virus strain mac chimeric viruses having vpr and/or nef of different parental ..... The nucleotide numbers given are from GenBank data base (accession numbers ..... Summary of virus recovery* and virus loadst of monkeys infected with NM-3rN.
Journal of General Virology (1995), 76, 2181-2191.
2181
Printed in Great Britain
Construction of human immunodeficiency virus 1/simian immunodeficiency virus strain mac chimeric viruses having vpr and/or nef of different parental origins and their in vitro and in vivo replication Takeo Kuwata, Tatsuhiko Igarashi, Eiji Ido, Minghao Jin, Akiko Mizuno, Jiangli Chen and Masanori Hayami* Institute for Virus Research, Kyoto University, Shogoin-kawahara-cho, Sakyo-ku, Kyoto 606, Japan
We constructed a series of human immunodeficiency virus 1 (HIV-1)/simian immunodeficiency virus strain mac (SIVmac) chimeric viruses having vpr and/or nef genes of either HIV-1 or SIVmac based on a chimeric virus with LTRs, gag, pol, vif and vpx derived from SIVmac and tat, rev, vpu and env from HIV-1. All of the chimeric viruses replicated in human and macaque peripheral blood mononuclear cells (PBMCs) and in several CD4 + human cell lines, though their growth potentials were slightly different depending on whether vpr and nef were from HIV-1 or SIVmac, or were defective. The presence of nefaccelerated replication in all the cells used and the replication of each chimera appeared to reflect that of the parental virus from which nefwas derived. The presence of vpr had no clear effect
in human and monkey PBMCs, but the replication of each chimera was influenced by the origin of vpr in H9 and A3.01 cells. NM-3rN, which carries HIV-1 vpr and SIVmac nef was inoculated intravenously into three rhesus monkeys, three cynomolgus monkeys and two pig-tailed monkeys. From 2 to 14 weeks after inoculation, viruses were consistently re-isolated from all the monkeys and virus loads were as high as that of SIVmac reported previously. The results indicate that infection with NM-3rN is more efficient than any of our previous chimeric viruses and suggest that NM-3rN, having HIV-1 Env, will be a useful challenge virus for evaluating AIDS vaccines based on HIV-1 Env in macaque monkeys instead of chimpanzees.
Introduction
use. Some SIV strains of SIVmac, SIVmne and SIVsmm are known to cause a fatal disease in macaque monkeys similar to human AIDS (Letvin et aI., 1985; Benveniste et al., 1988; Fultz et al., 1989). Thus, macaque monkeys infected with these pathogenic SIVs are now considered to be the most appropriate system for studying AIDS pathogenesis. Nevertheless, the immune response to SIV envelope glycoproteins has been reported to be different from that in the case of HIV-1 (Weiss et al., 1986). Thus, for developing anti-HIV-1 drugs and vaccines and evaluating their efficacy and safety, a new animal model that utilizes the HIV-1 genes would be of value. To establish a useful experimental infection system using HIV-1 and macaque monkeys, we previously generated two HIV-1/SIVmac chimeric viruses. One of these, named NM-3 (Shibata et al., 1991) contained tat, rev, vpu and env of HIV-1 (NL432) and LTRs, gag, pol, v/f and vpx of SIVmac (MA239) and the other, named NM-3n (Igarashi et al., 1994) contained n e f o f HIV-1 in addition to the genome structure of the former chimera. Two cynomolgus monkeys (Macaca fascicularis) each were infected with NM-3 and with NM-3n, but in each
Human immunodeficiency virus 1 (HIV-1) can infect only a limited range of animal species other than humans, such as chimpanzees (Pan troglodytes) (Alter et al., 1984; Fultz et al., 1986; Gajdusek et al., 1985; Nara et al., 1987) gibbons (Hylobates lar) (Lusso et al., 1988) pigtailed monkeys (Macaca nemestrina) (Agy et al., 1992), SCID-hu mice (Leonard et al., 1988) and rabbits (Filice et al., 1988). Chimpanzees infected with HIV-1 are the currently favoured animal model of HIV-1 infection. However, a limitation of this system is that HIV-1 does not induce AIDS-like symptoms in infected chimpanzees even during long observation periods. Simian immunodeficiency viruses (SIVs) are closely related to HIV-1 and HIV-2 and can infect macaque monkeys, which are readily available for experimental
* Author for correspondence. Fax +81 75 761 9335. e-mail mhayami @ virus.kyoto-u.ac.jp 0001-3187 © 1995 SGM
2182
T. Kuwata and others
case infection resulted in induction of a carrier state in only one monkey. In addition, one rhesus monkey (Macaca mulatta) each was infected with NM-3n or with the recovered virus from the NM-3n-infected cynomolgus monkey, and in each case infection resulted in induction of a carrier-state. None of the animals, however, showed any clinical symptoms. (Sakuragi et at., 1992; Igarashi et at., 1994). The results indicate that these chimeras were still not suitable for practical use and that a more efficient infection system was required. Recently, the importance of both the vpr and nefgenes of SIVmac for viral pathogenesis in rhesus monkeys was reported (Kestler et al., 1991 ; Lang et al., 1993). For the construction of NM-3 and NM-3n, viral genomes from two different origins were joined using restriction enzyme sites within the vpr and nefgenes and consequently NM3 did not have intact vpr and nefwhereas NM-3n did not have intact vpr. The lower infectivity and absence of pathogenicity of these chimeric viruses might be due to defects in vpr a n d / o r nef. Therefore, in this study, we modified the genetic structure o f the former chimeras to generate a new series of HIV-1/SIVmac chimeric viruses containing various combinations of intact vpr a n d / o r nef from either HIV-1 or SIVmac and demonstrated that one of the new chimeras infected macaque monkeys very efficiently.
Methods DNA constructs. The infectious molecular clones NL432 (HIV-1) (Adachi et al., 1986), MA239 (SIVmac), NM-3 (Shibata et al., 1991) and NM-3n (Igarashi et al., 1994) have been described previously. To generate new chimeric viruses, we first produced several plasmids with various combinations of junction sequences. To create an MA239 vpx/HIV-1 vpr junction sequence, for example, we constructed a plasmid called pPR-57 as follows. First, part of the genome of MA239 [SacI (nt 5755) to XbaI (nt 6439)] which carries SIVmac vpx was subcloned into pUC119 and part of NL432 [KpnI (nt 4154) to SalI (nt 5785)] which carries HIV-1 vpr was subcloned into pUC18. Subsequently, the sequence of MA239 vpx was modified by PCR mutagenesis to have a SpeI site near the Y terminus of its gene using a reverse primer 5' AT ACTAGTCCTGGAGGGGGAGGAGGAGG 3' (nt 6148-6121 of MA239) and an M13 reverse primer. Similarly, the sequence of pNL432 vpr was modified to introduce an NheI site near the 5' terminus of the gene using a forward primer 5" GAGCTAGCATAAATGGAACAAGCCCCAGAAGACCAAGGGCC 3' (nt 5547-5587 of NL432) and an M13 reverse primer (underlined nucleotides are the changed ones). The two PCR products were then ligated and subcloned after digestion with SpeI or NheI (since both SpeI and NheI produce the same cohesive ends) and appropriate restriction enzymes, yielding the junction plasmid pPR-57 [see Fig. 1 b (i)]. To generate NM-3r, which carries the intact HIV-1 vpr downstream of SIVmac vpx (Fig. 1 a) the junction fragment was excised from pPR-57 and inserted into the corresponding position of NM-3. To create an SIVmac vpr/HIV-1 tat junction sequence [see Fig. 1 b (ii)] we constructed a plasmid called pPR-91011. A KpnI-PvuII (nt 5771-6622) fragment of MA239 and an EcoRI-HindIII (nt 5743 6026) fragment of NL432, which carry SIVmac vpr and HIV-1 tat, respectively, were subcloued into the corresponding sites of pUC18.
The sequence of MA239 vpr was changed by two-step PCR to have a modified splicing acceptor and an initiation codon for MA239 tat. The first PCR was performed using a forward primer 5' GGTAATCATATCTATAATCGACACGGAGAC Y (nt 6280-6309 of MA239) and an M13 forward primer and a reverse primer 5' CTCCCTCAAGGGTGTCTCCGTGTCGATTATAG 3' (nt 6322-6291 of MA239) and an MI3 reverse primer. The second PCR was performed using two products of the first PCR. Meanwhile, the sequence of NL432 tat was modified to introduce an SphI site near the 5' terminus of the gene using a forward primer 5' GCGCATGCTATAAGAGGAGAGCAAGAAATGGAGCCAGTAG 3' (nt 5803-5842 of NL432) and an M13 forward primer. The two PCR products were then ligated and subcloned after digestion with SphI (nt 6446 of MA239) and appropriate restriction enzymes, yielding the junction plasmid pPR91011. Care was taken in the codon selection not to cause any amino acid substitutions in MA239 vpr by incorporated mutations. To generate NM-3R, which carries the intact SIVmac vpr upstream of HIV-I tat (Fig. 1 a), the fragment was excised from pPR-91011 and inserted into the corresponding position of NM-3. To create an HIV-I env/SIVmac nefjunction sequence [see Fig. 1 b (iv)] we constructed a plasmid called pPR-12. First, the stop codon in the middle of nef(codon 93, nt 9353) of MA239 was changed by PCR mutagenesis from a stop (TAA) to a Glu (GAA) codon. Then, a BamHI-SacI (nt 8465-9562) fragment of NL432 which carries HIV-1 env was subcloned into pUC119 and an NheI-PvuII (nt 8742-9294) fragment of MA239/nef-open which carries SIVmac nefwas subcloned into pUC18. The sequence of the NL432 env was modified by PCR to introduce an EcoRV site near the 3' terminus of its gene using a reverse primer 5' CAGATATCTTATAGCAAAATCCTTTCCAAGCC 3' (nt 8793-8762 of NL432) and an M13 reverse primer. The sequence of MA239 nefwas modified to have a Sinai site near the 5' terminus of the gene using a forward primer 5' AACCCGGGTGGAGCTATTTCCATGAGGCGGTC 3' (nt 9074-9105 of MA239) and an M13 reverse primer. The two PCR products were ligated and subcloned after digestion with EcoRV or Sinai (both enzymes produce blunt ends) and appropriate restriction enzymes, and the junction plasmid pPR-12 was made [see Fig. 1 b (iv)]. To generate NM-3N, which carries the intact SIVmac nefdownstream ofHIV-t env (Fig. 1 a), the junction fragment was excised from pPR-12 and inserted into the corresponding position of NM-3. NM-3r, NM-3R and NM-3N were constructed from MA239, NL432 and NM-3 and the above-mentioned junction plasmids by standard recombinant DNA techniques using appropriate restriction sites. NM-3rn, NM-3Rn, NM-3rN and NM-3RN were constructed by recombination of NM-3r, NM-3N, NM-3R and NM-3n. Cells'. CD4 + human cell lines CEMx174 (Salter et al., 1985) M8166 (a subclone of C8166; Clapham et al., 1987) H9 (Popovic et al., 1984) and A3.01 (Folks et al., 1985) were maintained in RPMI 1640 medium containing 10% heat-inactivated fetal calf serum (FCS). Peripheral blood mononuclear cells (PBMCs) from humans and monkeys were separated from heparinized whole blood, stimulated with 25 lag of concanavalin A/ml for 24 h, and maintained in RPMI 1640 medium containing 10% FCS and crude or recombinant interleukin 2 as described previously (Shibata et al., 1991). Transfection and infection. Samples of 10 lag of plasmid DNA were introduced into 2 x 106-3 x 106 ceils of M8166 or CEMx174 by the DEAE dextran method (Naidu et al., 1988). The culture medium was changed every 24 h and the supernatant was filtered (0.45 gm pore size) and stored at - 8 0 °C. Then virion-associated reverse transcriptase (RT) activity was measured as previously described (Willy et at., 1988). The supernatant with the highest RT level was used as the virus stock. The TCIDs0 was determined using M8166 cells (Igarashi et al., 1994). The virus inocula used for infection were adjusted to contain equal RT units or TCIDs0 titres by adding an appropriate volume of the medium
S I V Having vpr and n e f o f different origins
(a)
2183
(b)
NL432 (HIV-1)
1 "1-R |
LTR I vpu
LTR
env
...................... TAAATG vpx
LTR
env
vi Vfl" ..............
pol
Y-1
SIVmac
n~fLFTR
gag I
NM-3rN
NM-3rn
SIVmac vpx/HIV-1 vpr
pol
MA239 (SIVmac)
NM-3r
(i)
(ii)
r
'
i
LII
S.~.
S.A,
d•
$
:--
tat
!/
I
r~
E2~
..... CGACACG
A
NM-3RN
NM-3R
)HIV-1
SIVmac vpr/HIV-1 tat
vpx vpu
V-
~[
.................
...........
TAAGAGGAGAGCAAGAAATG
T SIVmac
d.
LLA
(iii)
HIV-1
HIV-1 nef/SIVmac LTR LTR
NM-3Rn
NM-3N
1" TaqI/StuI
(iv) HIV-1 env/SIVmac nef nef
................ T
HIV-1 g l
0 .........
) SIVmac
Fig. 1. Genetic structures of parental and HIV-1/SIVmac chimeric viruses. (a) Full-genome structures of NL432 (HIV-1), MA239 (SIVmac) and chimeric viruses. Solid and open boxes represent sequences derived from NL432 and MA239, respectively. Not-intact vpr and nef(due to chimeric recombinations) were previously described (Shibata et al., 1991) and are represented by dotted boxes. (b) Schematic representations of NL432/MA239 junctions of various chimeric viruses. (i) The MA239 vpx/NL432 vpr junction of the chimeric viruses NM-3rn, NM-3rN and NM-3r contains sequences of MA239 to the termination codon of vpx (to nt 6150) and those of NL432 from the initiation codon of vpr (from nt 5559). The nucleotide numbers given are from GenBank data base (accession numbers M 19921 and M33262). The initiation cod.on of HIV-1 vpr was positioned at that of SIVmac vpr to maintain as similar a way of gene expression as possible. (ii) The MA239 vpr/NL432 tat junction of the chimeric viruses NM-3Rn, NM-3RN and NM-3R contains sequences of MA239 to the termination codon of vpr (to nt 6456) and those of NL432 from 14 nt upstream of the initiation codon of tat (from nt 5816). (iii) The NL432 nef/MA239 LTR junction of the chimeric viruses NM-3rn, NM-3Rn and NM-3n was constructed by blunt-end ligation using a TaqI site (nt 9410) of NL432 and a StuI site (nt 9829) of MA239 as previously described (Igarashi et al., 1994). (iv) The NL432 env/MA239 nefjunction of the chimeric viruses NM-3rN, NM-3RN and NM-3N contains sequences of NL432 to 1 nt downstream of the termination codon of env (to nt 8786) and those of MA239 from the initiation codon ofnef(from nt 9077). The initiation codon of SIVmac nefwas positioned at the same site as that of HIV-1 neffor the same reason as mentioned above.
.....
2184
T. Kuwata and others
to the virus stocks. Culture supernatants were collected every 3 days and their RT activities were monitored.
Western immunoblotting. Lysates of transfected cells were prepared as previouslydescribed (Willy et al., 1988) and proteins were resolved in SDS-polyacrylamide gels (10-18%) and transferred electrophoretically to nitrocellulose membranes (Immobilon;Millipore). The membranes were incubated with sera overnight at 4 °C and with horseradish peroxidase (HRP) -anti-human immunoglobulin(Caltag) or HRP protein A (Amersham) for 1 h at 37 °C, washed and examined with an ECL western blotting detection system (Amersham). Inoculation of monkeys and their follow-ups. Three male adult cynomolgus monkeys (M. fascicularis), three male adult rhesus monkeys (M. mulatta) and two female adult pig-tailed monkeys (M. nemestrina) were inoculated intravenously with NM-3rN. The virus stock of NM-3rN was prepared 10 days after transfection into CEMx174 cells and 1 x 10'~ TCIDs0 per monkey were used for inoculation. Blood samples were collected periodically from the infected monkeysand their PBMCs were co-cultured with M8166 cells to test for virus re-isolation. Virus production was monitored by determination of the RT activityof the culture supernatants. Virus load was determined accordingto Kestler et al. (1991). Briefly,serial threefold dilutions of periodicallycollectedCD8+cell-depleted PBMCs were performed and co-cultured with 1 x 10s M8166 cells for 6 weeks. The endpoint was determined by CPE observation and expression of viral antigens judged by indirect immunofluorescence assay. The antibody responses of the sera collected were examined by western immunoblotting, as described above, using HIV-1-and SIVmac-infectedcells as antigens. Plasma antigenaemia was examined using an SIV core antigen assay kit (Coulter).
Results Construction of chimeric viruses and their production of viral proteins The genome organizations of the parental molecular clones of HIV-1 (NL432) and SIVmac (MA239) are very similar except for vpu and vpx. Since a prototype chimeric virus, NM-3, has defective vpr and nefgenes, we designed new chimeric viruses with intact vpr a n d / o r nef from either NL432 or MA239. As shown in Fig. 1 (a) seven new chimeras were constructed, each with a different combination of vpr and nef with respect to their genetic derivation. To examine whether viral proteins were expressed as intended for each D N A construct, the M8166 cell lysates obtained 3 or 4 days post-transfection were subjected to immunoblotting analysis. The serum from a cynomolgus monkey infected with NM-3 is known to recognize SIVmac Gag (p26) and HIV-1 Env (gpl20) proteins and also to cross-react with HIV-1 Gag (p24) but not with SIVmac Env (gpl30) (Sakuragi et al., 1992). By using this serum, it was confirmed that all the chimeras produced SIVmac Gag and HIV- 1 Env proteins (data not shown), indicating that all the chimeras maintained their basic genetic structures. Similarly, Vpr proteins of HIV-1 (NM-3rn, N M - 3 r N and NM-3r) and SIVmac (NM-3Rn, N M - 3 R N and NM-3R) were detected by using the anti-Vpr serum which reacts with
Vpr of HIV-1 and SIVmac (Sato et al., 1990). HIV-1 Nef proteins were detected in NM-3rn, N M - 3 R n and N M - 3 n by the anti-Nef serum which specifically reacts with Nef of HIV-1 (data not shown). However, the expression of Nef proteins of SIVmac was not examined because antisera to these proteins were not available.
The presence of nef accelerated replication To compare the growth kinetics of all chimeras, infection experiments were performed in human CD4 + cell line CEMx174 and monkey PBMCs (Fig. 2). Each graph shows the growth of a set of three chimeras which carried vpr of the same origin. Of the viruses with vpr from the same source, the chimeras carrying nef, irrespective of its origin, replicated more rapidly than the n@defective chimera. The source of nefdid not seem to have any significant effect. Similar results were obtained in M8166 cells and PBMCs from three different cynomolgus monkeys (data not shown).
Comparison of four chimeras having combinations of intact vpr and nef of different origins To compare chimeras with vpr and nef of different origin, the following four viruses, NM-3rn, NM-3rN, N M - 3 R n and N M - 3 R N , were used for infection of H9, A3.01 and human or monkey PBMCs. All the virus stocks used for inoculation were found to be 1-1 x 106 TCIDs0/ml using M8166 cells. In monkey PBMCs, chimeras with SIVmac nefreplicated slightly faster than those with HIV-1 nef[Fig. 3 a (i)]. On the other hand, the chimeras with HIV-1 nef replicated to higher titres in human PBMC than those with SIVmac nef[Fig. 3 b (i)]. The parental viruses grew well in the original virus-host combinations [Fig. 3 a (ii), b (ii)l. Though these differences in replication were slight, it would seem that the growth potential of each chimera reflected that of the parental virus from which nefwas derived. In comparison with parental viruses, the chimeras with SIVmac nef replicated faster, but to lower titres than parental SIVmac in monkey PBMCs, and the chimeras with HIV1 nefreplicated slower than parental HIV-1, but to the same titres in human PBMCs. Unlike nef, no effect of vpr was seen in human and monkey PBMCs since no significant difference was observed between two combinations of chimeras with vpr of different origin. Similar results were obtained with PBMCs from two cynomolgus monkeys and two human subjects. Moreover, essentially similar results to those with cynomolgus monkeys were obtained with two rhesus monkeys (data not shown). The effect of nef origin was more clearly observed in H9 and A3.01 cells. In H9 cells, as in human PBMCs, parental NL432 replicated faster and to higher titre than
S I V Having vpr and nef of different origins I
(a) (i) 6000
I
I
I
r
(ii)
2185
[
[
I
I
I
I
5
10
(iii)
4000
2000 d
0
0
I
(b) l
f
,
i
(i) 0 e~
I
I
I
~
(ii)
(iii)
6OO
¢)
.=. E-
4OO
200
/
i
5
l0
15
20
0
10 t5 20 Time post-infection(days) 5
0
15
20
Fig. 2. Replication of chimericviruses m (a) the human CD4÷ cell line CEMx174 and (b) PBMC from a cynornolgusmonkey. Cellfree virus stocks from M8166 cells transfected with the respectivechimeric DNA clones were inoculated and RT production in the infected cells was monitored every 3 days. (i) Kinetics of three chimericviruses carrying HIV-1 vpr. Symbols: O, NM-3rn; O, NM3rN; El, NM-3r. (ii) Kinetics of three chimericviruses carrying SIVmac vpr. Symbols: O, NM-3Rn; O, NM-3RN; [3, NM-3R. (iii) Kinetics of three chimericviruses carrying defectivevpr. Symbols: O, NM-3n; O, NM-3N; [3, NM-3. MA239 [Fig. 4 a (ii)]. For the pair of chimeras with vpr of the same origin, those with SIVmac nef replicated slightly faster, but the titres of virus production of chimeras with HIV-1 nefwere twice as high as those with SIVmac nefin H9 cells [Fig. 4 a (i)]. In A3.01 cells, the parental NL432 was replication competent whereas MA239 was not [Fig. 4 b (ii)]. The chimera with HIV-1 nef replicated faster and to higher titre (Fig. 4 b). These results support the notion that the growth of viruses was enhanced by HIV-1 nef in human cells. These experiments were performed three times, with similar results. Though the growth of chimeras was not influenced by the vpr origin in PBMCs of both humans and monkeys, it was drastically different in H9 and A3.01 cells. In H9 cells, for the pair of the chimeras with nef of the same origin, the growth peaks almost reached the same height,
but the onset of replication of chimeras with HIV-1 vpr was earlier than those with SIVmac vpr [Fig. 4 a (i)]. In A3.01 cells, virus production was observed only for chimeras with HIV-1 vpr (NM-3rn and NM-3rN) and the parental virus NL432, and not with chimeras with SIVmac vpr (NM-3Rn and NM-3RN) or another parental virus MA239 (Fig. 4 b). In attempts to rescue viruses from cultures infected with NM-3Rn, N M - 3 R N and MA239 in which no significant virus production was observed, the cultures 40 days after infection were cocultured with M8166 cells. Viruses were detected in cultures of N M - 3 R n and NM-3RN, but not in those of MA239. These results indicate that all four chimeras (NM-3rn, NM-3rN, N M - 3 R n and NM-3RN) replicated in A3.01, and that HIV-1 vpr was required for highly productive infection. The results suggest that the effect of
2186
T. Kuwata and others (a) I
I
I
2500 |
(i)
t
I
'
I
~
I
'
I
(ii)
1200 2000 P
1500
800
1000 ~-.
400
[
i
500
0 "
,
(b) 10000
o~
,
"i) (
'
i
, i , j ,
I
lO00
8000
6000
6000
4000
4000
2000
2000
0
,
i
i
~
10
~ 15
i
(ii)
~- 8000
0
,
5
10
15
0 20 5 Time post-infection (days)
.....
, tq 20
Fig. 3. Replication of four chimeric viruses having intact vpr and nef and parental viruses in (a) cynomolgus PBMCs and (b) human PBMCs. (i) Chimeric viruses: O, NM-3rn; 0, NM-3rN; [3, NM-3Rn; II, NM-3RN. (ii) Parental viruses: ~, NL432; A, MA239; +, mock-infected. Infection of cynomolgus PBMCs was performed at an m.o.i, of 1"1 and that of human PBMCs at an m.o.i, of 0"11. All experiments were performed in duplicate and average RT values are shown. vpr might be cell type dependent and that the origin o f vpr reflected the growth o f the parental virus in these cells. Inoculation of macaque monkeys with NM-3rN One of the newly constructed chimeras, N M - 3 r N , was examined for its ability to infect m a c a q u e m o n k e y s in vivo. The virus stock o f N M - 3 r N was p r e p a r e d 10 days after transfection into C E M x 1 7 4 cells. The virus stock o f N M - 3 r N containing 1 x 105 TCIDs0 was inoculated
intravenously into three rhesus monkeys, three cynomolgus m o n k e y s and two pig-tailed monkeys, respectively. Viruses were consistently re-isolated from all m o n k e y s 2 to 14 weeks post-inoculation (p.i.) (Table 1). Virus loads were very similar between the three species, though pig-tailed m o n k e y s showed slightly higher virus loads. Virus loads reached the highest levels at 2 weeks p.i. (2"1 x 103-1.9 x 104) and decreased to 3-2 x 10 ~1.2 x 106 at 10-14 weeks p.i. A n antigenaemia in cell-free plasma was detected at 2 weeks p.i. in two of three c y n o m o l g u s and two of three rhesus, but none of two
SIV Having vpr and nef of different origins
(a) t
'
I
10000
I
"
I
'
I
I
(ii)
3000 8000
20001000[
1
4
0
0
0
6
0
0
0
!
2000
"~ "~
O"
0
(b)
I
-- --
I
I
(i)
°.
--
'
I
(ii)
12000
12000 -
8000
8000
4000
4000
,,z
0
o - - -
1 0 -
-
20
30 0 Time post-infection (days)
/.
I t It
2
_" ~ , _
10
"
"20
30
Fig. 4. Replication of four chimeric viruses having intact vpr and nefand parental viruses in (a) H9 cells and (b) A3.01 cells. (i) Chimeric viruses: O, NM-3rn; 0 , NM-3rN; IN, NM-3Rn; II, NM-3RN. (ii) Parental viruses: /X, NL432; A, MA239; +, mock-infected. H9 cells were infected at an m.o.i, of 0.11, and A3.01 cells at an m.o.i, of 1.1. All experiments were performed in duplicate and average RT values are shown.
Table 1. Summary of virus recovery* and virus loadst of monkeys infected with NM-3rN Time post-infection (weeks) Species
Animal
0
M. mulatta
MM43 MM64 MM50 MF44 MF46 MF47 MN2150 MN2170
+ -+ - + ( < 1-0xl04) + + -- +(1"9 × 104) -- +(2.1 x 10~) -- +(4"8 × 103)
M. fascicularis
M. nemestrina
2
4 + + ND + + ND +(5"5 x 103) +(5"1 x 104)
6 + + +(7-5×104) + + +(1"5 X 105) +(1.1 x 105) +(1"1 x 105)
10
12
NI) +(1-1 × 106) t,~ +(8"0 × 105) +(3.2× 10a) ND + (1.2 × 105) +(9.0 × 104) +(1.8 x l0 s) +(1"5 X 105) ND +(2.4 x 105) ND +(7"0 x 104) ND
14 +(1'1 × 105) +(1"2 × 106) ND + (1-4 x 105) +(6.7 × 105) ND ND ND
* Re-isolation of virus was judged by RT production in co-cultures of M8166 cells and PBMCs from infected monkeys. "~ Virus loads are show by the minimum numbers of PBMCs needed to yeild virus. ND, Not determined.
2187
2188
T. Kuwata and others
Table 2. Plasma antigenaemia of monkeys infected with NM-3rN* T i m e p o s t - i n f e c t i o n (weeks) Species
Animal
0
2
M. mulatta
MM43 MM64 MM50
-- t -
0"04 0"08
MF44 MF46 MF47
--
0-37 0" 13 -
MN2150 MN2170
--
-
M. Jascicularis
M. nemestrina
4
m
m
m
* Plasma antigenaemia (ng/ml) was measured by a Coulter SIV core a n t i g e n a s s a y kit. t V a l u e s b e l o w 0"03 n g / m l w e r e j u d g e d n e g a t i v e .
pig-tailed monkeys (Table 2). An antibody response to the virus was also observed in all monkeys and the western immunoblot analysis of sera from two rhesus, two cynomolgus and two pig-tailed monkeys is shown in Fig. 5. Antibodies to HIV-1 Env (gpl20) and SIVmac Gag (p26) appeared about 6 weeks p.i. and increased thereafter in cynomolgus and rhesus monkeys. In pigtailed monkeys, antibodies levels to HIV-1 Env (gpl20) were very low, though antibodies to SIVmac Gag (p26) appeared in similar amounts to those found in the other two species. In the previous study with NM-3 or NM-3n, persistent viraemia was not observed in this period and virus recovery was successful from only one of two infected cynomolgus monkeys (Sakuragi et al., 1992; Igarashi et al., 1994). These results indicate that the infectivity of NM-3rN was higher than those of our former chimeras, NM-3 and NM-3n.
Discussion A series of chimeric viruses constructed in this study replicated in vitro, and the present in vivo experiments demonstrated that one of these chimeras, NM-3rN, infected macaque monkeys with high efficiency. In the case of NM-3 or NM-3n, virus isolation (for which 2 x 106-4 x 106 PBMCs were required) was positive at some time points from one of two inoculated monkeys (Sakuragi et al., 1992; Igarashi et al., 1994). In the present study, viruses were easily isolated from all the NM-3rN inoculated monkeys and virus loads were rather high (to the level of about 104-106 PBMCs). Also, an antibody response was observed in all the monkeys infected with NM-3rN, but only in one of two monkeys in the case of NM-3. Judging by virus re-isolation and immune response of infected monkeys, the efficiency of infection with NM-3rN is higher than with our previous chimeric viruses, NM-3 and NM-3n. Li et al. (1992) constructed and infected cynomolgus monkeys with the
chimera designated SHIV-4 that has basically the same genome structure as NM-3RN but lacks the vpu gene carried by NM-3RN. However, they did not determine virus loads for SHIV-4. Therefore, we could not compare SHIV-4 with NM-3rN in terms of infection efficiency. In the case of SIVmac infection, 1 x 102 to 2 x 104 PBMCs were reported to be required for virus recovery in the early period (Daniel et al., 1992). Comparison with the results obtained with SIVmac may provide useful information on the efficiency of infection, although the experimental conditions, such as the cells used as an indicator, were not the same. In the very early period (2 and 4 weeks p.i.) the virus load of NM-3rN was comparable to that of parental SIVmac, though the virus load of NM-3rN thereafter decreased to a 10-100-fold lower level. In comparison with a nefdeletion mutant of SIVmac, the virus load of NM-3rN was apparently higher. SIVmac/nef deletion, which did not induce disease, required > 106 PBMCs for virus recovery (Kestler et al., 1991). Plasma antigenaemia of NM-3rNinfected monkeys was detected in four of eight monkeys. Levels of p27 protein ranged from 0.04 to 0.37 ng/ml. These values are about 10-fold lower level than in SIVmac239 infection. In the case of SIVmac/nefdeletion, however, no plasma antigenaemia was detected (Kestler et al., 1991). The results of virus loads and levels of plasma p27 in NM-3rN infection indicate that the in vivo replication ability of NM-3rN does not equal that of SIVmac239, but is apparently greater than that of SIVmac/nef deletion. NM-3- or NM-3n-infected monkeys produced neutralizing antibodies to the chimera as well as the parental HIV-1, and cytotoxic T-lymphocytes (CTL) to HIV-1 Env (Igarashi et al., 1994). As NM-3rN has basically the same genome structure as NM-3 and NM3n, the immune response of the NM-3rN-infected monkeys was probably similar, though neutralizing antibodies and CTL were not assessed in this study. At the time of submission, no clear clinical symptoms have been observed in monkeys infected with NM-3rN. But, even if NM-3rN does not induce any AIDS-like disease, its highly efficient infectivity shown in this study indicates that it may be suitable as a challenge virus for evaluating AIDS vaccine candidates based on HIV-1 Env, and allows the use of macaque monkeys instead of chimpanzees. The chimeras constructed in this study have intact vpr and nefgenes from either HIV-1 or SIVmac, or defective genes in some cases. The growth potential of these chimeras differed and this seemed to be due to the effects of vpr and nef. The effects of parameters other than vpr and nef, such as LTR and splice donors and acceptors, were not addressed in this study, since the principal aim was to select a chimera which displayed efficient macaque
SIV Having vpr and nef of different origins (a)
T i m e p o s t - i n f e c t i o n (weeks) Cynomolgus N o . 44
kDa
0
4
6
9
Rhesus
N o . 46 12
16
0
4
6
9
12
Pig-tailed
N o . 43 16
0
4
6
9
N o . 64 12
16
0
4
6
9
No. 2150
12
16
0
4
6
9
12
No. 2170 16
0
4
6
9
12
16
P
200 gpl20
97-4 69
46
30 p24
21.5
(b) kDa
0
4
6
9
12
16
0
4
6
9
12
16
0
4
6
9
12
16
0
4
6
9
12
16
0
4
6
9
12
16
0
4
6
9
12
16
P
200
97.4 m 69m
46--
30-p26
21.5 Fig. 5. A n t i b o d y r e s p o n s e o f m o n k e y s infected w i t h N M - 3 r N d e t e r m i n e d b y w e s t e r n i m m u n o b l o t t i n g . P l a s m a s a m p l e s c o l l e c t e d a t i n t e r v a l s w e r e t r e a t e d w i t h S D S - P A G E - r e s o l v e d a n t i g e n s o f (a) p a r e n t a l H I V - 1 ( N L 4 3 2 ) a n d (b) S l V m a c ( M A 2 3 9 ) a f t e r t r a n s f e r to membranes. The numbers of monkeys and weeks after inoculation are shown above. The serum from a cynomolgus monkey infected w i t h N M - 3 w a s tested as a positive c o n t r o l (P). Size m a r k e r s a r e i n d i c a t e d o n the left.
2189
2190
T. Kuwata and others
infection. We observed some effects of vpr and nef, though only the in vitro replication of chimeric viruses was compared. Acceleration of replication by nef was observed in all the cell types used. This effect of nefwas shown not only with the chimeras, but also with a parental virus, MA239. MA239/nef-open (in which the stop codon TAA of nefwas changed to GAA) replicated faster than MA239/nef-stop (original clone MA239) in monkey PBMCs (data not shown). These results are consistent with previous reports that nef has a positive effect on replication in PBMCs (De Ronde et al., 1992; Zazopoulos & Haseltine, 1993). Furthermore, results suggested that nef from both HIV-1 and SIVmac is functional in cells of both human beings and macaque monkeys and that the growth potential of each chimera reflects that of the parental virus from which nef was derived. This effect of nef may be related to the interaction between Nef and host cell protein(s). The effect of vpr was observed in H9 and more clearly in A3.01 cells. Chimeras with HIV-I vpr replicated faster than those with SIVmac vpr in H9 cells [Fig. 4 a (i)]. Furthermore, chimeras with HIV-1 vpr replicated in A3.01, but those with SIVmac vpr did not, although virus rescue was successful [Fig. 4 b (i)]. SIVmac (SIVmac251) is reported not to replicate in A3.01 cells (Koenig et al., 1989). We also observed that one parental virus HIV-1 (NL432) was competent for replication, whereas another parental virus SIVmac (MA239) showed no detectable virus production and even rescue of the virus was not successful [Fig. 4 b (ii)]. In addition to the region including tat, rev, vpu and env of HIV-1, which all four chimeras share, HIV-1 vpr appears to confer highly productive infection in A3.01 cells. Moreover, the growth potential of each chimera in these cells reflected that of the parental virus from which vpr was derived. For in vivo study, only one of the chimeras could be used due to the limited availability of monkeys. We chose to test the chimera that grew best in macaque PBMC. Chimeras with SIVmac nef replicated faster in macaque PBMC. Moreover, infection with NM-3n, which carried HIV-1 nef, was no more efficient than with NM-3 which lacks an intact nefgene (Igarashi et at., 1994, Sakuragi et al., 1992). Thus, we considered that the nef gene from SIVmac would be more suitable for in vivo replication. With regard to choice of vpr genes, no clear results were observed in macaque PBMC with respect to its origin, but chimeras carrying HIV-1 vpr replicated more efficiently in established cell lines. In addition, the genetic structure of the vpr region is much closer (in terms of the sites of ORFs, splicing acceptors and donors) to parental viruses in chimeras carrying HIV-1 vpr than in those carrying SIVmac vpr. For these reasons, NM-3rN carrying HIV-1 vpr and SIVmac nefwas inoculated into the monkeys. We can not exclude the possibility that
o t h e r c h i m e r a s w h i c h w e r e n o t tested in vivo in this s t u d y m a y p r e s e n t w i t h h i g h e r in vivo infectivity. C o m p a r a t i v e i n f e c t i o n e x p e r i m e n t s u s i n g t h e o t h e r c h i m e r a s will be useful f o r c l a r i f y i n g t h e in vivo effects o f b o t h vpr a n d n e f The authors acknowledge Dr A. Adachi (Kyoto University) for advice, Dr A. Sato (Shionogi Institute for Medical Science) for providing Anti-Vpr antiserum, Dr. Y. Takebe (NIH Japan) for providing anti-Nef antiserum, and Shin Nippon Biomedical Laboratories, Ltd for providing two pig-tailed monkeys. This work was supported by Grants-in-Aid for AIDS Research and from the Japanese Ministry of Health and Welfare, and the Ministry of Education, Science and Culture of Japan.
References ADACHI, A., GENDELMAN,H. E., KOENIG, S., FOLKS, T., WILLEY, R., RABSON, A. & MARTIN, M.A. (1986). Production of acquired immunodeficiency syndrome-associated retrovirus in human and non-human cells transfected with an infectious molecular clone. Journal of Virology 59, 284-291. AGY, M., FRUMKIN, t., COREY, t., COOMBS, R., WOLINSKY, S., KOEnLER, J , MORTON,W. & KATZE,M. (1992). Infection of Macaca nemestrina by human immunodeficiency virus type-1. Science 257, 103-106. ALTER, H. J., EICHBERG,J. W., MASUR,H., SAXINGER,W. C., GALLO, R., MACHER, A.M., LANE, H.C. & FAUCI, A.S. (1984). Transmission of HTLV-IIIb infection from human plasma to chimpanzees: an animal model for AIDS. Science 226, 54%552. BENVENISTE,R. E., MORTON,W. R., CLARK,E. A., TSAI, C.-C., OCHS, H. D., WARD, J. M., KULLER,L., KNOTT,W. B., HILL, R. W., GALE, M.J. & THOULESS, M.E. (1988). Inoculation of baboons and macaques with simian immunodeficiency virus/rune, a primate lentivirus closely related to human immunodeficiency virus type 2. Journal of Virology 62, 2091-2101. CLAPHAM,P. R., WEISS,R. m., DALGLEISH,A. G., EXLEY,M., WHITBY, D. & HOGG, N. (1987). Human immunodeficiency virus infection of monocytic and T-lymphocytic cells: receptor modulation and differentiation induced by phorbol ester. Virology 158, 44-51. DANIEL, M.D., KIRCHHOFF, F., CZAJAK, S.C., SEHGAL,P. K. & DESROSIERS,R. C. (1992). Protective effects of a live attenuated SIV vaccine with a deletion in the nefgene. Science 258, 1938 1941. DE RONDE, A., KLAVER, B., KEULEN, W., SMIT, L. & GOUDSMIT,J. (1992). Natural HIV-1 Nef accelerates virus replication in primary human lymphocytes. Virology 188, 391-395. FILICE,G., CEREDA,P. M. & VARNIER,O. E. (1988). Infection of rabbits with human immunodeficiency virus. Nature 335, 366-369. FOLKS, T., BENN, S., RABSON, A., THEODORE,T., HOGGAN, M. D., MARTIN,M., LIGHTFOOTE,M. & SELL,K. (1985). Characterization of a continuous T-cell line susceptible to the cytopathic effects of the acquired immune deficiency syndrome (AIDS)-associated retrovirus. Proceeding of the National Academy of Sciences, USA 82, 4539-4543. FULTZ, P. N., MCCLURE, H. M., SWBNSON,R. B., MCGRATH, C. R., BRODIE, A., GETCHELL, J.P., JENSEN, F.C., ANDERSON, D.C., BRODERSON,J. R. & FRANCIS, D. P. (1986). Persistent infection of chimpanzees with human T-lymphotropic virus type III/ lymphadenopathy-associated virus: a potential model for acquired immunodeficiency syndrome. Journal of Virology 58, 1t6-124. FULTZ, P. N., MCCLURE,H. M., ANDERSON,D. C. & SWITZER,W. M. (1989). Identification and biologic characterization of an acutely lethal variant of simian immunodeficiency virus from sooty mangabeys (SIV/SMM). AIDS Reserch and Human Retroviruses 5, 397-409. GAJDUSEK, D.C., AMYX, H.L., GIBBS, C.J., JR, ASHER, D. M., RODGERS-JOHNSON,P., EPSTEIN, L. G., SARIN, P. S., GALLO, R. C., MALUISH, A., ARTHUR, L.O., MONTAGNIER, L. & MILDVAN, D. (1985). Infection of chimpanzees by human T-lymphotropic retroviruses in brain and other tissues from AIDS patients. Lancet i, 55-56.
S I V Having vpr and n e f o f different origins IGARASHI, T., SHIBATA, R., HASEBE, F., AMI, Y., SHINOHARA, K., KOMATSU, T., STAHL-HENN1G, C., PETRY, H., HUNSMANN, G., KUWATA, T., JIN, M., ADACHI, A., KURIMURA,T., OKADA, M., MIURA, T. & HAYAMI,M. (1994). Persistent infection with SIVmac chimeric virus having tat, rev, vpu, env and nefof HIV-1 in macaque monkeys. AIDS Research and Human Retroviruses 10, 1021-1029. KESTLER, H.W., III, RINGLER, D.J., MORI, K., PANICALI, D.L., SEHGAL, P.K., DANIEL, M.D. & DESROSIERS,R.C. (1991). Importance of the nefgene for maintenance of high virus loads and for development of AIDS. Cell 65, 651-662. KOENIG, S., HIRSCH,V. M., OLMSTED,R. A., POWELL,D., MAURY,W., RABSON,A., FAUCI,A. S., PURCELL,R. H. & JOHNSON,P. R. (1989). Selective infection of human CD4 + cells by simian immunodeficiency virus: productive infection associated with envelope glycoproteininduced fusion. Proceedings of the National Academy of Sciences, USA 86, 2443-2447. LANG, S.M., WEEGER, M., STAHL-HENNIG, C., COULIBALY, C., HLrNSMANN,G., M/~ILLER,J., MIdLLER-HERMEL1NK,H., FUCHS, D., WACHTER, H., DANIEL, M. M., DESROSIERS,R. C. & FLECKENSTE1N, B. (1993). Importance of vpr for infection of rhesus monkeys with simian immunodeficiency virus. Journal of Virology 67, 902--912. LEONARD, J.M., ABRAMCZUK,J.W., PEZEN, D.S., RUTLEDGE, R., BELCHER,J. H., HAKIM,F., SHEARER,G., LAMPERTH,L., TRAVIS,W., FREDRICKSON, T., NOTKINS, A.L. & MARTIN, M.A. (1988). Development of disease and virus recovery in transgenic mice containing HIV proviral DNA. Science 242, 1665-1670. LETVIN, N.L., DANIEL, M.D., SEHGAL, P.K., DESROSIERS, R.C., HUNT, R.D., WALDRON, L.M., MACKEY, J.J., SCHMIDT,D.K., CHALIFOUX, L. V. & KING, N. W. (1985). Induction of AIDS-like disease in macaque monkeys with T-cell tropic retrovirus STLV-III. Science 230, 71 73. Lt, J., LOAD,C. I., HASELTINE,W., LETVlN,N. L. & SODROSK1,J. (1992). Infection of cynomolgus monkeys with a chimeric HIV-1/SIVmac virus that expresses the HIV-1 envelope glycoproteins. Journal of Acquired Immune Deficiency Syndromes 5, 639-646. Lusso, P., MARKHAM,P. D., RANKI,A., EARL, P., MOSS, B., DORNER, F., GALLO, R. C. & KROHN, K. J. E. (1988). Cell-mediated immune response toward viral envelope and core antigens in gibbon apes (Hylobates lar) chronically infected with human immunodeficiency virus-1. Journal of Immunology 141, 2467-2473. N~aou, Y. M., KESTLER, H.M., III, LI, Y., BUTLER, C.V., SILVA, D.P., SCHMIDT,D. K., TROUP, C. D., SEHGAL,P. K., SONIC,O, P.,
2191
DANIEL, M.D. & DESROSIERS,R.C. (1988). Characterization of infectious molecular clones of simian immunodeficiency virus (SIVmac) and human immunodeficiency virus type 2: persistent infection of rhesus monkeys with molecularly cloned SIVmac. Journal of Virology 62, 46914696. NARA, P. L., ROBEY,W. G., ARTHUR,L. O., ASHER,D. M., WOLFF, A. V., GIBBS, C. J., JR, GAJDUSEK,D. C. & FISCHINGER,P. J. (1987). Persistent infection of chimpanzees with human immunodeficiency virus: serological responses and properties of reisolated viruses. Journal of Virology 61, 3173-3180. PoPovIc, M., SARNGADHARAN,M.G., READ, E. & GALLO, R.C. (1984). Detection, isolation and continuous production of cytopathic retroviruses (HTLV-III) from patients with AIDS and pre-AIDS. Science 224, 497-500. SAKURAGI,S., SH1BATA,R., MUKAI, R., KOMATSU,T., FUKASAWA,M., SAKAI,H., SAKURAGI,J.-I., KAWAMURA,M., IBUKI,K., HAYAMI,M. & ADACHI,A. (1992). Infection of macaque monkeys with a chimeric human and simian immunodeficiency virus. Journal of General Virology 73, 2983-2987. SALTER, R.D., HOWELL, D.N. & CRESSWELL, P. (1985). Genes regulating HLA class I antigen expression in T-B lymphoblast hybrids. Immunogenetics 21,235 246. SATO, A., IGARASm, H., ADACm, A. & HAYAMI, M. (1990). Identification and localization of vpr gene product of human immunodeficiency virus type 1. Virus Genes 4, 303 312. SHIBATA,R., KAWAMURA,M., SAKAI,H., HAYAMI,M., ISHIMOTO,A. & ADACm, A. (1991). Generation of a chimeric human and simian immunodeficiency virus infectious to monkey peripheral blood mononuclear cells. Journal of Virology 65, 3514--3520. WEISS,R. A., CLAPHAN,P. R., WEBER,J. N., DALGLEISH,A. G., LASKY, L. A. & BERMAN,P. W. (1986). Variable and conserved neutralization antigens of human immunodeficiency virus. Nature 324, 57~575. WILLY, R. L., SMITH,D. H., LASKEY,L. A., THEODORE,T. S., EARL, P.L., Moss, B., CAPON, D.J. & MARTIN, M.A. (1988). In vitro mutagenesis identifies a region within the envelope gene of the human immunodeficiency virus that is critical for infectivity. Journal of Virology 62, 139-147 ZAZOPOULOS,E. & HASELTINE,W. A. (1993). Effect of nef alleles on replication of human immunodeficiency virus type 1. Virology 194, 20-27.
(Received 9 February 1995; Accepted 27 April 1995)
