegetables due to lower and more erratic sales volumes, largely because farmers have the option of using saved seed, besides other informal seed sources. Since 2007, ICRISAT, CIAT and IITA partnered with seed actors in 13 countries in Sub-Saharan Africa and Asia through the Tropical Legumes Projects (TLI, TLII and TLIII) to develop institutional and technical innovations to overcome these obstacles. Between 2007 and 2017, 657,582 t of certified and quality declared seed of 301 improved market–preferred varieties was produced by various project partners. About 15 seed production and delivery models for selected legume crops were tested. Areas of action included i) increasing total seed production and availability (e.g. through licensing decentralized production); ii) increasing access to highquality seed of improved varieties (e.g. through small packs, financial support and better coordination with extension or development programmes); iii) creating demand for quality seed (e.g. through value-chain support, demonstration trials, postharvest handling including seed, business training and market linkages); iv) reaching farmers ‘at last mile’ (bundling seed with other products, piggybacking on existing product supply channels such as fertilizers and pesticides

40


and also through strengthening community seed production approaches); and v) lowering costs of seed (e.g. through quality declared seed). More than 285,830 farmers have hosted project technology trials as part of the testing, release and demonstration of results. Adoption studies in target geographies revealed that farmers embraced the new varieties in target locations due to factors such as market access, superior returns and disease resistance besides spillovers through farmer-to-farmer seed exchanges. Extrapolation of data suggest that since 2007, project varieties have been grown on at least 2 million ha and generated more than US$ 976 million from project and partners’ investment while directly benefitting more than 10 million farmers. Every US$ invested in TL I, TL II and TLIII (US$ 73 million) has had US$ 13 - 20 return based on technology adoption and leveraging partnerships. Overall, substantial progress has been made but continuous and strengthened efforts are needed to enhance the delivery and dissemination of improved technologies and establish sustainable legumes seed system so that the productivity and production of legumes is increased thereby contributing to nutrition, health and income of smallholder farmers.

OP06: Role of extrinsic and intrinsic factors in the uptake of best agricultural practices among smallholder food legume farmers in Afghanistan Tavva S*, Mohammady, Akbarzai D, Habibi A, Saharawat YS and Swain N International Centre for Agricultural Research in the Dry Areas (ICARDA), Afghanistan Program, Kabul, Afghanistan *Email: [email protected] Despite the potential of agricultural innovations, their uptake by smallholder farmers in Afghanistan seems to be slow especially in food legumes resulting in continued large yield gaps. A three-year average yield gap of 142%, 65% and 129% for chickpea, lentil and mung bean, respectively, recorded (ICARDA CLAP-IFFVC Annual Report 2017) between participatory demonstration plots with improved varieties and best agronomic practices, and farmer plots with local varieties and local agronomic practices is indicative of this fact. Farmers’ decision to adopt new agricultural technologies is inﬂuenced by both extrinsic (age, literacy, family size, experience in farming, etc.) and intrinsic (attitude and perceptional score) variables. Taking into account both sets of variables, an attempt is made in this paper to understand the adoption process of best bet practices fo r food legumes in Kabul, Parwan and Logar provinces of Afghanistan using the data collected from a sample of 560 households with a structured questionnaire under IFAD funded project. Though farmers’ awareness was high about the technologies for the three crops across all provinces, adoption indices varied from 47% (mung bean) to 64% (chickpea and lentil) with differences across provinces after three years of technology demonstration. Lowest adoption in all three crops was estimated for farmers from Parwan followed by Kabul and Logar. Different extrinsic and intrinsic variables were identified influencing the adoption score of a farmer that need to be considered for fast uptake of technologies.

41


OP07: Trends and determinants of the adoption of improved chickpea varieties in Ethiopia Alemu D*1 and Bishaw Z2 1

BENEFIT, Addis Ababa, Ethiopia; 2International Center for Agricultural Research in the Dry Areas (ICARDA), Addis Ababa, Ethiopia *Email: [email protected] This paper presents trends in adoption of improved chickpea varieties by chickpea types (Kabuli and desi) along with its determinants, based on primary data collected in 2017 from 612 randomly selected chickpea producers from nine zones, 18 woredas and 38 kebeles from Amhara and Oromia regions, which cover 52% and 40% of the total area allocated to chickpea production in the country, respectively. Overall, 43% of the chickpea producers were full adopters, 9.5% partial adopters and the remaining 47.5% non-adopters. The overall adoption seems to be relatively high, which is associated with increased area under Kabuli chickpea production. All Kabuli chickpea producers (42.5% of the total chickpea producers) were users of improved varieties, whereas from the total 57.5% desi chickpea producing farmers, only 9.6% were full adopters where all plots of chickpea were planted with improved chickpea varieties and close to 1% are partial adopters where improved variety of chickpea was used in one of the chickpea plots. From among 11 Kabuli chickpea varieties released, farmers reported using only four varieties with dominant proportion by Arerti variety (57.7% of Kabuli chickpea producers). Of the 12 desi chickpea varieties released, eight improved varieties were preferred by the farmers, the dominant variety being Natoli with 7.7% of desi chickpea producers adopting it. The logit model estimates show that the key determinants for adoption of desi type chickpea are related with dependency ratio, number of chickpea plots managed, livestock ownership, access to market, and social capital related with cooperative membership.

OP08: Analysis of seed quality traits in chickpea (Cicer arietinum L.) population Båga M1, Wang R1, Gangola MP1, Irvine C1, Gaur PM2 and Chibbar RN1* 1

University of Saskatchewan, Saskatoon, Canada; 2International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Patancheru, India. *Email: [email protected] Grain produced by a desi chickpea (Cicer arietinum L.) population of 193 recombinant inbred lines derived from a cross between medium-protein ICC 995 and high-protein ICC 5912 was analyzed in the study. Seed shape (SS), 100-seed weight (100-SW), protein (PRO) and starch (STA) content in grain produced in four environments was determined. Genotype, environment and their interactions had significant (P 8) by all the age groups.

AB020: Impact of roasting on metabolic syndrome-related enzymes modulatory properties, anti-radicals and polyphenolics profile of cowpea pulse Irondi AE1*, Adegoke BM1,2, Ogunsanmi AO1, Ahmad RS1 and Boligon AA3 1

Kwara State University, Malete, Ilorin, Nigeria; 2Osun State Polytechnic, Iree, Osun State, Nigeria; 3Federal University of Santa Maria, Santa Maria, CEP 97105-900, Brazil; *Email: [email protected] Intake of whole legume pulses, including cowpea (Vigna unguiculata), has been evidently associated with lower risk of metabolic syndrome (MS), due to the presence of some bioactive secondary metabolites such as polyphenols. This study investigated the impact of roasting temperatures (150°C and 180°C for 20 min) on MS-related enzymes modulatory properties, antiradicals and polyphenolics profile of cowpea pulse. MS-related enzymes (pancreatic lipase, αamylase, α-glucosidase angiotensin 1-converting enzyme and xanthine oxidase) modulatory effects and antioxidant activities (2,2-diphenyl-2-picrylhydrazyl radical [DPPH*] and 2,2-azinobis (3-ethyl-benzothiazoline-6-sulfonicacid) cation radical [ABTS*+] scavenging activities, reducing power and Fe2+ chelating capacity) were assayed using spectrophotometric methods. Phenolic profiles of extracts of raw and roasted cowpea were characterized using high-performance liquid chromatography-diode-array detection (HPLC-DAD). Extract of raw cowpea strongly inhibited all the enzymes tested and displayed potent antioxidant activities. However, whereas the enzymes inhibitory effects of the extracts decreased, the antioxidant activities increased significantly (p < 0.05) as the roasting temperature increased. Raw cowpea contained phenolic acids (gallic and caffeic acids) and flavonoids (catechin, quercitrin, quercetin, kaempferol and apigenin); with caffeic acid and quercetin as the most abundant phenolic acid and flavonoids, respectively. The levels of these polyphenols decreased significantly (p < 0.05) with increasing roasting temperature. Hence, whole cowpea pulse may be beneficial for the management of MS through the inhibition

146


of the relevant enzymes; but roasting at higher temperatures may not be recommended for the optimum retention of this health benefit. AB021: Physico-chemical, cooking and nutritional quality of improved varieties of grain cowpea grown in Pantnagar, India Kushwaha A1*, Verma A2, Sharma SK3, Lohani U4, Kumar A5 and Singh YV6 1

Department of Foods & Nutrition, College of Home Science, GB Pant University of Agriculture & Technology (GBPUA&T), Pantnagar, India; 2State Nutrition Mission (UNICEF Project), Department of Community Medicine & Public Health, KGMU, Lucknow, India; 3Department of Food Science & Technology, College of Agriculture, GBPUA&T, Pantnagar, India; 4Department of Post Harvest Process, College of Technology, GBPUA&T, Pantnagar, India; 5Department of Plant Breeding & Genetics, Bihar Agricultural University, Sabour, India; 6Department of Vegetable Science, College of Agriculture, GBPUA&T, Pantnagar, India *Email: [email protected] Cowpea (Vigna unguiculata) is an inexpensive legume, with liberal amount of energy, protein, vitamins, minerals, dietary fibre and many phytochemicals favouring health. In contrast to conventional vegetable type, grain cowpea varieties are high yielding, early maturing, well grown and fit in rice-wheat cropping system in Uttarakhand, wherein lands are marginal with low productivity and agriculture is rain-fed. Although, legumes are main source of protein, unfortunately the protein is accompanied by anti-nutrients that reduce its quality and bioavailability. Therefore, varietal evaluation is essential before recommendation for a particular use. Considering this, five early maturing improved varieties (PL-1, PL-2, PL-3, PL-4 and PL-5) of grain cowpea developed at Pantnagar, aiming to increase per capita consumption of legumes in the state, were investigated for selected physico-chemical, cooking and nutritional quality attributes. Results revealed that 100-seed weight, hydration and swelling capacity were significantly higher for PL-5, followed by PL-1, depicting the boldness of seeds, with good cooking quality. Seed coat (2.73%) was least in PL-1, which also indicated good cooking quality. Significant difference was observed with respect to protein (23.95-29.7%); fibre (3.6-4.5%); phytic acid (195.2-211.6mg%) and tannins (0.51-0.84 mg%). PL-1 was also second highest in protein content (29.3 %) and had good protein digestibility, from grains point of view. However, the antinutrients were high in PL-1 variety, but these can be addressed by soaking and processing treatments. Therefore, PL-1 can be selected as a good choice or eating quality and development of value added products. AB022: Biofortification quandary associated with distribution pattern of iron accumulations in cowpea (Vigna unguiculata L. Walp) seeds Umar ML1*, Ishiyaku, MF1, Olufajo OO1, Boukar O2 and Fatokun C3 1 2

Institute for Agricultural Research (IAR), Ahmadu Bello University, Zaria, Nigeria; International Institute of Tropical Agriculture (IITA), Kano station; 3IITA, Ibadan, Nigeria;

*Email: [email protected]

147


Fortifying cowpea with essential elements such as iron (Fe) will improve the livelihood of its millions consumers especially women and children. This study was conducted to determine the distribution pattern of iron in cowpea seed and how it associates with seed sizes. Twenty-one cowpea genotypes were subjected to Atomic Absorption Spectrophotometry (AAS) analyses in the Multiuser laboratory, Ahmadu Bello University, Zaria, Nigeria in 2016. The mean iron concentration was unevenly stored in the 3 main parts of the seed: coat (43.32% = 2.88 mg/kg), Embryo (36.18% = 2.409 mg/kg) and cotyledon (20.50% = 1.365mg/kg). Seed size (100 seed weight) was negatively correlated with iron concentrations in the embryo. This indicates the quandaries that may be encountered when making a selection for high iron concentrations in cowpea seed and progress in fortifying cowpea grain with high iron concentrations and large seed size which is desired by most consumers. Similarly, seed coat weight was negatively correlated with iron concentration in the cotyledon (-0.0526) and embryo (-0.3314), implying that an indirect selection for high iron concentration should be avoided. However, the significant (P150 varieties have been developed. The last two decades have witnessed a shift in mungbean breeding objectives such as reducing crop duration, enhancing nutritional quality, introgressing disease resistance genes and increasing climate resilience which might have led to a change in its genetic architecture. In order to assess the change, genetic diversity and the population genetic structure of 41 elite lines developed in India during the last three decades were investigated using 80 mapped microsatellite markers. A total of 696 alleles were detected among the 41 lines with an average of 8.68 alleles per locus. Gene diversity ranged between 0.93-0.05 with mean of 0.68, and polymorphic information content ranged between 0.92-0.05, with mean of 0.66. Out of 80 microsatellites, 51 were found highly polymorphic with >0.60 PIC value and these were noticed as most informative. As a result of STRUCTURE analysis, three distinct genetic groups were identified and it was observed that mungbean breeding programme led to a clear-cut improvement in 100-seed weight, pod length, seeds per pod and plant height in elite lines developed after the year 2000. The grouping pattern was also supported by the factorial and UPGMA analysis. These microsatellites covering all 11 linkage groups proved useful to detect genetic variation and assess the progress in trait improvement in mungbean breeding programme.

AB070: Pea breeding programmes in the Czech Republic Dostalova R*, Ludvikova M, and Griga M Agritec Plant Research Ltd., Sumperk, Czech Republic; *Email: [email protected] In 2017 the Czech acreage cultivated with grain legumes was 43 800 ha which represents 1.7 % of the arable land. The most important grain legumes were peas (36 400 ha; 2.9 t. ha-1 average yield). The breeding aims to develop peas resistant to lodging, high protein content, green or yellow colour, round seed shape, low content of trypsin inhibitor activity, high content of resistance starch, of vitamins and carotenoids. Agritec holds a collection of pea genetic resources (1280 accessions) and a core collection of peas which was established by both morphological evaluation and DNA analysis. Molecular analyses were performed to speed the breeding process. eIF4E genes, or more precisely eIF4E (iso) corresponding loci sbm-1 (LG VI) and sbm-2 (LG II), mediating recessive resistance to several viral pathogens of the genus potyvirus (including PSbMV) were identified.

177


Alleles of eIF4E gene were identified in selected genotypes of pea, involving all PSbMV donors used in practice. Other methods for molecular marker tested were performed according to available publications. Molecular detection of resistance to powdery mildew, Fusarium wilt (race 1) and PEMV were carried out. Molecular detection of trypsin inhibitor activity was performed and results were compared with chemical analysis. Suitable materials with high levels of biological properties were used in the hybridization process to develop new varieties.

AB071: Performance of genetically modified disease resistant peas (Pisum sativum L.) in confined field trials for three years Kahlon JG1*, Jacobsen HJ2, Chatterton S3, Hassan F2, Bowness R4, Cahill JC5 and Hall LM1 1

Agricultural, Food and Nutritional Sciences, 410 Agriculture/Forestry, University of Alberta, Edmonton, AB, T6K 2P5 Canada; 2Institute for Plant Genetics, section of Plant Biotechnology, Gottfried Wilhelm Leibniz Universität Hannover, Herrenhäuser Str. 2, 30419 Hannover, Germany; 3Agriculture and Agri-food Canada, Lethbridge Research and Development Centre, Lethbridge, AB, T1J 4B1 Canada; 4Alberta Agriculture and Rural Development, Lacombe, AB, T4L 1W1, Canada; 5Department of Biological sciences, B717a, Biological Sciences Bldg. University of Alberta, Edmonton, AB, T6K 2P5 Canada; *Email: [email protected] Plant productivity can be greatly reduced by biotic and abiotic stresses, including fungal diseases. Biotechnological tools are available for enhancing tolerance against these stresses. In this project, antifungal genes (individual or stacked; previously transformed in pea in Germany) were tested for their field efficacy against hemibiotrophic pathogen, Fusarium root rot (Fusarium spp.) in Edmonton, AB, Canada in three years (2013-2015) of confined field trials. Transgenic lines with four antifungal genes (1-3 β-1,3 glucanase, endochitinase, polygalacturonase inhibiting proteins and stilbene), were tested in comparison with two parental German lines and three Canadian lines. In these confined field trials or three years, no consistent differences in pattern of superior emergence, higher fresh weight, lower disease ratings between transgenic lines in presence of pathogen inoculum were observed when compared to the parental and Canadian lines in the presence of pathogen inoculum. No indication of an advantage of stacked genes over single genes was observed. Most transgenic lines had lower relative gene expression in roots than leaves, suggesting the role of promoters chosen or silencing of genes. Due to concerns about unintended consequences on non-target organisms including beneficial soil associates, pea transformed with four antifungal genes were tested in confined field trials in 2013, these transgenic to determine the impact of disease tolerant pea or gene products on colonization by non-lines target did not show differences in root colonization by arbuscular mycorrhizae fungus, (AMF) and nodulation by Rhizobium. Transgene insertion, as single gene or stacked genes, did not alter root colonization by AMF or root nodulation by Rhizobium inoculation in the field. We found no effects of transgenes on the plant growth performance, although having a dual inoculant with both AMF and Rhizobium yielded higher shoot-to-root ratio in all the lines tested.

178


AB072: Identification and evaluation of pinto bean lines suitable for planting in low-input and sustainable agricultural ecosystems Ghadiri A1*. Moghaddam PR2, Bagheri A2, Ghorbani R2, and Beheshti A3 1

Markazi Agricultural and Natural Resources Research and Education Center, AREEO, Arak, Iran; 2Ferdowsi University of Mashhad, Iran; 3Khorasan Agricultural and Natural Resources Research and Education Center, AREEO, Mashhad, Iran; *Email: [email protected] In order to evaluate and identify Pinto Bean genotypes suitable for cultivation in low-input cropping systems, a series of studies were carried out between 2014 and 2015. In the first season, 559 genotypes with three controls including Cos-16, Koosha and Sadri were evaluated in augmented design under conventional and low input farming systems. To assess genotypes tolerance to low input conditions, mean productivity (MP), geometric mean productivity (GMP), stress tolerance index (STI), stress susceptibility index (SSI) and tolerance index (TOL) were calculated. Based on the results, under low-input farming systems, the average yield decreased at the rate of 45.5 %. Based on cluster analysis and factor analysis, 25 lines with greatest GMP and STI and lowest SSI and TOL were selected for further evaluation. In the second season, the same number of lines with three checks were tested at two locations in randomized complete block design with three replications under both farming systems. Low-input farming systems caused lower yield (-44.4%) and yield components including number of pods per plant (-25.2%), number of seeds per plant (-33.8%) and hundred seed weight (-9.4%). From this study, Pinto bean lines Cos-16, Ks-21184, Ks-21679, Ks-21413 and Ks-21354 with determinate bush growth type (type I) and Ks-21673, Ks-21451 and ks-21286 with indeterminate climbing growth type (type III) were selected for cultivation in low-input farming systems.

179


Theme 5 Biotic stresses and their management AB073: Evaluation of suppressive activity of four composts against Fusarium oxysporum f. sp. ciceris on chickpea Benejar N1,2*, Krimi Bencheqroun S2, Houmairi H1 and Kholtei S1 1

Université Hassan II, Faculté des sciences et technique, Settat, Morocco; 2Institut National de la rechercher Agronomique, Settat, Morocco; *Email: [email protected] Fusarium wilt (Fusarium oxysporum f. sp. ciceris) is one of the important biotic stresses of chickpea in Morocco. The aim of this study was to investigate the suppressive potential of four agronomic composts (poultry manure, cattle manure mixed with wheat straw and two commercial composts against Fusarium wilt of chickpea. In vitro studies showed that compost water extract suppressed the hyphal growth of F. oxysporum f.sp. ciceris compared to a biological agent Trichoderma harzianum. Microbial agents isolated from compost water extract also exhibited an antagonistic effect against the pathogen. Eleven bacteria isolated from compost were tested individually and showed variable growth inhibition from 9 to 54% against the pathogen. In glasshouse bioassay, the disease suppression with the soil amendment of different composts was evaluated in comparison with two fungicides. A significant effect of disease control was observed using seed treatment fungicides (Carbendazim and Difenoconazole + Fludioxonil) in reducing disease severity index by 58 %. However, the effect of compost application on disease suppression was not detectable. The results suggested the presence of several microorganisms in composts that can play a role in reducing soil-borne diseases of chickpea in which are difficult to be controlled by short term crop rotation and fungicide seed treatment.

AB074: Status of wilt and root rot diseases of Kabuli chickpea in some regions of Morocco Elbouazaoui A1, 2*, Maafa I2, Ahmed A1, Udupa S2 and Dioura A1 1

Ibn Tofail University Kenitra, Kenitra Morocco; 2International Center for Agricultural Research in the Dry Areas (ICARDA), Rabat, Morocco; *Email: [email protected] Kabuli chickpea is the most important temperate food legume in wheat based cropping system of Morocco. The area covered by the crop is over 88,000 ha in 2015-16 with a production of 44,000tons which is not enough to meet the demands of the population, a fact that pushed the country to import chickpea to fill the gaps. The low productivity of chickpea is partly due to diseases and insect pests. Major chickpea diseases are Ascochyta blight and wilt/root rot (WRR) affecting spring and winter planted crops causing high yield losses. Although WRR diseases are known to impact chickpea production in Morocco, knowledge on disease incidence, distribution

180


and pathogen associated with WRR complex are not well established. For this purpose, a survey was conducted in two regions of Morocco (Gharb and Saiss) covering 19 fields, to determine the distribution and importance of WRR. The results showed that WRR incidence ranged from 1-30% where the majority of the field had 10 to 20% disease incidence. Laboratory isolation revealed that the major pathogens associated with disease plants were Fusarium oxysporum f.sp. ciceris (59.8%), Rhizoctonia bataticola (32.7%) and R. solani (7.3%) and very low incidence of Pythium spp. These results showed the need to develop cultivars resistant to Fusarium wilt and dry root rot which are dominant in farmers' fields.

AB075: Response of seven Moroccan chickpea varieties to different Ascochyta blight pathotypes Krimi Bencheqroun S1*, Houasli Ch1, Belhaimer Z2, and Zouine S2 1

Institut National de la rechercher Agronomique, Settat, Morocco; 2Université Hassan II, Faculté des sciences et technique, Settat, Morocco; *Email: [email protected] Ascochyta blight (Ascochyta rabiei) is the most important foliar disease of chickpea worldwide that causes high yield and quality losses. High yielding chickpea varieties and resistant to Ascochyta blight are released in Morocco. However, the resistance can be overcome by the evolution of new virulent pathotypes of the pathogen. The purpose of this study was to determine the response of commercial Moroccan varieties for winter sowing against different pathotypes groups of A. rabiei to prevent resistance breakdown. Seedling of seven varieties (Bochra, Arifi, Douyet, Farihane, Moubarak, Rizki and Zahor) and a local susceptible cultivar were tested under greenhouse conditions using three pathotypes of A. rabiei (PI, PII and PIII). Significant difference was observed among chickpea cultivars for their reactions to the three pathotypes where the newly released. Bochra (FLIP 97-114C) showed resistance to all pathotypes with good agronomic traits like high yield and large seed size.

AB076: Screening chickpea genotypes for resistance to Fusarium wilt in Iran Mahmodi F*and Fatahi B 1

Dryland Agricultural Research Institute (DARI), Sararood Branch, Agricultural Research, Education and Extension Organization (AREEO), Kermanshah, Iran; *Email: [email protected] Wilt of chickpea caused by Fusarium oxysporum f.sp. ciceris is one of the most important diseases of chickpea (Cicer arietinum L.) in Iran. Resistant varieties would be the best way to control this disease. About 130 international and advanced chickpea genotypes were evaluated for FW resistance in Fusarium wilt sick plot in 2015. Each entry was planted in two rows of 3m length. Susceptible check (JG62) was sown after every two entries and disease score was done using a 1– 5 scale. The germplasm that scored 1– were considered resistant (R) (1 to 20%); 2– as moderately

181


resistant (MR) (21 to 40%); 3– as moderately susceptible (MS) (41 to 60%); 4 –as susceptible (S) (61 to 80%), and 5– as highly susceptible (HS) (>80%). The results showed that 52 lines were resistant and can be used in the chickpea breeding program. AB077: Genetic variability of Ascochyta rabiei affecting chickpea (Cicer arietinum L.) using trap nursery in Iran Mahmodi F1*, Ashrafi J2 and Khiergo M3 1

Dryland Agricultural Research Institute (DARI), Sararood, Agricultural Research, Education and Extension Organization (AREEO), Kermanshah, Iran; 2Golstan Agricultural & Natural Resources Research and Education Center, AREEO, Golestan, Iran; 3Ilam Agricultural and Natural Resources Research and Education Center, AREEO, Ilam, Iran; *Email: [email protected] Ascochyta blight (Ascochyta rabiei) is a devastating fungal disease of chickpea in Iran. Pathogenic variability of A. rabiei, was assessed using trap nursery from 2013-2017in different parts of Iran. The results showed that race 1 in Kermanshah, races 1 and 2 in Ilam, and races 4, 5 and 6 in Gorgan are dominant ones. High genetic diversity of isolates was observed in populations collected from Gorgan and chickpea genotypes should be exposed to these aggressive pathogen populations to identify promising sources of resistance.

AB078: Evaluation of chickpea genotypes for resistance to Ascochyta blight (Ascochyta rabiei) disease in the dryland areas of Iran Mahmodi F1*, Ashrafi J2and Kheirgo M3 1

Dryland Agricultural Research Institute (DARI), Sararood Branch, Agricultural Research, Education and Extension Organization (AREEO), Kermanshah, Iran; 2Agricultural and Natural Resources Research Center of Ilam, AREEO, Ilam, Iran; 3Agricultural and Natural Resources Research Center of Golestan, AREEO, Golestan, Iran; *Email: [email protected] Ascochyta blight (Ascochyta rabiei) is the most important disease of chickpea (Cicer arietinum L.) in Iran. The objective of this study was to evaluate 45 genotypes from international and local sources for resistance under natural infection in Kermanshah, Gonbad, and Ilam research stations. Each entry was planted in one row of 3m length. Susceptible check (ILC 263) was sown after every two entries as spreader-indicator and inoculated by scattering Ascochyta blight infected chickpea debris. Disease was recorded using a 1 to 9 rating scale. The results showed that genotypes showed differential reactions to the disease at the three stations indicating the existence of variability in the A. rabiei populations.

182


AB079: Viral diseases affecting chickpea crop (Cicer arietinum L.) in Sudan Moukahel AR1*, Kumari SG1, Adlan AH2 and Sharman M3 1

International Center for Agricultural Research in the Dry Areas (ICARDA), Terbol, Lebanon; Plant Pathology Research Program, Agricultural Research Corporation, Wad Medani, Sudan; 3 Department of Agriculture and Fisheries, Brisbane, Queensland, Australia; 2

*Email: [email protected] A survey was conducted to identify viruses affecting chickpea crops in different locations of Sudan (Gezera, Barber, Shendi, Hudeiba) during 2013 and 2015 growing seasons. A total of 204 samples with symptoms suggestive of virus infection (chlorosis, stunting, necrosis, yellowing, reddening) were collected from 14 fields. All samples were tested by tissue-blot immunoassay (TBIA) using polyclonal and monoclonal antibodies. The most common virus detected was Chickpea chlorotic dwarf virus (58.6% in 2013 and 88.7% in 2015). Only one sample was infected with Faba bean necrotic yellows virus. Whereas, 20% of the samples were infected with unknown Luteovirus species, and based on the serological tests, four Luteovirus isolate groups were identified using different specific monoclonal antibodies. All samples were further tested by Reverse transcription polymerase chain reaction (RT-PCR) using different Luteovirus primers followed by sequencing. Our study showed that Beet western yellows virus and Chickpea chlorotic stunt virus, important in West Asia and North Africa, were not detected in the Sudan. About 2-3 new Luteovirus species were detected from chickpea in Sudan. Further research is needed to unambiguously identify the Luteovirus species found in Sudan and compare the strains with others reported in the world. In addition, a long-term research plan is needed in order to manage the impact of viruses on chickpea.

AB080: Insecticidal activities of four essential oils of aromatic plants against the third instar Larvae of Helicoverpa armigera (Hub.) Rachid B1,2*, Lhaloui S1, Sabraoui A1, El-Fakhouri K1, Oubayoucef A1, Mesfioui A2 and ElBouhssini M1 1

Laboratory of Entomology, International Centre for Agricultural Research in the Dry Areas (ICARDA), Rabat, Morocco; 2Laboratory of Genetics, Neuroendocrinology and Biotechnology, Department of Biology, Faculty of Science. Ibn Tofail University, Kenitra, Morocco; *Email: [email protected] Aromatic and medicinal plants are rich sources of molecules, which present insecticidal activities against a huge number of insect pests. The present study investigated the insecticidal activities of four essential oils against third instar larvae of Helicoverpa armigera. Results pertaining to the experiment clearly indicated that the larvicidal activity of O. basilicum at 2.5% concentration caused 88% and 92% of larval mortality after 24 and 48h application respectively. M. veridis at 2.5% concentration, resulted 52% and 76% of larval mortality after 24h and 48h of treatment respectively. The topical application of O. basilicum at 2.5% concentration caused 80% of larval mortality after 24h of treatment. At 5% concentration, the morality was 90% and 100% at 6h and 24h after treatment, respectively. M. veridis at 5% concentration caused 80% and 100% of larval

183


mortality after 6h and 24h of treatment, respectively. E. globulus and T. vulgaris oils showed moderate larval mortality. The insecticidal activities of O. basilicum and M. veridis oils showed a great potential to be used in the control pod borer in chickpea.

AB081: Biocontrol effect of essential oils on the chickpea leaf miner (Liriomyza cicerina R.) in Morocco Sabraoui A1,3*, El Bouhssini1 M, Lhaloui S2, El Fakhouri K1, Boulamtat R1, Oubayoucef A1, and Bouchelta A3 1

International Center for Agricultural Research in the Dry Areas (ICARDA), Rabat, Morocco; Entomology laboratory, Regional Center for Agricultural Research, INRA, Settat, Morocco; 3 Plant Protection and Environment Laboratory, Moulay Ismail University, Zitoune, Meknes, Morocco; 2

*Email: [email protected] Chickpea leaf miner (Liriomyza cicerina R.) is one of the major flies damaging chickpea (Cicer arietinum L.) crop in North Africa and Mediterranean region. In spite of their drawback, chemical control using the synthetic insecticides mainly deltamethrin, abamectin, and cyromazine, commonly used to reduce infestations especially in spring. In this sense, looking for a safe and environmentally friendly alternative method to control leaf miner is highly important. Essential oils and plant extracts from Eucalyptus globulus, Melia azadirachta, Mentha pulegium, and Ocimum basilicum with and without biological adjuvant were used. The insecticidal activity of the essential oils was assessed in comparison with three commercial pesticides under greenhouse and field conditions. M. pulegium and E. globulus showed 100% mortality on leaf miner adults, at 33 μl/l, three hours after treatment. In addition, Melia azadirachta, M. pulegium and E. globulus gave 100% mortality on larvae leaf miner, six hours after treatment, with 33 µl/l, 50 µl/l and 83 µl/l air, respectively. In the field, foliar application of M. pulegium, M. azadirachta and E. globulus essential oils with adjuvant separately, confirmed 34%, 27% and 24% reduction of L. cecrina infestations respectively, compared to 50% reduction for abamectin. Furthermore, M. pulegium, M. azadirachta, E. globulus and abamectin, gave yield gains up to 27%, 25%, 22% and 34%, respectively compared to the untreated control. Essential oil compounds could be used to develop a new bioinsecticide as one of the IPM components for the control of chickpea leaf miner.

AB082: Advances in host plant resistance in chickpea (Cicer arietinum L.) and pathogenic variability in wilt and ascochyta blight causing pathogens Sharma M1*, Ghosh R1, Gaur PM1, Basandrai A2 Saxena DR3, Sirari A4 and Basandrai D2 1

International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Patancheru, India; CSK HPKV, Palampur, Himachal Pradesh, India; 3RAK Collage of Agriculture (RAKCA), Sehore, India; 4Punjab Agricultural University, Ludhiana, India; 2

*Email: [email protected]

184


The production and productivity of chickpea is severely curtailed by soil borne diseases [Fusarium wilt (FW, Fusarium oxysporum f sp ciceris), dry root rot (DRR, Rhizoctonia bataticola), collar rot (CR, Sclerotium rolfsii) and foliar diseases (Ascochyta blight (AB, Ascochyta rabiei), botrytis gray mold (BGM, Botrytis cinerea) in India. Among these diseases, wilt is most important but DRR and CR are emerging as a major threat in chickpea growing regions under changing climate. High temperature and low soil moisture stress favours DRR however reverse is true for CR. Sporadic occurrence of AB and BGM has been found under favourable climatic conditions. Well established phenotyping protocols are available for reliable screening and identification of resistant sources for these diseases. Continuous efforts are being made to identify stable and broad based sources of resistance through multi-location and multi-year testing at hot spot locations. Variability in disease incidence among the genotypes, environments and G x E interaction was found significant (P < 0.001) at multi-locations. GGE biplot analyses facilitated selection of genotypes with stable performance against FW (ICCVs 05527, 05528, 96818, ICC 11322), AB (ICCVs 04537, 98818, 05530) and BGM (ICCVs 96859, 96853, 05604, 96852). Significant advances have been made with respect to pathogenic variability in F. oxysporum fsp ciceris, and also pathogenicity mechanism is being explored through whole genome sequencing and transcriptomics. Efforts are underway to decipher the genetic similarity and races of Foc through re-sequencing of isolates which will serve as an additional resource to assist crop improvement efforts in chickpea.

AB083: Scotopic illumination and its role in entrainment of egg laying rhythm of Helicoverpa armigera (Hubner) in chickpea Tomar VS1, 2*, Verma R2 and Sarker A1 1

International Center for Agricultural Research in the Dry Areas-Food Legume Research Platform, Amlaha, India; 2RAK College of Agriculture (RVSKVV), Sehore, India; *Email: [email protected] Helicoverpa armigera (Hubner) is strong photopositive in nature and attracted towards the light sources during scotophase and photophase of night in different degree of attraction. Moon is the Major natural illumination that influences the response of nocturnal moth in present investigation to impact of moon phase on egg laying behavior of moth was assessed in chickpea experiment was conducted at ICARDA-FLRP, Amlaha during the 2014-16 cropping season. Impact of moon cycle is studied in ascending phase (No moon to full moon) and descending (Full moon to no moon) phase. Further ascending phase classified as waxing crescent (0-50%-disc illumination) and waxing gibbous (50-100%-disc illumination) likewise descending phase classified waxing gibbous (100-50% disc illumination) and waxing crescent (50-0% disc illumination). Egg laying pattern of moth was observed in every night in transparent and dark cage in field and compared the influence of changing moon light intensity and total dark on the egg laying behavior of moth. Results indicated that in ascending phase 11% reduction in egg laying was observed. Correlation was nonsignificant in waxing crescent, while it was negative significant in waxing gibbous(r=0.663) in descending phase hours of scotophase coincides with the early hours of night that increases gradually. Enhancing of egg laying 8.5 per cent and correlation was non-significant in transparent

185


and dark cages in waxing gibbous and waxing crescent. The present study would be helpful for prediction of larval population in the field.

AB084: Resistance to nematodes in chickpea Zwart RS*, Reen RA, Clewett TG, Sheedy JG, Owen KJ, and Thompson JP University of Southern Queensland, Toowoomba, Australia; *Email: [email protected] Plant-parasitic nematodes are important constraints to chickpea production, causing global annual yield losses in chickpea estimated at 14%. Nematode species recognized as causing significant economic damage in chickpea include root-knot nematodes (Meloidoygne artiella, M. incognita, M. javanica), root-lesion nematode (Pratylenchus thornei), cyst nematode (Heterodera ciceri) and reniform nematode (Rotylenchulus reniformis). Reduced functionality of roots due to nematode infestation leads to water stress and micronutrient deficiency. Thus, symptoms of nematode damage in chickpea roots are non-specific and not easily identifiable. Integration of resistant crops with appropriate agronomic practices is recognized as the most practical, safest, economic and effective control strategy for plant-parasitic nematodes. However, breeding for resistance to plantparasitic nematodes has numerous challenges that originate from the lack of resistance available in the cultivated chickpea (Cicer arietinum) gene pool. Progress in the identification of genetic sources of nematode resistance through screening modern cultivars, germplasm available in international genebanks, and wild Cicer relatives will be discussed, with a focus on the advancements that have made in breeding chickpea for resistance to P. thornei in Australia. While levels of resistance to M. artiellia, P. thornei and H. ciceri have been identified in wild Cicer relatives that are superior to resistance levels in C. arietinum, barriers to interspecific hybridization restrict the use of sources of nematode resistance to Cicer species belonging only to the primary gene pool (C. reticulatum and C. echinospermum). Recent advances in chickpea genomics will enable better targeting of molecular markers to desired resistance genes to accelerate introgression of superior nematode resistance into commercial chickpea cultivars.

AB085: Variation of faba bean genotypes to different Orobanche crenata biotypes in Egypt Abd-Elrahman R1*, Maalouf F2, Hamwieh A3, Attia SM1, Kader AA1, EL-Sayed Nassar ASM1, EL-Hassanien EL- Shirbini H1, Ibrahim HM1 and Kholousy AS1 1

Agriculture Research Centre (ARC), Field Crops Research Institute (FCRI), Giza, Egypt; International Centre for Agricultural Research in the Dry Areas (ICARDA), Terbol, Lebanon; 3 ICARDA, Giza Egypt; 2

*Email: [email protected] Faba bean (Vicia faba L.) is an important grain legume in East Asia and North Africa. faba bean productivity is severely affected by broomrapes. Resistant varieties to Orobanche have different responses to different Orobanche biotypes. The aim of this study was to evaluate the reactions of

186


different faba bean genotypes to five Orobanche populations collected from Sakha, Giza, Malawi, Sids and Shandaweel during 2012/13 and 2013/2014 seasons in Egypt. Two partial resistant varieties (Misr-3 and Giza-843) and one susceptible (Giza-3) were planted in infested soils with different Orobanche populations in randomized block design in early November for cropping 2012/2013 and in split plot design with two date of planting in first week of November and first week of December in 2013/2014 with two different treatments by glyphosate. Genetic relationships the five Orobanche population was estimated by Jaccard genetic distance using five ISSR markers. The results indicated significant differences among genotypes for their reactions to the different Orobanche populations and date of planting. The variety Misr3 showed high degree of resistance to all populations than Giza-843. The genetic distance of the Orobanche populations showed significant differences within populations but not among populations.

AB086: First record of natural enemies of faba bean Stem borer, Lixus algirus L. (Coleoptera: Curculionidae) in Morocco Ait taadaouit N1,2*, El Fakhouri K2, Sabraoui A2, Rohi L1 and El Bouhssini M2 1

Laboratory of Ecology and Environment, Faculty of Sciences Ben M'sik. University Hassan II of Casablanca, Cdt Driss El Harti Avenue, Sidi Othman, Casablanca, Morocco; 2International Center for Agricultural Research in the Dry Areas (ICARDA), Rabat, Morocco. The stem borer weevil, Lixus algirus L. (Coleoptera: Curculionidae), causes severe damage to faba bean (Vicia faba L.) in Morocco. This polyphagous insect is widely found in many parts of the world, particularly in Mediterranean areas. The biology and ecology studies of this weevil and associated host plants were conducted in the field at Douyet in Fez, Morocco during two seasons (2014/2015 and 2015/2016) under natural and cultivated habitats to determine their diversity at different stages of life cycle of this insect pest. From this field study, we report the first identification of four natural enemies (parasitoid and predators) of faba bean Stem borer in Morocco, two are egg parasitoids Chlorocytus lixi and Anaphes longicornis, one is an egg predator Orius sp., and the last is a larval parasitoid (Cyanopterobracon). The egg parasitism ranged from 57.3% to 63.1% for C. lixi, whereas larval parasitism ranged from 13.4% to 17.2% for Cyanopterobracon. These results showed that cultivated and natural environments harbor a diverse natural enemy community worthy of conserving for Stem borer biological control in Morocco.

AB087: Gene integration for developing resistance to Orobanche of Vicia faba L. Boumlik I 1,2, Diria G1, Gaboun F1, Iraqi D, Ibriz M2, and Abdelwahd R*1 1 2

Biotechnology Research Unit, National Institute of Agronomic Research, Rabat, Morocco; Faculty of Science Ibn Tofail, Kenitra, Morocco;

*Email: [email protected] Orobanche is an obligate holoparasite that attacks faba bean crop and causes severe economic losses. To overcome this problematic weed, the use of biotechnological tools can help to develop

187


parasite resistant crops. In this work, bacterial strain-genotype–polyamine interaction effect on genetic transformation via Agrobacterium tumefaciens was studied using two strains of Agrobacterium EHA101 and GV3101 both harboring the pBIBhyg vector containing sarcotoxin IA and hptII gene, co-cultivated with the explants of two cultivars Lobab and Defes on regeneration media with and without polyamine. Results revealed a high rate of resistant shoots with those inoculated in the presence of polyamine, and confirmation of the integration by molecular analysis is underway.

AB088: Effect of exogenous application of two elicitors on induction of systemic resistance in faba bean against Orobanche crenata Briache FZ1,2, Ennami M1,3, Mbassani Mansi J1,2, lozzi A3, Abousalim A3, Triqui Z2, and Mentag R1* 1

National Institute of Agricultural Research (INRA), Rabat, Morocco; 2Faculty of sciences, University Mohammed V, Rabat, Morocco; 3institute of Agronomy and Veterinary medicine Hassan II, Rabat, Morocco; *Email: [email protected] In Morocco, the parasitic weed Orobanche crenata represents a major biotic constraint to production of faba bean. As different control methods used proved ineffective, induction of host plant natural defence against this parasite constitutes a promising solution. The efficiency of two elicitors (A and B) was tested be soaking seeds of two faba bean genotypes (Lobab and Giza 843). The tests were done under field and controlled conditions. Results revealed that the most effective treatment coincided at the beginning or just before O. crenata infection. The elicitors reduced the infection by 75% on cv. Lobab and 66% in cv. Giza 843. This reduction was accompanied by the improvement of host development and yield. Moreover, both elicitors increased the level of chlorophyll and phenolic compounds, induced phenylalanine ammonia lyase (PAL), peroxidase (POX) and polyphenol oxidase (PPO) activities in faba bean roots. These results demonstrated that stimulation of plant defence, through the use of elicitors could be used an important strategy in Orobanche management. AB089: Assessment of post-harvest losses due to Bruchus rufimanus on faba bean and its control by fumigation of oil extracts in Morocco El-Miziani I1,2*, Lhaloui S1,2, El-Bouhssini M2 and Lamiri A3 1

Laboratory of Entomology, National Institute of Agronomic Research, Regional Center of Settat, Morocco; 2International Center for Agricultural Research in the Dry Areas (ICARDA), Rabat, Morocco; 3Superior School of Technology, Berrechid, Morocco; *Email: [email protected] Post-harvest losses remain the greatest concern of grain legume farmers in Morocco. The storage pests mainly Bruchids spp. are one of the most destructive pests which affect legume grain in storage. Commonly, their control is done using chemical pesticides that have a harmful effect on

188


humans, animals and on the environment. In order to avoid this effect and look for alternative methods a study was conducted to (i) identify Bruchids species affecting faba bean and (ii) assess their damaging extent and (iii) test bio-insecticidal activity of essential oil extracts. Two concentrations (10 and 20µl/l) of essential oil extracted from Mentha viridis, M. pulegium, Rosmarinus officinalis, Lippia citriodora, Thymus saturoides, Origanum compactum, Eucalyptus camaldulencis, Eugenia caryophyllus, Cedrus atlantica and Artemisia herba albawere used against adults of Bruchus rufimanus. The results revealed that more than 50% of the stored faba bean grain were infested by B. rufimanus leading to 33% weight losses and germination losses of 25%-33% and germination loss of 25%. The majority of the essential oils tested were highly toxic against the adults of B. rufimanus causing 100% mortality at both concentration.

AB090: Effect of Orobanche crenata infection on susceptible and resistant faba bean genotypes Ennami M1,2, Mbasani-Mansi J1, Briache FZ1, Gaboun F1, Oussible N2, Ghaouti L2, Belqadi L2, Ghanem ME3, Aberkani K4, Westwood J5 and Mentag R1* 1

CRRA, National Institute of Agricultural Research, Rabat, Morocco; 2Rabat, Agronomic and Veterinary Institute Hassan II- Rabat, Morocco; 3International Center for Agricultural Research in the Dry Areas (ICARDA), Rabat-institutes, Morocco; 4Faculty of Science and Technology- Al Hoceima, University Mohammed First, Morocco; 5Plant Pathology, Physiology and Weed Science- Blacksburg, VA, Virginia Tech, USA; *Email: [email protected] Orobanche crenata Forsk., a root holoparasitic plant, represents a major biotic constraint to faba bean, field pea and lentil production in the Mediterranean and West Asia regions. In this study, the effect of O. crenata on biomass production and partitioning of susceptible and resistant faba bean genotypes were investigated through pot assays methods. The experiment was repeated three times. During the first stage of infection, 53.8 and 27. 0% of reductions in host biomass were observed on both susceptible and resistant faba bean genotypes respectively. However, during the last stage of plant development, the biomass of the host and the parasite was not different compared to the control. Regarding biomass partitioning over the various host plant parts, the infection of O. crenata on susceptible genotype greatly increased host roots dry weight, maintained host vegetative parts, and delayed and reduced host reproduction. The strength of parasitic and host organ sinks revealed a marked decrease on root relative weight and increase of relative parasitic weight. Results suggested that faba bean -O. crenata interactions are governed by growth-defense tradeoffs during the early stage of infection, when source-sink relationship explains the dry weight diversion from host to parasite during the last phases of infection.

189


AB091: Effect of exogenous applications of micro- and macro-algae extracts in stimulating growth and induction of defense mechanisms against the parasitic weed (Orobanche crenata) on faba bean Soro GCL1,2, Mbasani MJ1,2, Triqui Z2, El Arroussi3 H, Wahby I2, and Mentag R1* 1

National Institute of Agricultural Research (INRA), Rabat, Morocco; 2Faculty of Sciences, Mohammed V University, Rabat, Morocco; 3Moroccan Foundation of Advanced Research Science and Innovation, Rabat, Morocco; *Email: [email protected] Faba bean (Vicia faba) is a major pulse crops grown in Morocco. It is a versatile crop which plays an important socio-economic and a strategic role in improving soil fertility and its structures. Significant decrease of faba bean cultivated area and production was observed during the last two decades due to parasitic weed problems (Orobanche crenata). Several control methods have been used but without complete success. The effects of micro- and macro-algae extracts on incidence and severity of O. crenata on susceptible faba bean genotype was evaluated under field and pot experiments. Impact on agro-morphological traits were assessed. Foliar application of micro-algae extracts at 1/600 ml reduced both O. crenata severity and incidence on faba bean plants under both conditions. A positive effect on the host plant growth was observed with both foliar application of micro-algae extracts at 1/600 ml, and macro-algae extracts at 2 ml/L. This control strategy could be confirmed at large scale to be used as one of the components integrated pest parasitic weed management strategy.

AB092: Identifying promising sources of quantitative resistance to Fusarium oxysporum f. sp. pisi in grass pea Sampaio AM1, Pereira PM1, Rubiales D2 and Vaz Patto MC1* 1

Instituto de Tecnologia Química e Biológica António Xavier (ITQB-NOVA), Avenida da República, 2781-157 Oeiras, Portugal; 2Instituto de Agricultura Sostenible, CSIC, Avenida Menéndez Pidal s/n, 14004 Córdoba, Spain; *Email: [email protected] Grass pea (Lathyrus sativus) is a promising source of protein in drought-prone areas, and an interesting alternative for cropping systems diversification in marginal lands in Europe. However, yield inconsistency due to sensitivity to specific diseases strongly limits its cultivation. Fusarium wilt, caused by the soil-borne fungus Fusarium oxysporum f. sp. pisi (Fop), is one of the most destructive diseases affecting pea (Pisum sativum) worldwide, and is now becoming a threat for grass pea production in Portugal. Variable responses to fusarium wilt under field conditions have been recorded previously among grass pea accessions. This supported the search for Fop resistance sources using an extended collection of grass pea accessions with representatives not only from the Iberian Peninsula but also from distant grass pea production regions in the world. Until now, 131 grass pea accessions were characterized under controlled conditions for Fop race 2 resistance. Disease rating over time and the area under disease progression curve revealed great variability

190


among the collection, with the identification of highly resistant to susceptible accessions. These results support also the existence of quantitative resistance mechanisms in our collection. To better describe these mechanisms, the fungus colonization extension was also characterized in the most contrasting accessions. This study represents the first steps on breeding grass pea varieties resistant to fusarium wilt and may, due to the phylogenetic closeness to pea, contribute as a resistance source to future pea improvement. Upcoming work will involve the unraveling of the genetic basis of resistance through genome wide association analysis.

AB093: Isolation, characterization and mapping of MLO1 in Lathyrus cicera Santos C1, Polanco C2, Rubiales D3, and Vaz Patto MC1* 1

Instituto de Tecnologia Química e Biológica António Xavier, Universidade Nova de Lisboa, 2780157 Oeiras, Portugal ; 2 Área de Genética, Dpto. Biología Molecular, Universidad de León, León, Spain; 3Institute for Sustainable Agriculture, CSIC, Córdoba, Spain; *Email: [email protected] The lack of function of the MLO (Mildew Locus O) gene has for long been associated with durable resistance to powdery mildew in barley and more recently in dicots (Arabidopsis thaliana, tomato and pea). As MLO genes had not been characterized in Lathyrus species so far, we searched for transcripts annotated as MLO1 on the Lathyrus cicera transcriptome. Lathyrus cicera MLO-like transcript sequences annotated as PsMLO1 (Pisum sativum) were aligned against MLO1 gene sequences of other legumes. Specific primers were designed to amplify the whole genomic sequence of LatMLO1 in two L. cicera genotypes, which have previously shown contrasting phenotypes to powdery mildew infection. LatMLO1 sequences were analyzed and compared for SSRs, SNPs, insertions and deletions between both L. cicera genotypes. Using a RIL population resulting from the cross of these two genotypes and using the previous identified polymorphisms it was possible to map LatMLO1 locus in an updated version of the L. cicera genetic linkage map. In general, high sequence conservation was observed between L. cicera and other legume species. However, for the first time 16 exons were found in legume MLO1 sequences. Characterization of LatMLO1 putative protein and domain organization, as well as its comparison with another legume MLOs will be presented.

AB094: Effects of arbuscular mycorrhizal fungi on agro-morphological and biochemical parameters of two faba bean and lentil cultivars under Orobanche crenata infestation Abdallah I1,2, Bouseber M1,2, Gaboun F1, Triqui ZEA2, Qaddoury A3, and Mentag R*1 1

National Institute of Agricultural Research (INRA), Rabat, Morocco; 2Faculty of Sciences, Mohammed V University, Rabat, Morocco; 3University Cadi Ayyad, Marrakech, Morocco; *Email: [email protected]

191


Plants are targets of several pathogens including parasitic plants that can be destructive. Orobanche crenata is a root hemi-parasite of certain legumes (faba bean, lentil and pea), it is a true agronomic scourge in the Mediterranean area because of its biological particularities which make it difficult to control. In fact, several control strategies have been developed, but only marginal successful. This project aimed to study the effect of arbuscular mycorrhizal fungi (AMF) on faba bean and lentil/O. crenata interactions using faba bean and lentil that are either susceptible or tolerant to O. crenata. Results showed that AMF reduced attachment, emergence and biomass of O. crenata. Stimulating defense mechanisms was correlated with the increase of three enzyme activities (POX, PPO and PAL). Differences in protection by AMF against O. crenata in both cultivars suggested that effect is plant genotype-dependent. AMF have increased plant height, root length and biomass of these two legume species.

AB095: Genetic diversity of Moroccan Orobanche crenata populations revealed by SequenceRelated Amplified Polymorphism Markers Ennami M1,2, Briache FZ 1, Mbasani-Mansi J1, Gaboun F1, Ghaouti L2, Belqadil L2 and Mentag R1* 1

CRRA, National Institute of Agricultural Research, Rabat, Morocco; 2Agronomic and Veterinary Institute Hassan II, Rabat, Morocco; * Email: [email protected] Orobanche crenata Forsk. is a root holoparasitic plant that affects legume species in Mediterranean basin. This parasitic weed is particularly problematic in faba bean (Vicia faba L.) and lentil (Lens culinaris Medik.) fields. In Morocco, development of legume resistant/tolerant genotypes is considered the most economical and ecological control strategy against O. crenata. Efficient selection of resistant/tolerant cultivars requires prerequisite knowledge of the genetic diversity of the parasite. Thus, the present study focused on the assessment of the genetic diversity among and within Moroccan O. crenata populations, growing in faba bean fields, using SequenceRelated Amplified Polymorphism markers (SRAP). This marker proved to be a powerful and an efficient tool for the evaluation of the genetic diversity among O. crenata populations. In fact, a total of 101 markers were identified and used for the Analysis of Molecular Variance (AMOVA), among which 98 bands were polymorphic (97.02%), indicating considerable genetic variation of these O. crenata populations. However, at population level, low level of polymorphic loci was observed with a percentage ranging between 41.58% and 67.33%. The Jaccard’s similarity coefficient and Principal Coordinate Analysis (PCoA) showed a clear differentiation among O. crenata samples according to the geographical origin of each population. AMOVA analysis revealed also a large extent of variation among O. crenata populations (60%; p < 0.010). Our outputs on molecular genetics of O. crenata combined with future epidemiological studies of these populations should clarify occurrence of O. crenata pathotypes and thereby validate the relevance of using multisite screening trials during breeding programs.

192


AB096: Black box and silver bullet approaches for holistic crop disease and soil health management under Indian condition Kumar K*, Kumar S, Rathore US and Mishra RK Division of Crop Protection, Indian Institute of Pulses Research, Kanpur (208024) *Email: [email protected] Soil is a fundamental and dynamic biological system providing life supports to plants, animals and microbes. Microbes indeed have proven themselves beneficial in plant growth, although many the community is phytopathogenic including fungi, bacteria, viruses and nematodes. Losses caused due to the pathogens pose agricultural, nutritional and economical loss in India. Concept of suppressive soils has been conceded for over 100 years and must be included in integrated pest management (IPM). Soils in which phytopathogens are unable to cause disease despite of favorable surroundings even after establishment, are termed as suppressive soils and managing the resident population of suppressive soil by means of good agronomic practices is known as ‘Black box’ approach. Deciphering the knowledge through polyphasic or molecular means from soils, whether suppressive or non-suppressive, will yield information about microbial diversity of suppressive soils as well as comprehensive understanding on pathogenesis from non-suppressive soils. Nutrient mining, imbalanced and overuse of chemical fertilizers have deteriorated the resident microbial population of Indian soils. Amending soils with application of specific strains of microorganisms as biocontrol agents is termed as ‘Silver bullet’ approach. Research showed effectiveness of single microbial inoculants in-vitro and limited efficacy in-vivo. Hence, proven bacterial and fungal strains could be utilized as potential biocontrol agents. Next generation agriculture must emphasize on plant probiotics having multi-trait properties, which can be appropriately introduced to IPM. Amalgamation of both traditional and modern scientific approaches is needed for soil and crop health management to make our agricultural land more productive.

AB097: Legume yellow mosaic viruses in grain legumes: diagnosis and their management Mohammad Akram*, Naimuddin and Pratap A ICAR-Indian Institute of Pulses Research (ICAR-IIPR), Kanpur, India; *Email: [email protected] Grain legumes are very important for both soil and human health and are grown worldwide. Viruses however, are major factors limiting production and productivity of these crops inflicting substantial losses and thereby reducing farmers’ income. Among them, legumoviruses belonging to the genus Begomovirus are very important and cause yellow mosaic disease (YMD) in more than 10 cultivated legumes and a number of wild Vigna accessions. Till date 11 legumoviruses infecting different leguminous hosts have been identified based on their unique genome characteristics. These viruses caused similar symptoms (yellow mosaic) in legume hosts. Hence, based on symptoms it is not possible to differentiate them. Breeding for resistance against legumoviruses requires precise identification protocol. Simplex and multiplex-PCR detection

193


protocols of four legumuviruses (MYMIV, MYMV, HgYMV and DoYMV) have been developed and are being used routinely. The association of MYMIV, MYMV, HgYMV and DoYMV with YMD in mungbean, urdbean, soybean, pigeonpea, dolichos, rajmash, horsegram, many wild accessions of Vigna and weeds has been confirmed. Management of YMD is mainly relied on resistant cultivars and use of chemicals for controlling the vector (whiteflies). Screening a large number of mungbean/urdbean genotypes against MYMIV at IIPR, Kanpur, resulted identification of many resistant genotypes. Using these, several improved varieties of mungbean and urdbean resistant to MYMIV have been developed and released for cultivation. Seed treatment with imidacloprid 17.8SL @5ml/kg and two foliar sprays with an insecticide (50% chlorpyriphos and 5% cypermethrin) @0.1% at 15 and 45 days old crop enhanced grain yield of mungbean.

AB098: Deletion mutation and subcellular localization of the protein encoded by βC1 gene of Cotton leaf curl Multan betasatellite. Tiwari N1, 4*, Jyothsna P1, 2, Sarker A4 and Malathi VG1, 3 1

Advanced Centre for Plant Virology, Division of Plant Pathology, Indian Agricultural Research Institute, New Delhi, India; 2Monsanto Research Centre, Bangalore, India; 3Tamil Nadu Agricultural University, Coimbatore, india;4International Centre for Agricultural Research in the Dry Areas, New Delhi, India. *Email: [email protected] Whitefly transmitted begomoviruses are one of the most important plant viruses causing severe leaf curl disease in tropical and subtropical region of the world. Begomoviruses have circular single stranded DNA genome of 2.7 kb in length and are found to be associated with betasatellite (1.3 kb). The betasatellite encodes only one ORF known as βC1 and is required to produce typical symptoms in the primary hosts. The βC1 gene is a pathogenicity determinant and a suppressor of post-transcriptional gene silencing. In this present work, the absolute requirement for βC1 expression to induce symptom phenotype was demonstrated by inoculation of Tomato leaf curl New Delhi virus (ToLCNDV) with βC1 deletion mutant of Cotton leaf curl Multan betasatellite (CLCuMuB). For the infectivity experiment, Partial tandem repeat constructs for DNA A component of ToLCNDV-[IN:Pun:JID27:08] and DNA β component of CLCuMuB-[IN:Sri:02] (wild and βC1 deletion mutation) were made and mobilized into Agrobacterium tumefaciens EHA105 for inoculation. Nicotiana benthamiana seedlings were inoculated and maintained at 28-30°C, 85% humidity and 8000 – 9000 lux. For the localization of the βC1 gene, GFP-βC1 fusion construct of CLCuMuB, was made under 35S promoter in a vector pAVA319. The construct was bombarded on epidermal cells of onion and the GFP expression was visualized using confocal microscopy. Inoculation of ToLCNDV with βC1 deletion mutant construct of CLCuMuB reveals that βC1 expression is absolutely required for symptom induction. Subcellular localization of CLCuMuB-βC1 reveals that the βC1 protein may have an important role in intracellular transport from the nucleus to the cell periphery.

194


AB099: Integrated pest management in lentil Ahmed S* International Center for Agricultural Research in the Dry Areas (ICARDA), Rabat, Morocco; *Email: [email protected] Lentil (Lens culinaris Medik) is an important food and feed crop in the small holder crop-livestock mixed farming in South Asia, East and North Africa, and a commercial crop in Australia and the Americas. The productivity of the crop is low in different regions due to biophysical and poor agronomic management practices. The major biotic constraints are fungal diseases (foliar and soil borne), insect pests (Aphids, Bruchids, Sitona weevil) and parasitic weeds. The economic importance of the biotic factors on lentil production and productivity varies from region to region. The major diseases are Ascochyta blight, rust, Stemphylium blight, anthracnose, wilt/root rot complex and viruses. Emerging diseases like downy mildew on early planted lentil crop under zero tilled condition in West Asia and collar rot in rice fallow in south Asia are becoming a threat for lentil production and its expansion under different cropping system and agro-ecologies. Currently, the major emphases are given to breed resistant cultivars to manage key lentil diseases and insect pests using cultivated and wild relatives. However, for some biotic constraints, sources of resistance are either limited or not existing in the germplasm pool. Therefore, developing integrated pest management (IPM) that combines cultural, host plant, minimal pesticide application and good agronomic practices are recommended. New sources of resistance are also required to manage multiple pests, aggressive pathogen populations, pests with wide host ranges and emerging pests through regional and international partnership.

AB100: Novel sources of resistance against rust and powdery mildew in wild Lens spp. Basandrai AK1*, Basandrai D2, Thakur MS3, Sarker A4, Rizvi AH4 and Kumar S5 1

CSK Himachal Pradesh Agricultural University (CSKHPAU), Palampur, India; 2Rice and Wheat research Centre, CSKHPAU, Malan, India; 3NBPGR, Regional Research Station, Phagli, Shimla, India; 4International Center for Agricultural Research in the Dry Areas (ICARDA); South Asia & China Regional Program (SACRP), New Delhi, India; 5Biodiversity and Crop Improvement Program, ICARDA, Rabat, Morocco; *Email: [email protected] Lentil is an important cool-season food legume grown in South Asia, North America, Southern Europe, North Africa, West Asia, Central Asia and Oceania. Among various constraints for low productivity, fungal diseases like Ascochyta blight, anthracnose, Stemphylium blight, wilt root rot, rust and powdery mildew take a heavy toll in different areas. In search of sources of resistance to rust and powdery mildew, 300 accessions of wild lentil species were evaluated during 2012-2013 and 2013-14 at a hot spot Dhaulakuan, Himachal Pradesh, India. Out of these 94 core collections, 18, 28, 7, 2, 22 and 18 accessions of Lens culinaris f sp orientalis (Lco), L. nigricans (Ln), L. tomentii (Lt), L. culinaris f sp culinaris (Lcc), L. ervoides (Le) and L culinaris f sp. odomensis (LCod), respectively were selected and re-evaluated under field and glass house conditions.

195


Accessions of Ln (ILWL 6, 9, 34, 37), Lt (ILWL 480) and Le (ILWL 269, 292, 321) showed combined resistance to rust and powdery mildew. Accessions ILWL117, ILWL35, ILWL436, and ILWL438 showed combined slow rusting and mildewing reactions which is an indication of partial resistance to the two diseases. The sources of resistance can be utilized as donors for transferring resistance genes against both the diseases.

AB101: Monitoring of lentil diseases planted under conservation agriculture in Morocco Bentata F1*, Moussadek R1, Abderabihi M1, Kissayi Kh3, El Aissami A2, Makhoukhi F4, Maafa I5 and Labhilili M1 1

INRA Rabat, Morocco; 2Faculty of Science of Rabat, Morocco; 3National school of forestry Salé, Morocco; 4National Centre of Scientific and National research Rabat, Morocco; 5 ICARDA, Rabat, Morocco; *Email: [email protected] Through time, the dominance of monocultures in the crop rotation had adverse repercussions on the ground (land degradation) and culture (increase in the incidence of diseases and pests) leading to the reduction of productivity of crops. Balance of cereal crop rotation with pulse crops like lentil shows its importance in recent years due to their agronomic, ecological and socio-economic interests. Moreover, zero tillage is an alternative to combat soil degradation caused by deep cultivations during dry seasons. Disease survey was done on lentil crops planted in conservation agriculture in 2014-15 cropping season in the region of Zaer. Farmers applied different fungicides (Tetraconazole-chloranthalonil; Thiophanate-méthyl mixed with Maneb; Mancozeb and Quarzate), to control lentil diseases. The major disease observed were rust and ascochyta blight. The effectiveness of different products differed from farmer. Since the season was dry, no significant difference observed for disease severity and yield for tillage and fungicide sprays.

AB102: Population dynamics and yield Loss assessment of lentil Aphid (Aphis craccivora Koch) El Bouhssini M, El Fakhouri K*, Sabraoui A and Lhaloui S International Center for Agricultural Research in the Dry Areas, Rabat, Morocco; Email: [email protected] The abundance of lentil aphid (Aphis craccivora Koch) and yield loss assessment of different lentil varieties (Abda, Bakria, Zaria) were investigated during the cropping seasons of 2015-2016 and 2016-2017 at Marchouch Station, Morocco. The population of Pea aphid appeared late at the end of March for the first year due to delayed rainfall and at the end of January for the second year. The maximum aphid population was recorded during second and third week of April in 2016. The higher aphid population was observed for Abda variety with an average of 27 and 25 aphids/20 twigs during 15 and 23 April, respectively. The Peak aphid numbers during 2016/ 2017 was recorded in the last week of March and early April. The highest aphid population was observed on

196


Zaria variety with an average of 25 and 27 aphids/20 twigs on 25 March and 01 April, respectively. However, numbers of pea aphids at the time of population peak did not differ significantly with the varieties for the two seasons, but the population dynamic of Pea aphid changed with weather conditions. Both Bakria and Abda varieties showed losses of the total grain yield during the first year (9% and 12% respectively). During the second year, varieties Zaria and Bakria showed yield losses of 5.5% and 9.3%.

AB103: Impact of fungicide management of the resurgence of lentil rust in Bangladesh Kamal MM*1, Sarker D1, Sahiduzzaman M2, Anower MB3 and Hossain M1 1

Pulses Research Centre, Bangladesh Agricultural Research Institute (BARI), Ishurdi, Pabna, Bangladesh; 2Regional Pulse Research Station, BARI, Madaripur, Faridpur, Bangladesh; 3 Regional Agricultural Research Station, BARI, Jessore, Bangladesh; *Email: [email protected] One of the challenges of lentil production is the control of rust (Uromyces vicia-fabae) in Bangladesh. The disease is increasing in severity in recent years and posing significant threat to the successful cultivation of lentil. The recommended fungicides like Tilt 250EC (Propiconazol) and Rovral 80WP (Iprodione) are not any more effective against the disease. The present study was conducted to search for new fungicides to manage the disease and reduce yield losses. Three fungicides, namely, Secure 600WG (Fenamidone & Mancozeb), Nativo 75WG (Tebuconazole & Trifloxystobin) and Folicur 430SC (Tebuconazole) were tested in three (Ishurdi, Madaripur and Jessore) locations during 2015-16, 2016-17 and 2017-18 cropping seasons. The result showed that Folicur treatment showed effective in controlling rust and will be used as IPM package to manage rust in Bangladesh.

AB104: Development of Bemisia tolerant marker free transgenics in Vigna spp. Rathore M*, Pandey P, Das A, Kushwah NS and Singh NP ICAR-Indian Institute of Pulses Research (IIPR), Kanpur, India; *Email: [email protected] Yellow Mosaic Disease (YMD) is the most destructive disease in pulses caused by Legume yellow mosaic viruses (LYMVs) and transmitted by whiteflies, Bemisia tabaci Genn. It leads to severe yield reduction in green gram and black gram in India, but also in Pakistan, Bangladesh and contiguous areas of South East Asia. Management of the disease is largely dependent on use of resistance cultivars, cultural practices and incessant use of insecticides that has rendered many whitefly populations tolerant to insecticides. As a result, the disease is still prevalent. Vector management is an avenue that has been less explored and functional breeding lines that confer tolerance/resistance against whiteflies are not available. Development of genetically modified marker free pulses with the ability to resist whitefly infestations is feasible strategy to work upon. In this context, the novel gene tma 12, isolated form the fern Tectaria macrodonta, insecticidal to

197


whitefly (LC50 1.49ug/ml) was chosen to develop marker free gene expression cassettes. tma 12 and nptII were independently sub cloned into the vector PRI201AN under the control of constitutive promoter CaMVE35 S for co transformation using the two vector system. It is assumed that introduction of these genes in black gram and green gram shall aid in management of whitefly transmitted diseases in the Vigna spp.

AB105: Molecular characterization of a virus causing yellow mosaic disease in urdbean (Vigna mungo L.) Saeed S*1, Ashraf S1 and Akram M2 1

Department of Plant Protection, Faculty of Agricultural Sciences, Aligarh Muslim University, Aligarh, India; 2ICAR-Division of Crop Protection, ICAR-Indian Institute of Pulses Research, Kanpur, India; *Email: [email protected] Yellow mosaic disease (YMD) transmitted by whitefly (Bemisia tabaci) is one of the most destructive diseases of urdbean and several other legumes. It causes significant yield loss of crop in India as well as many other Asian Countries. It has been reported that YMD in urdbean is mainly caused by two different virus species viz., Mungbean yellow mosaic India virus (MYMIV) and Mungbean yellow mosaic virus (MYMV). It is not known, which of them causes YMD in urdbean crop grew in Aligarh region of Utter Pradesh. Keeping in view an attempt was made to ascertain the identity of virus causing YMD in urdbean. During 2017, genotypes (n=25) of urdbean were grown in the field of Faculty of Agricultural Sciences, AMU, Aligarh, Uttar Pradesh. Typical symptoms of yellow mosaic were observed in many genotypes and processed for the characterization of virus involved in causing YMD. The abut primers specific to amplify DNAA(AC-abut5’GTAAAGCTTTACGCATAATG3’/AV-abut 5’AAAGCTTACATCCTCCAC3’) and DNA-B (BV-abut5’CCAGGATCCAATGATGCCT3’/BC-abut 5’ATTGGATCCTGGAGATTCA3’) of both viruses (MYMIV/MYMV) were used to get full length genome. The expected sizes of amplicons (2.6-2.7 kb) were obtained, which indicated the involvement of virus causing yellow mosaic disease in urdbean. Detection of DNA-β using specific primers (β01F5’AGCCTTAGCTACGCCGGAGC3’/β02R5’ GCTGCGTAGCGTAGAGGTTT3’) resulted negative amplification. These fragments were gel purified, cloned in pJET/1.2 blunt cloning vector and sequenced. The sequence analysis in blast of our samples revealed that both DNA-A and DNA-B had maximum nucleotide identity with respective DNA fragment of MYMIV, confirming that the YMD in urdbean is caused by MYMIV.

AB106: Diversity of Mungbean yellow mosaic virus resistance genes in mungbean (Vigna radiata) Schafleitner R*1, Douglas C2, Shwe T3, Alam AKMM4, Pratap A5, Gupta S5, Yen JY1, Breria CA1,6, Boddepalli VN7, Huang SM1, Lin JY1, and Nair RM7

198


1

The World Vegetable Center, Shanhua, Tainan 74151, Taiwan; 2 Department of Agriculture and Fisheries, Hermitage Research Facility, Warwick 4370, Queensland, Australia; 3Myanmar Department of Agricultural Research, Yezin 15013, Nay Pyi Taw, Myanmar; 4 Pulses Research Centre, Bangladesh Agricultural Research Institute (BARI), Gazipur 1701, Bangladesh; 5Indian Institute of Pulses Research (IIPR), Kalyanpur, Kanpur 208024, Uttar Pradesh, India; 6National Pingtung University of Science and Technology, Neipu Township 912, Pingtung County, Taiwan; 7 The World Vegetable Center South Asia, ICRISAT Campus, Patancheru, India; *Email: [email protected] Mungbean (Vigna radiata) is an important food and cash crop in the rice and wheat based farming systems in Asia. Short crop duration, low input requirement, high demand and the capacity to fix nitrogen make mungbean an ideal rotation crop for smallholder farmers. The major production constraint in many growing regions is yellow mosaic disease (YMD) caused by several Begomovirus species, mainly by Mungbean yellow mosaic virus and Mungbean yellow mosaic India virus. YMD tolerant lines have been developed by classical and radiation breeding. Stable tolerance to YMD across locations in India was found in line ML1628, while NM94 was tolerant only in East and South India and showed a susceptible reaction in Northern India. The observed differences in tolerance among the lines are most probably due to the presence of various virus strains. Quantitative trait locus (QTL) analysis for YMD tolerance in these two lines pinpointed loci on chromosomes 1, 3, 4, 5 and 9. The QTL on chromosome 1 was found in ML1628 only and apparently confers tolerance to various virus strains. Recently, additional YMD-tolerant material became available by multi-location screening of a mungbean mini core collection. Genome-wide association genetics indicated tolerance genes located on chromosomes 4, 6, 9 and 11 and on scaffold sequences that have not yet been integrated into the mungbean whole genome sequence. These results suggest that YMD tolerance is multigenic and is conditioned by different loci in different materials. Molecular markers associated with resistance are currently validated to be used for marker-assisted selection

AB107: Transgenic pigeon pea for Insect Resistance Management Alok Das*, Shukla A, Ansari J, Thakur S, Sujayanand GK, and Singh NP ICAR-Indian Institute of Pulses Research (IIPR), Kanpur, India; *Email: [email protected] Pigeon pea (Cajanus cajan L. Millisp.) is an important tropical grain legume and important constituent of dietary protein. Average annual loss in productivity of pigeon pea due to insect pest, gram pod borer (Helicoverpa armigera H.) hovers around 30-35%. Transgenic strategy employing Bt gene (cry1Ac) provides immense potential for resistance management. We report Agrobacterium tumefaciens (LBA4404) mediated genetic transformation of pigeon pea (cv. ICPL87119) and event characterization of the generated lines. Transgenic pigeon pea lines were generated with the insecticidal crystal protein (cry1Ac) driven by constitutive promoter, CaMV35S, employing pre-standardized direct organogenesis protocol, with transformation frequency ranging from 0.01-0.1%. Molecular analyses of the primary transgenic derived

199


progenies indicate presence and expression of Bt gene in the progenies. Expression of Bt-protein was observed in all plant parts (leaves, seeds, pod wall, flowers) across different developmental stages (pre-flowering and post flowering). Notably, expression in pre-flowering stage is higher as compared to post flowering stages. Detached leaf and whole plant insect (Helicoverpa larvae) bioassay of the transgenic pigeon pea lines indicate high larval mortality (80-100%). Five promising selected events are currently being evaluated in confined field trials at ICAR-Indian Institute of Pulses Research, Kanpur. This includes flanking sequence analyses, expression at various stages, agronomic performance and trait efficacy. Characterized pigeon pea lines can be used as potential donor in resistance breeding programme and can be effectively used in Integrated Pest Management.

AB108: Influence of wild relatives and cultigens on parasitism of pod borer Helicoverpa armigera (Hubner) larvae by Campoletis chlorideae Uchida on pigeon pea Jaba J1*, Nareshkumar B1, Mishra SP1 and Sharma HC2 1 2

International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Patancheru, India; Dr.YS Parmar University of Horticulture & Forestry, Nauni, Solan, India;

*Email: [email protected] The pigeon pea is major food legume crop after chickpea in Semi-Arid tropical (SAT) countries. It plays a vital role in food, nutritional security, and sustainable crop production. Several insect pests damage pigeon pea crop, among pod borer Helicoverpa armigera is major constraints for the sustainable production and productivity in SAT. Usage of insecticides are conventional practice for managing this pest but in recent days due to indiscriminate usage of insecticides lead to development of insecticide resistance of pod borer and also developing a negative impact on environment, natural enemies and soil ecosystem. The eco-friendly management of this pest by adopting larval parasitoid Campolits chlorideae, in order to increase the activity of parasitoid under natural ecosystem, there is need to study the behavioral response of pigeon pea accessions for host preference under lab conditions. The present study was carried on the host preference of parasitoid for wild relatives and cultigens of pigeon pea, the results were confounded that a significant difference in larval parasitization were observed on different pigeon pea accessions under no-choice, dual choice and multi choice cage conditions. Under no-choice cage conditions percentage parasitization was maximum on ICPW 159 (44.0%) followed by ICPL 87 (42.6%), ICPL 84060 (36.9%); Dual choice ICPW 159 (43.3%) followed by ICPL 87 (40.0%) and multi choice ICPW 159 (48.3%) followed by ICPL 87 (46.66%) and least parasitization were observed for ICPW (17.4 %); ICPL 332WR (20.0%) and (23.3%) respectively under no-choice, dual choice and multi choice conditions.

200


Theme 6 Agronomy, physiology, and abiotic stresses AB109: Water stress effect on growth, yield and water use efficiency of alfalfa in Tadla, Morocco Bouazzama B1*, Sabri A2, Bouaziz A3, Xanthoulis D4, and Benbati M.1 1

Centre Régional de la Recherche Agronomique de Tadla, INRA, Beni Mellal, Morocco; 2Centre Régional de la Recherche Agronomique d’Errachidia, INRA Errachidia, Morocco; 3Institut Agronomique et Vétérinaire Hassan II, Rabat, Morocco; 4Université de Liège Agro-Bio Tech, Gembloux, Belgium; *Email: [email protected] This study was conducted from 2008-2012 cropping seasons with the aim to study the effect of water deficit on alfalfa productivity in the irrigated perimeter of Tadla. Under flood irrigation, four water regimes (100%, 80%, 60% and 40% ETc) were compared. Under drip irrigation, the same regimes were associated with spacing between ramps (50 cm and 75 cm). Observations were made on soil, root system and dry biomass at each cut. The results showed that the average biomass yield was 23.2 t ha-1. The contribution of the spring cycles to annual yield varies from 55% under 100% ETc to 65% under 40% ETc. in addition to the amount of water, alfalfa productivity depended on water applied within a cycle. The water use efficiency varied from one cycle to another and between seasons. Drip irrigation resulted similar biomass yield with flood irrigation where the former save water and improved agronomic efficiency.

AB110: Mitigating abiotic stresses and improving yield of chickpea (Cicer arietinum L.) by foliar application of Salicylic acid Basu PS1*, Chaturvedi SK1, Gaur PM2, Kumar S3 and Singh NP1 1

Indian Institute of Pulses Research (IIPR), Kanpur, India; 2International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Patancheru, India; 3International Center for Agricultural Research in the Dry Areas (ICARDA), Rabat, Morocco; *Email: [email protected] Terminal drought and heat stress during reproductive stage are serious threat limiting grain yield of chickpea. Besides introducing genetically tolerant cultivars, it is also important to explore mitigation options to minimize the detrimental effects of heat and drought and improve yield. These stresses primarily inhibit photosynthesis, accelerates chlorophyll degradation, disturb hormonal regulation, impairing ion transport and directly or indirectly affect metabolic activities. An experiment was carried out using two chickpea varieties DCP 92-3 (drought and heat sensitive) and ICCV 92944 (heat and drought tolerant). Both the varieties were subjected to drought (without irrigation) and under irrigation (no stress). While another set of experiment was carried out by

201


planting in normal sowing and delayed sowing so that plants were naturally exposed to high temperature (>350C) during flowering and podding. Foliar spray of salicylic acid, SA @500 nmol strength were applied over plants exposed to drought and heat (late sown plants) during flowering period and repeated every week till maturity. High temperature > 380C induced pollen sterility while drought did not have any effect on pollen fertility. Salicylic acid enhanced photosynthesis, transpiration, ion uptake, water retention capacity, antioxidant activity, chlorophyll, nitrogen balance index, anthocyanin & transport and induced specific changes in leaf anatomy, chloroplast structure and pollen fertility. Sensitive variety DCP 92-3 was more responsive to salicylic acid than tolerant variety ICCV 92944. SA acts at cellular level to modify some anatomical, physiological and biochemical processes which are helpful for mitigating abiotic stresses and improving grain yield by 15-20% in chickpea.

AB111: Efficacy of some herbicides against winter chickpea weeds in Sais Belmalha S1, El bardi A1, El Hamel A2 and Boulif M1 1

Ecole Nationale d’Agriculture de Meknès, Département de Protection des Plantes et de l’Environnement BP. S 40 Meknès, Morocco; 2Centre Régional de la Recherche Agronomique de Meknès, Morocco ; *Email: [email protected] This experimental study was conducted to evaluate several strategies for chemical weed control in winter planted chickpea. Winter chickpea planting coincides with the rainy season when weeds are very abundant. During this period, chickpea growth is relatively slow and make it very vulnerable to weed competition which induces high yield losses and poor adoption of winter planting. In this context, this study aims to evaluate the effectiveness of pre-emergence or postemergence herbicides to control weeds in winter planted chickpea. The field trial was conducted at the Research Farm of the National School of Agriculture of Meknes, during 2016-2017. Preemergence treatments provided good weed control and the combination of the active ingredients Linuron + Acetochlor + Furilasole doses of 1.5 l/ ha gave better weed control.

AB112: Genotype selection and integrated weed management for chickpea production in organic farming Chen C1*, Miller, Z2, Mohammed Y1, and Walia M1 1

Eastern Agricultural Research Center, Montana State University, Sidney, MT, USA; 2Western Agricultural Research Center, Montana State University, Corvallis, MT, USA; *Email: [email protected] The primary challenges to growing chickpeas (Cicer arietinum) in organic system are pest management, because synthetic fungicides and herbicides are prohibited. Two field trials combined two varieties (Black chickpea and CDC Orion), two seeding rates (1.0x and 1.5x), and two pre-emergent weed control practices (flame weeding and shallow tillage) were carried out at

202


EARC and WARC. We evaluated the efficacy of the treatments on stand densities and weed biomass early in the growing season, and final yields. Increasing seeding rates consistently increased yields. The black chickpea variety had consistently higher stand densities and yields relative to the CDC Orion possibly due to higher vigor and resistance to soil borne disease. Flame weeding was not effective at either reducing weed biomass or increasing chickpea yields. Shallow tillage did increase yields and reduce weed biomass although effects on yields and weed biomass depended upon timing of application. In 2017, tillage was applied late when chickpeas were just starting to emerge and resulted in reduced crop stands but also reduced weed biomass. Results suggest that competitive varieties, increasing seeding rates, and shallow tillage can be successfully integrated to improve yields and reduce weed pressure in organic chickpea, but efficacy of shallow tillage depends strongly on proper timing and is affected by planting date and weather conditions. Additional greenhouse and field trials were carried out in 2016 and 2017 to evaluate seedling vigor, biomass accumulation, and seed yield of 20 breeding lines and 5 commercial varieties of chickpea. Several promising genotypes/varieties have been identified for organic production.

AB113: Evaluation of six no-till seeders for successful crop establishment under wheatchickpea-wheat crop rotation in arid land of Morocco El Aissaoui A*, Al Masmoudi Y, Gharras O, and Boutfiras M Arid Land Center, National Institute of Agricultural Research (INRA), Settat, Morocco; *Email: [email protected] Conservation agriculture (CA) is a sustainable farming system to improve productivity and preserve the environment. The aim of this study was to assess the performance of six zero tillage brands (one with double disc openers and five with tyne openers) for crop establishment of wheat and chickpea under three years crop rotation (Wheat-chickpea-wheat) on vertisol conducted under no-till for 15 years. Performance evaluation was based on measurements of seeding depth (cm), emergence (%), root length (cm), height of plant stem (cm), weight of root stem (g), number of plants / linear meter and vigour. The results showed that seeders with tyne openers performed better than double disc openers on emergence exigence of deeper seeds deposition with presence of a significant amount of rainfall recorded during installation period of the first and second season. The disc opener showed better performance as the climatic conditions of the third cropping season was dry during installation period. The disc performance was due to superficial seed deposition for successful emergence in low soil water content. Results showed also that tyne openers fit exigence to depose chickpea seeds in adequate depth for better crop establishment and safe development in rainfed cropping system. Hoe openers can be of importance in dry soil condition according to its ability to act and to create adequate seed bed in hard soil. In the Moroccan arid land context, it is preferable to choose seeders equipped with hoe openers as there is a requirement for deposing seed as deep as possible to safely ensure its germination and plant emergence without any effect of randomized soil moisture change in rainfed based cropping system.

203


AB114: Effect of three rates of Bentazon herbicide on nodulation and growth and nodulation of chickpea Hajjaj B* and El Mourabit N National Institute of Agronomic Research (INRA), Tangier, Morocco; *Email: [email protected] A trial was conducted at INRA Tangier-Boukhalef during 2016 growing season. The aim of the investigation was to see the effects of three rates of Bentazon (480 g/ha, 720 g/ha and 960 g/ha) on the growth and nodulation of chickpea. Results showed that the selectivity of chickpea and the number of nodules varied according to the applied rates. Bentazon applied at 720 g/ha and 960 g/ha affected growth of chickpea and decreased the number of nodules by 37% and 74%, respectively. Bentazon applied at 480 g/ha was relatively selective for chickpea with a small reduction in the number of nodules by 78% compared to the control. AB115: Drought Stress and Rhizobium Nodules Interactions in chickpea Istanbuli T, Tawkaz S, and Hamwieh A* International Center for Agricultural Research in the Dry Areas (ICARDA), Terbol, Lebanon; *Email: [email protected] Two hundred four genotypes of chickpea were assessed for various nodule characteristics and morphological traits under two environments, irrigated (well watered) and rain-fed (water stressed). The field experiment was conducted in the dry seasons of 2015-2016 and 2016-2017 at two sites (Terbol and Kfardan in Lebanon) in alpha lattice design with two replications. Three parameters (nodule mass (m3), nodule fresh and dry weight (g), were collected to assess the Rhizobium nodulation, and four other traits (plant height (cm), grain yield (g), biological yield (g) and 100-seed weight (g) were measured. The genotypes were scored for drought tolerance using a drought tolerance score (1-9 scale). Ten genotypes were considered as drought tolerant (