Corynebacterium diphtheriae: Identification and Characterization of a ...

JOURNAL OF BACTERIOLOGY, Nov. 2007, p. 7709–7719 0021-9193/07/$08.00⫹0 doi:10.1128/JB.00864-07 Copyright © 2007, American Society for Microbiology. All Rights Reserved.

Vol. 189, No. 21

Corynebacterium diphtheriae: Identification and Characterization of a Channel-Forming Protein in the Cell Wall䌤 Bettina Schiffler,1† Enrico Barth,1† Mamadou Daffe´,2 and Roland Benz1* Lehrstuhl fu ¨r Biotechnologie, Biozentrum der Universita ¨t Wu ¨rzburg, D-97074 Wu ¨rzburg, Germany,1 and Institut de Pharmacologie et Biologie de Structurale, Centre National de la Recherche, Scientifique/Universite´ Paul Sabatier (UMR 5089), F-31077 Toulouse Cedex 04, France2 Received 4 June 2007/Accepted 10 August 2007

The cell wall fraction of the gram-positive, nontoxic Corynebacterium diphtheriae strain C8r(ⴚ) Toxⴚ (ⴝ ATCC 11913) contained a channel-forming protein, as judged from reconstitution experiments with artificial lipid bilayer experiments. The channel-forming protein was present in detergent-treated cell walls and in extracts of whole cells obtained using organic solvents. The protein had an apparent molecular mass of about 66 kDa as determined on Tricine-containing sodium dodecyl sulfate-polyacrylamide gel electrophoresis gels and consisted of subunits having a molecular mass of about 5 kDa. Single-channel experiments with the purified protein suggested that the protein formed channels with a single-channel conductance of 2.25 nS in 1 M KCl. Further single-channel analysis suggested that the cell wall channel is wide and water filled because it has only slight selectivity for cations over anions and its conductance followed the mobility sequence of cations and anions in the aqueous phase. Antibodies raised against PorA, the subunit of the cell wall channel of Corynebacterium glutamicum, detected both monomers and oligomers of the isolated protein, suggesting that there are highly conserved epitopes in the cell wall channels of C. diphtheriae and PorA. Localization of the protein on the cell surface was confirmed by an enzyme-linked immunosorbent assay. The prospective homology of PorA with the cell wall channel of C. diphtheriae was used to identify the cell wall channel gene, cdporA, in the known genome of C. diphtheriae. The gene and its flanking regions were cloned and sequenced. CdporA is a protein that is 43 amino acids long and does not have a leader sequence. cdporA was expressed in a C. glutamicum strain that lacked the major outer membrane channels PorA and PorH. Organic solvent extracts of the transformed cells formed in lipid bilayer membranes the same channels as the purified CdporA protein of C. diphtheriae formed, suggesting that the expressed protein is able to complement the PorA and PorH deficiency of the C. glutamicum strain. The study is the first report of a cell wall channel in a pathogenic Corynebacterium strain. The suborder Corynebacterineae belongs to a distinctive suprageneric actinomycete taxon, the mycolata, which also includes the mycobacteria, nocardiae, rhodococci, and closely related genera. These bacteria share with corynebacteria the property of having an unusual cell envelope composition and architecture (19). They have a thick peptidoglycan layer, which is covered by lipids in form of mycolic acids and other lipids (5, 26, 54). The mycolic acids are covalently linked through ester bonds to the arabinogalactan attached to the murein of the cell wall (45). The chain lengths of these 2-branched, 3-hydroxylated fatty acids vary considerably within the mycolic acidcontaining taxa. Long mycolic acids have been found in mycobacteria, but the mycolic acids are short in corynebacteria (22 to 38 carbon atoms) (13, 20, 29, 45, 46, 76). The cell walls of corynebacteria and closely related genera are very similar to those of mycobacteria, especially in terms of ultrastructure and cell wall chemical composition (4, 44, 69). This means that the cell wall of a member of the mycolata forms a permeability barrier and probably has the same function as the outer membrane of gram-negative bacteria, which contains channel-form-

ing proteins, the porins, for the passage of hydrophilic solutes (8, 9, 31, 50, 51, 52, 53). Analogous to the situation in the outer membrane of gram-negative bacteria, channels for the passage of hydrophilic compounds are present in the mycolic acid layer of the mycobacterial cell wall and the cell wall of Corynebacterium glutamicum (17, 18, 30, 38, 41, 70, 72). The assumption that the mycolic acids represent a permeability barrier on the surface of members of the mycolata has been confirmed in recent years by the investigation of porins in different members of the Corynebacterineae (38, 39, 40, 62, 63, 64, 72). Members of the genus Corynebacterium are of considerable interest because some of them are potent producers of glutamate, lysine, and other amino acids through fermentation processes on an industrial scale. Two prominent examples of amino acid producers are C. glutamicum and Corynebacterium callunae (22, 32, 35, 37, 65, 73). On the other hand, the genus Corynebacterium contains a few pathogens. The main pathogen is Corynebacterium diphtheriae (43), well known as the cause of diphtheria, which is an acute, communicable respiratory disease. Other possible pathogens are Corynebacterium urealyticum and Corynebacterium jeikeium (56). Diphtheria disease is caused by exotoxin-producing C. diphtheriae cells that infect the throat or nose and sometimes the eyes or skin, inducing the formation of an inflammatory pseudomembrane. The exceedingly potent toxin is absorbed into the circulation and damages remote organs, potentially resulting in death (21, 28). In 1990

* Corresponding author. Mailing address: Lehrstuhl fu ¨r Biotechnologie, Biozentrum der Universita¨t Wu ¨rzburg, Am Hubland, D-97074 Wu ¨rzburg, Germany. Phone: 49-(0)931-888-4501. Fax: 49-(0)931-8884509. E-mail: [email protected]. † B.S. and E.B. contributed equally to this paper. 䌤 Published ahead of print on 24 August 2007. 7709

7710

SCHIFFLER ET AL.

J. BACTERIOL. TABLE 1. Oligonucleotides used in this studya

Oligonucleotide

Position

Sequence (5⬘–3⬘)

Cdiph_XbaI_for Cdiph_KpnI_rev FP KO 1 RP KO 2 FP KO 3 RP KO 4

2073825–2073796 2073038–2073067 2862508–2862538 2861687–2861717 2861216–2861246 2860356–2860385

GCTTTTGCTATTTCTAGAGGAGGTATTGAC CCTAGCCAGCTAGGTACCAAGCCAACAAAC GACGAGGCAACCGGAATTCGCATCGTCCGCG GTTGCCAGTTTGCTGGGGCCCTCAGGACGTC AACTTCGCCCACGGGCCCAGTTTTCAAAAAC ATTCGACTTGATGGGGATCCACGGGGACTC

a The sequences of the primers were derived from the prospective gene of the cell wall channel and its flanking regions from the genome of C. diphtheriae NCTC 13129 (11). The accession number for the genome of C. diphtheriae NCTC 13129 is NC_002935.

the World Health Organization observed a reemergence of the pathogen, which led to a worldwide launch of immunization programs. A total of 1,214 declared cases of diphtheria originated an epidemic which spread through Russia, Ukraine, and neighboring countries and even reached a few subjects in Europe and North America (12, 14). Especially disturbing is the fact that nontoxigenic C. diphtheriae strains are associated with invasive diseases (27) and nontoxigenic strains can change to toxigenic strains by lysogenic conversion (2, 57). Furthermore, it is known that the epidemiological pattern of the disease has changed (25, 59). The current situation clearly demonstrates that the risk of a diphtheria epidemic still exists, even in Western countries. These results emphasize the importance of further studies of this microorganism in order to understand the metabolic pathways and to find new mechanisms of prevention and treatment. In this study, we extended the search for cell wall channels to C. diphtheriae strain C8r(⫺) Tox⫺ (⫽ ATCC 11913), which is another member of the genus Corynebacterium. It is known that the cell wall of this strain contains a channel-forming protein, but this protein has not been investigated in detail (60). Using lipid bilayer experiments, we demonstrated that extracts of cell walls and whole C. diphtheriae cells contain a protein that forms wide and water-filled channels similar to the porins found in gram-negative bacteria (7, 8, 9). The gene encoding the channel-forming protein, designated CdporA, was identified in the accessible genome of C. diphtheriae NCTC 13129 (16) by using the homology of CdporA to PorA of C. glutamicum. CdporA was expressed in a PorA/PorH-deficient strain of C. glutamicum (30, 41). In this study we describe characterization of the first channel-forming protein of a pathogenic strain in the genus Corynebacterium. MATERIALS AND METHODS Bacterial strain and growth conditions. C. diphtheriae strain C8r(⫺) Tox⫺ (⫽ ATCC 11913) (3) was used in all experiments. This strain was routinely grown in 500-ml Erlenmeyer flasks containing 250 ml brain heart infusion medium (Difco Laboratories) broth at 36 ⫾ 1°C using a New Brunswick shaker at 120 rpm for 24 h. C. glutamicum ATCC 13032 cells were routinely grown in brain heart infusion medium as described previously in detail (30). PorA- and PorH-deficient C. glutamicum strain ATCC 13032⌬porA⌬porH (see below) was used to complement for PorA deficiency. Growth rates were determined in triplicate by measuring the optical density at 600 nm. Construction of C. glutamicum ATCC 13032⌬porH⌬porA. The up- and downstream regions of target genes were amplified by PCR with primers FP KO1 and RP KO2 (containing EcoRI and ApaI restriction sites) and primers FP KO3 and RP KO4 (carrying ApaI and BamHI restriction sites) (Table 1). The FailSafe PCR system (Biozym Scientific, Oldendorf, Germany) and buffer G were used according to the manufacturer’s instructions. The PCR products were separately digested using ApaI (Fermentas, St. Leon-Rot, Germany) and ligated over-

night with T4 DNA ligase. The ligation product served as a template for another PCR with primers FP KO1 and RP KO4. After double digestion with EcoRI and BamHI the knockout fragment was inserted into the multiple cloning site of BamHI-EcoRI-cleaved pk18mobsacB, resulting in plasmid pK18mobsacB⌬porH⌬porA. This plasmid was transformed by electroporation into competent C. glutamicum ATCC 13032 cells. Integration of the plasmid into the chromosome, indicating that the first single-crossover event occurred, was tested by plating the cells on BHIS (brain heart infusion medium with 9.1% D-sorbitol) plates supplemented with 25 ␮g/ml kanamycin. For deletion of the target genes one of the colonies on a plate was grown overnight in liquid LB and spread on BHIS plates containing 10% sucrose. Cells growing on this plate were tested for kanamycin sensitivity by parallel picking on BHIS plates containing either kanamycin or sucrose. Sucrose-resistant and kanamycin-sensitive cells indicated that the second crossover occurred. The deletion was verified by PCR and by DNA sequencing (data not shown). Preparation of the cell wall, plasma membrane, and cytosol fractions. The cell fractions were produced as previously described for mycobacteria (20, 61). Wet cells (5 g) were suspended in 20 ml phosphate buffer (50 mM, pH 7.5), and the resulting bacterial suspension was passed through a cell disrupter and then centrifuged at 4,000 rpm for 15 min to eliminate unbroken cells; cell walls were recovered from the supernatant by centrifugation at 10,000 rpm (8,300 ⫻ g) for 60 min. The 10,000-rpm supernatant was centrifuged at 50,000 rpm (170,000 ⫻ g) for 60 min at 4°C in an ultracentrifuge (Beckmann Omega 90 XL with a 70.1 Ti rotor) to obtain the membrane fraction in the pellet; the supernatant was considered the cytosol fraction (61). The pellets were washed and lyophilized (20) or were used directly for experiments. All fractions were analyzed to determine their protein contents by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) and to determine their pore-forming activities by reconstitution experiments with the black lipid bilayer assay following detergent treatment of the different fractions. Correct separation of the different fractions was determined by their diverse levels of NADH oxidase activity. This activity was measured by detecting the decrease in absorbance at 340 nm (55). The reaction followed first-order kinetics. The specific activity was calculated by dividing the appropriate rate constant (k1) by the relative protein concentration of the sample. Isolation and purification of the channel-forming protein from the cell wall fraction. Whole cells of C. diphtheriae were extracted with a 1:2 mixture of chloroform and methanol by using 1 part cells and 5 to 8 parts organic solvent (38). The protein extracted with the chloroform-methanol mixture was precipitated with ice-cold diethyl ether at ⫺20°C for 24 h and dissolved in 1% Genapol X-80. Further purification was achieved by excising bands at different molecular masses from preparative SDS-PAGE gels and extracting them with 1% Genapol X-80. Possible oligomers of the channel-forming protein were obtained by adding to the protein solution a volume of ethanol that was 2.5-fold greater than the volume of the solution. The protein was then precipitated by incubation at 4°C for 24 h. After centrifugation at 4°C, the resulting pellet was dried under a vacuum to completely remove the remaining ethanol. Digestion of the polypeptide. The purified polypeptide with a molecular mass of about 5 kDa was treated for 5 min with 50 U/ml proteinase K (EC 3.4.21.64; Sigma, St. Louis, MO) in a buffer containing 1% Genapol X-80. SDS-PAGE. Analytical and preparative SDS-PAGE was performed as described by Laemmli (36) or, because of the low resolution of this gel system at low molecular mass, as described by Scha¨gger and von Jagow (66) with Tricinecontaining gels. The gels were stained with Coomassie brilliant blue or with colloidal Coomassie blue (48). Utilizing the colloidal properties of Coomassie brilliant blue G-250, the latter resulted in improved staining of proteins with sensitivity similar to that of silver stain.

VOL. 189, 2007 Immunological techniques. In Western blot (immunoblot) experiments, the proteins separated by 10% Tricine-SDS-PAGE were transferred onto nitrocellulose sheets (Protran; BA83; 0.2 ␮m; Schlëicher & Schuell) in a semidry blotting apparatus as described by Scha¨gger and von Jagow (67). This method is a modification of the procedure described by Keilhauer et al. (33), taking into account the higher ionic strength of Tricine-containing SDS gels. The reactive sites were blocked with 5% skim milk in TBS-T (20 mM Tris-HCl [pH 7.5], 0.01 M NaCl, 0.1% Tween) for 1 h and briefly washed three times with TBS-T. The blots were incubated for 1 h (or overnight) at room temperature with rabbit polyclonal antibodies against C. glutamicum PorA at a dilution of 1:100 (38). After incubation each membrane was washed three times with TBS-T. Bound antibodies were detected by using horseradish peroxidase-coupled rabbit immunoglobulins (DAKO, Denmark) at a dilution of 1:1,000. A color reaction was obtained by using a mixture containing 94% Tris-buffered saline, 6% chloronaphthol (0.3%), and 0.075% hydrogen peroxide. After 10 min of incubation bands appeared. For detection of the monomer we used the ECL Western blot detection system (GE Healthcare, United Kingdom) because chemiluminescent detection provides an extremely sensitive system for detecting small amounts of proteins with extremely low molecular masses. We followed the instructions in the manual supplied by the manufacturer. Signal detection was achieved by incubating the membrane in the detection mixture for 1 min, draining off the mixture, and wrapping the blot in Saran Wrap. Next, we placed the blot into a film cassette and placed a piece of autoradiography film (HyperfilmMP; GE Healthcare, United Kingdom) on top for 15 s to 5 min, as required by the sample. The exposed film was immediately developed by use of X-omat M35 (Kodak). Enzyme-linked immunosorbent assay (ELISA) experiments were carried out as described previously (15). The method used allowed us to perform a rapid, simple, and sensitive ELISA suitable for detection of bacterial surface proteins. Briefly, different amounts of cells were coupled in each well (MaxiSorp immunoplates; Nunc, Roskilde, Denmark). Cells of C. glutamicum ATCC 13032 were used as a positive control, and the corresponding preimmune serum and wells containing either only cells of C. glutamicum or C. diphtheriae ATCC 11913 without any primary antibody were used as negative controls. Absorption at 405 nm was measured with a microplate reader (Thermomax; Molecular Devices). PCR and construction of the expression plasmid. Primers Cdiph_XbaI_for and Cdiph_KpnI_rev (Table 1) were used for PCR amplification of the region which contained the gene coding for the PorA homolog of C. diphtheriae. Chromosomal DNA of strain C8r(⫺) Tox⫺ (⫽ ATCC 11913) was used as a template for PCR amplification. The program consisted of 30 cycles of 1 min of denaturation at 95°C, 1 min of annealing at 45°C, and 2 min of extension at 72°C, using FailSafe polymerase (Epicenter Biotechnologies) with buffer E. Fifty microliters of the reaction mixture was loaded on a 0.8% agarose gel and compared to 1-kb ladder (Gibco-BRL Life Technologies Ltd., Paisley, Scotland, United Kingdom). The PCR product was cut out of the gel, ligated in a TOPO 2.1 vector, and transformed in One Shot Top10 F⬘ cells. Plasmid miniprep of Escherichia coli cells was used for sequencing the PCR product with primers M13 forward and reverse. The gene coding for the prospective cell wall channel and its flanking regions were cut out of the TOPO 2.1 vector using restriction enzymes EcoRI and XbaI. The DNA piece was ligated into the shuttle vector pXMJ19. C. glutamicum ATCC 13032⌬porA⌬porH cells were transformed with the vector by using a slightly modified standard electrotransformation method (74). The transfected cells were grown until the optical density at 600 nm was 3. Then protein expression was induced with 1 mM isopropyl-␤-D-thiogalactopyranoside (IPTG), and the culture was grown for another 16 h. Cells were harvested by centrifugation. Subsequently, the cells were extracted with a 1:2 mixture of chloroform and methanol by using 1 part cells and 5 to 8 parts organic solvent. The protein was precipitated with ether in the cold. Lipid bilayer experiments. The methods used for the lipid bilayer experiments have been described previously in detail (10). The instrument consisted of a Teflon chamber with two aqueous compartments connected by a small circular hole. The hole had a surface area of about 0.3 mm2. Black lipid bilayer membranes were obtained by painting a 1% (wt/vol) solution of diphytanoyl phosphatidylcholine (PC) or phosphatidylserine (PS) (Avanti Polar Lipids, Alabaster, AL) in n-decane onto the hole. Membranes were also formed from PC-mycolic acid (Sigma) or PC-PS-mycolic acid mixtures to study the effect of mycolic acids on channel formation. The temperature was maintained at 20°C during all experiments, and the current recordings were filtered at 300 Hz. All salts were analytical grade and were obtained from Merck (Darmstadt, Germany). Zerocurrent membrane potential measurements were obtained by establishing a salt gradient across membranes containing 100 to 1,000 cell wall porins as described previously (11). Nucleotide sequence accession numbers. The sequences of CdporA from NCTC 13129 and ATCC 11913 have been deposited in the DDBJ/EMBL/

CELL WALL PORIN OF C. DIPHTHERIAE

7711

FIG. 1. Tricine (10%)-SDS-PAGE performed as described by Scha¨gger and von Jagow (66) of the cell wall fraction, the cytoplasmic membrane, and the cytosol of C. diphtheriae ATCC 11913. Lanes 1 to 3 were stained with Coomassie blue, and lane 4 was stained with colloidal Coomassie blue. Lane 1, molecular mass markers (97, 66, 45, 30, 20.1, and 14.4 kDa); lane 2, 15 ␮l of the cell wall fraction (8,300-⫻-g pellet) solubilized at 40°C for 30 min in 1% Genapol X-80 and 5 ␮l sample buffer; lane 3, 15 ␮l of the 8,300-⫻-g supernatant containing the cytoplasmic membrane and cytosol solubilized at 40°C for 30 min in 5 ␮l sample buffer; lane 4, 3 ␮g of the pure cell wall channel protein of C. diphtheriae ATCC 11913 incubated at 100°C for 30 min in 5 ␮l sample buffer.

GenBank databases under accession numbers AM689937 and AM690207, respectively.

RESULTS AND DISCUSSION Isolation and purification of the channel-forming protein. An homogenate of C. diphtheriae ATCC 11913 cells was centrifuged at two different speeds. The pellet from the first centrifugation should have contained the cell walls, and the pellet from the second centrifugation should have contained the cytoplasmic membrane. The supernatant from the second centrifugation was the cytosol of the cells. The pellets and supernatant were inspected to determine their protein contents, NADH oxidase activities, and channel-forming abilities. The greatest channel-forming ability was observed for Genapol X-80 extracts of the cell wall fraction. This fraction was essentially free of cytoplasmic membrane, as assessed by NADH oxidase activity. The NADH oxidase specific activity of the proteins of the cell wall fraction relative to the protein concentration was 0.10. The corresponding specific activities of the proteins of the cytosol and the fraction containing the cytoplasmic membrane relative to the protein concentrations were 0.03 and 0.87, respectively (the total activity of NADH oxidase was defined as 1.0). The proteins of the cytosol and the cytoplasmic membrane showed only very weak single-channel activity, indicating that the cell wall contained most of the channel-forming protein. The detergent-solubilized material from the cell wall fraction produced so many bands in Tricine-SDS-PAGE gels that it was impossible to relate a single band to the channel-forming activity, although there was a strong band in the low-molecular-mass region (Fig. 1). As a further step, whole cells were treated with organic solvents. In the case of the cell wall channel of C. glutamicum this method provided a simple purifica-

7712

SCHIFFLER ET AL.

tion procedure for the channel-forming protein (38). TricineSDS-PAGE of the ether precipitate following chloroformmethanol extraction showed that a protein with a molecular mass of about 5 kDa was enriched in this fraction (data not shown). Further purification of the channel-forming protein was achieved by excising this band from a preparative SDSPAGE gel and extracting it with 1% Genapol X-80 (Fig. 1). Addition of the 5-kDa band to planar lipid bilayers resulted in very fast reconstitution of channels. When regions at different molecular masses were excised from the same SDS-PAGE gel, the highest channel-forming activity was always observed with the 5-kDa band. However, we also noticed that low channelforming activity was smeared across the molecular mass region between about 5 and 70 kDa of the SDS-PAGE gel. This result indicated that the 5-kDa band may represent a channel-forming monomer, as is the case for PorA of C. glutamicum (41). This was confirmed by Tricine-SDS-PAGE of the ethanol precipitate of the 5-kDa protein eluted from the preparative SDSPAGE gel. The corresponding gel showed that the oligomer of the channel-forming protein has an apparent molecular mass of about 66 kDa (data not shown; see below). This is consistent with the situation in C. glutamicum, where PorA or PorH also forms oligomers (30, 41). In this respect it is interesting that the 20-kDa protein MspA of Mycobacterium smegmatis forms an octamer in the cell wall with a molecular mass of 160 kDa (23). The smaller size of the CdPorA oligomer than of the MspA octamer may be explained by the thinner cell wall of corynebacteria. This presumably has to do with the length of the corynomycolic acids, which are considerably shorter (22 to 38 carbon atoms) than the mycolic acids of other members of the mycolata. Forty-three amino acids are presumably sufficient to cross the mycolic acid layer of bacteria belonging to the genus Corynebacterium, whereas longer polypeptides are necessary to cross the cell wall of other members of the taxon mycolata. The mycolic acid layer of a member of the suprageneric actinomycete taxon mycolata acts as a permeability barrier to hydrophilic compounds (31, 52, 53). Our results indicate that the cell wall fraction of C. diphtheriae also contains a channelforming protein, similar to the mycolic acid layer of different members of the taxon Corynebacterineae (13, 38, 49, 62, 71, 72). The channel-forming activity of the cell wall was rather high with respect to the protein concentration. In addition, the NADH oxidase activity of this fraction, which is a marker of the cytoplasmic membrane, was rather low. This result ruled out the possibility that we were dealing with a contaminant protein responsible for channel formation. Furthermore, it is clear that the channels can be present only in the cell wall of C. diphtheriae and not in the cytoplasmic membrane. Otherwise, the presence of these high-conducting channels would result in cell death. Interaction of the cell wall protein with lipid bilayer membranes. Conductance measurement experiments were performed with lipid bilayer membranes to study the interaction of the cell wall protein with artificial membranes. Membranes were formed from 1% PC or PC-PS mixtures (molar ratio, 4:1) dissolved in n-decane. Addition of the 5-kDa cell wall protein at a low concentration (100 ng/ml) to one or both sides of the lipid membranes resulted in a strong increase in the conductance. The increase in conductance was not sudden; it was a

J. BACTERIOL.

FIG. 2. Single-channel recording for a PC–n-decane membrane in the presence of the channel-forming 5-kDa protein from the cell wall of C. diphtheriae ATCC 11913 (trace I). The aqueous phase contained 1 M KCl and 10 mM Tris-HCl (pH 7), and 10 ng/ml cell wall protein was added 2 min before the start of the recording. The applied membrane potential was 20 mV, and the temperature was 20°C. Trace II shows the results for a control without the 5-kDa protein.

function of time after addition of the protein to membranes in the black state. Within about 20 to 30 min the membrane conductance increased by several orders of magnitude above that of membranes without the protein (from about 0.05 to 150 ␮S/cm2). Only a small further increase (compared with the initial increase) occurred after that time. Similar results were obtained when the membranes were formed from PC-PS-mycolic acid mixtures to study the effect of mycolic acids on channel formation, suggesting that the mycolic acid did not influence channel formation. Control experiments with Genapol X-80 alone at the same concentration as that in the experiments with protein demonstrated that the membrane activity was caused by the presence of the cell wall protein and not by the detergent. Similarly, proteolytic degradation of the purified 5-kDa protein using proteinase K for 5 min completely destroyed its channel-forming ability. Single-channel analysis. Addition of lower concentrations of the cell wall porin (10 ng/ml) to PC–n-decane membranes allowed resolution of stepwise increases in conductance. Figure 2 shows a single-channel recording obtained in the presence of the 5-kDa protein, which was added 5 min after the membrane was in the black state. A few minutes after the addition of the protein, the current increased in step-like fashion because of reconstitution of long-lasting channels, which led to superposition of the steps. The current steps had a long lifetime (mean lifetime, more than 5 min). Figure 3 shows a


VOL. 189, 2007

FIG. 3. Histogram of the probability of the occurrence of a given conductivity observed with membranes formed with PC–n-decane in the presence of the cell wall protein of C. diphtheriae ATCC 11913. The aqueous phase contained 1 M KCl and 10 mM Tris-HCl (pH 7). The applied membrane potential was 20 mV, and the temperature was 20°C. The average single-channel conductance was 2.25 nS for 148 single-channel events.

histogram of the conductance fluctuations observed under the conditions used to obtain Fig. 2 (membrane potential, 20 mV; 1 M KCl, 10 mM Tris-HCl [pH 7]). Besides a major conductance step of about 2.25 nS (more than 30% of all conductance fluctuations) we observed channels with higher single-channel conductance, in particular channels with single-channel conductance of about 4.5 nS. The latter channels are presumably dimers of the 2.25-nS channel that could not be separated with the time resolution of our experimental setup. Under the lowvoltage conditions used to obtain Fig. 2, all the steps were directed upwards, which indicated that the channels were always in the open state. Changing the PC membranes to membranes consisting of other lipid mixtures, such as PC-PS (molar ratio, 4:1), PC-mycolic acid (molar ratio, 4:1), or PC-mycolic acid-PS (molar ratio, 4:4:1) membranes, did not influence the single-channel conductance of the porin. Single-channel experiments were also performed with salts containing ions other than K⫹ and Cl⫺. These experiments were done to obtain some insight into the biophysical properties of the cell wall porin of C. diphtheriae. The results summarized in Table 2 show that the channel is only moderately selective. This conclusion was derived from experiments in which KCl was replaced by LiCl or KCH3COO. Replacement of the mobile ions K⫹ and Cl⫺ by the less mobile ions Li⫹ and acetate⫺ showed that cations and anions have a certain permeability through the channels of C. diphtheriae. The permeability of the cations through the channels followed approximately their mobility in the aqueous phase. This probably means that the cell wall porin is a wide channel, which has only a low field strength inside and no small-molecule selectivity filter (i.e., no binding site), as suggested by the fact that the large organic Tris⫹ cation could also penetrate the channel. Table 2 also shows the average single-channel conductance as a function of the KCl concentration in the aqueous phase. The values for single-channel conductance always corresponded to the maximum on the left in the histograms (i.e., to the 2.25-nS peak in the case of 1 M KCl). Measurements were obtained down to 0.03 M KCl. In contrast to other cell wall

7713

channels of members of the mycolata (38, 40, 64, 70), we observed a linear relationship between single-channel conductance and KCl concentration, which would be expected for wide water-filled channels that do not contain point charges similar to those formed by gram-negative bacterial porins (7, 8, 9, 75). The CdPorA channel sorts mainly according to the molecular mass of the solutes, similar to the function of general diffusion pores in gram-negative bacteria (8, 9). This channel definitely represents the major permeability pathway of the cell wall, similar to the situation in C. glutamicum (18). This result is very surprising because to date only cell wall channels in members of the taxon mycolata that contain charges in or near the channel opening have been identified (Table 3). The channel described in this study is the first channel in the Corynebacterineae that does not contain point charges. This also means that the single-channel analysis does not allow estimation of the channel size, as was the case for other cell wall channels investigated to date (38, 40, 62, 63, 64). On the other hand, the size of the CdporA channel could be very similar to the size of the channel formed by PorA of C. glutamicum because of the sequence homology between CdPorA and PorA (see below). PorA and PorH have diameters of about 2.2 nm, and it is possible that the size of the CdPorA channel is similar (Table 3). Selectivity of the cell wall channel of C. diphtheriae. Zerocurrent membrane potential measurements were determined to obtain further information on the molecular structure of the C. diphtheriae cell wall channel. The experiments were performed in the following way. After incorporation of 100 to 1,000 channels into the PC membranes, the salt concentration on one side of the membranes was raised fivefold beginning with 100 mM, and the zero-current potential was measured 5 min after every increase in the salt gradient across the membrane. For KCl and KCH3COO the more diluted side of the membrane (100 mM) always became positive, whereas negative membrane potentials were observed for LiCl (Table 4). This result indicates that the channel functions as a general diffusion pore, which simply filters the solutes, as already de-

TABLE 2. Average single-channel conductance of the cell wall channel of C. diphtheriae ATCC 11913 in different salt solutionsa Salt

Concn (M)

Conductance (nS)

KCH3COO (pH 6) CsCl NH4Cl N(CH3)4Cl Tris-Cl (pH 6)

1.0 1.0 0.03 0.1 0.3 0.6 1.0 3.0 1.0 1.0 1.0 1.0 1.0

1.25 1.60 0.06 0.40 0.60 1.25 2.25 6.00 1.25 2.50 2.25 0.80 0.90

LiCl NaCl KCl

a The membranes were formed with 1% PC dissolved in n-decane. The aqueous solutions were buffered with 10 mM Tris-HCl, and the pH was 7 unless otherwise indicated. The applied voltage was 20 mV, and the temperature was 20°C. The average single-channel conductance was calculated from at least 80 single events derived from measurements of at least four individual membranes.

7714

SCHIFFLER ET AL.

J. BACTERIOL.

TABLE 3. Comparison of the cell wall channel properties of C. diphtheriae, C. glutamicum, Mycobacterium chelonae, and Nocardia farcinica Channel diam (nm) estimated bya: Conductance (nS) in 1 M KCl

Cation/anion permeability ratio in KCl

Point charge at the channel mouth

2.25

1.26

None

C. glutamicum ATCC 13032 PorA PorH PorB

5.5 2.5 0.70

8.1 5.1 0.12

⫺2.0 ⫺2.0 1.5

Rhodococcus erythropolis

6.0

Rhodococcus equi ReqPorA ReqPorB

4.0 0.30

Mycobacterium chelonae

2.7

Nocardia farcinica

3.0

8.2

1.3

Streptomyces griseus

0.85

1.3

None

Cell wall porin

C. diphtheriae ATCC 11913

11.8

Liposome swelling

14

⫺1.5 1.5 2.5

Effect of negative point charges

Reference(s) or source

This study

2.7

9.0 0.16

Single-channel conductance

2.2 2.2

2.2 2.2 1.4

38 30 18

2

2

62

1.8 1.4

2.0 1.4

62

2.0

70, 72

1.6

62

2.2 1.4

30

a

The channel diameters were estimated by using the liposome swelling assay, from the single-channel conductance as a function of the hydrated ion radii, or from the effect of negative point charges on single-channel conductance.

termined for general diffusion pores of gram-negative bacteria (9). Analysis of the membrane potential using the GoldmanHodgkin-Katz equation (11) confirmed the assumption that anions and cations are permeable through the channel. The cation/anion permeability ratios were 0.72 (LiCl), 1.26 (KCl), and 3.26 (potassium acetate). This means that the selectivity of the CdPorA channel was dependent on the mobility of the ions in the aqueous phase. Cell wall channel of C. diphtheriae is voltage dependent. In single-channel recordings the cell wall porin exhibited some flickering at higher voltages; i.e., it showed rapid transitions between open and closed configurations. This could have been caused by voltage-dependent closing of the cell wall porin. This was studied in separate experiments. The channel-forming protein was added at a concentration of 100 ng/ml to one side of a black PC–n-decane membrane (the cis side). After 30 min the conductance had increased considerably. At this point different positive and negative potentials were applied to the cis

TABLE 4. Zero-current membrane potentials of PC–n-decane membranes in the presence of the cell wall channel of C. diphtheriae ATCC 11913 measured for a fivefold gradient of different saltsa Salt

Cation/anion permeability ratio

Membrane potential (mV)

KCl LiCl KCH3COO

1.26 0.72 3.26

5.4 ⫺1.2 17.5

a The zero-current membrane potential is defined as the difference between the potential on the dilute side and the potential on the concentrated side. The aqueous salt solutions were buffered with 10 mM Tris-HCl (pH 7), and the temperature was 20°C. The cation/anion permeability ratio was calculated using the Goldman-Hodgkin-Katz equation (11) and the results of at least three individual experiments.

side of the membrane. For negative and positive potentials at the cis side of the membrane the current decreased in an exponential fashion (data not shown). This result indicated that the voltage dependence of the cell wall channel is symmetrical. Addition of the protein to the trans side of the membrane or to both sides of the membrane also resulted in a symmetric response to the applied voltage (data not shown). The data obtained in the experiments were analyzed in the following way. The membrane conductance (G) as a function of voltage (Vm) was measured when the opening and closing of channels reached an equilibrium (i.e., after exponential decay of the membrane current following the voltage step). G was divided by the initial value for the conductance (G0) (which was a linear function of the voltage) obtained immediately after the onset of the voltage. The data in Fig. 4 indicate the symmetrical voltage dependence of the cell wall porin (mean of four membranes) when the protein was added to the cis side. To study the voltage dependence in more detail, the data in Fig. 4 were analyzed assuming a Boltzmann distribution between the number of open and closed channels (No and Nc, respectively) (42): No/Nc ⫽ exp关nF共Vm ⫺ Vo兲/RT兴

(1)

where F, R, and T are the Faraday constant, gas constant, and absolute temperature, respectively, n is the number of charges moving through the entire transmembrane potential gradient for channel gating, and Vm equals Vo, which is the potential at which 50% of the total number of channels is in the closed configuration. The ratio of open channels to closed channels (No/Nc) may be calculated from the data in Fig. 4 using the following equation: No/Nc ⫽ 共G ⫺ Gmin兲/共Go ⫺ G兲

(2)

VOL. 189, 2007


7715

FIG. 4. Conductance (G) at a given membrane potential (Vm) divided by the conductance at 10 mV (G0) expressed as a function of the membrane potential. The symbols represent the means of four measurements, in which the 5-kDa protein from C. diphtheriae ATCC 11913 was added to the cis side of membranes. The solid line represents the fit of the experimental data using equations 1 and 2 and the following parameters: n ⫽ 1; and Vo ⫽ ⫺48 mV (left side of the curve) and Vo ⫽ 46 mV (right side of the curve). The aqueous phase contained 1 M KCl, 10 mM Tris-HCl (pH 7.0), and 100 ng/ml porin. The membranes were formed from PC dissolved in n-decane. The temperature was 20°C.

where G is the conductance at a given membrane potential (Vm) and Go and Gmin are the conductance at 10 mV (conductance of the open state) and the conductance at very high potentials, respectively. The data in Fig. 4 could be fitted to combination of equations 1 and 2. The fit (Fig. 4) allowed calculation of the number of gating charges (n) (number of charges involved in the gating process) and the midpoint potential (Vo) (potential at which the numbers of open and closed channels are identical). The midpoint potential for the addition of the protein to the cis side was for an applied positive voltage of 46 mV and for an applied negative voltage of ⫺48 mV. The gating charge in both cases was close to 1. Immunological detection of the channel-forming protein of C. diphtheriae. A channel-forming low-molecular-mass peptide is present in the cell wall of C. glutamicum (38, 41). To check the possible relationship between this peptide and the 5-kDa channel-forming protein of C. diphtheriae, a Western blot analysis was performed using a polyclonal antibody directed against the porin of C. glutamicum. The channel-forming protein of C. glutamicum was purified as described previously (38) and used as a control. We observed strong cross-reactivity of the antibodies with the 5-kDa channel-forming protein of C. diphtheriae and its oligomer (Fig. 5, lanes 1 and 2), indicating the presence of highly conserved immunodominant epitopes. It has to be noted, however, that it was not possible to show monomers and oligomers in one slot of the Western blot because of the very different blotting times of monomers and oligomers. In the next step an ELISA was performed with whole cells to confirm the localization of the 5-kDa protein on the surface of C. diphtheriae cells. Different amounts of cells were coupled in the wells. Experiments with immobilized cells of C. glutamicum and C. diphtheriae resulted in very low signals using the preimmune serum, similar to the signals that were detected using immobilized cells treated without any primary

FIG. 5. Western blot analysis of CdporA of C. diphtheriae ATCC 11913. An SDS-PAGE gel containing CdPorA oligomers and CdporA monomers was blotted onto a nitrocellulose membrane, which was probed with anti-PorA polyclonal antibodies. Bands were detected using horseradish peroxidase-conjugated antibodies and chloronaphthol-hydrogen peroxide as the substrate. Lane 1, C. diphtheriae porin oligomers; lane 2, CdporA monomers. Note that monomers and oligomers cannot be shown in one slot because of the very different blotting times of monomers and oligomers due to their different molecular masses.

antibody (Fig. 6). The anti-PorA antibody detected immobilized cells of both C. glutamicum and C. diphtheriae. The results of the ELISA experiments (Fig. 6) demonstrated that the antigenic structures of PorA and the 5-kDa protein are localized on the surface of the cells, which is in agreement with their

FIG. 6. Detection of CdporA of C. diphtheriae on the cell wall surface using an ELISA. Intact cells of C. diphtheriae ATCC 11913 and C. glutamicum ATCC 13032 were immobilized and incubated with anti-PorA (dilution, 1:100), preimmune serum (dilution, 1:1,000), and buffer. The maximum binding was defined as 100%, and the number of cells per well is indicated. The bars show the results of at least eight experiments; the error bars indicate standard deviations.

7716

SCHIFFLER ET AL.

J. BACTERIOL.

FIG. 7. Amino acid sequence of CdporA of C. diphtheriae NCTC 13129 and comparison with the amino acid sequences of CdporA of C. diphtheriae ATCC 11913, PorA of C. glutamicum ATCC 13032, and hypothetical PorA protein of C. efficiens AJ12310 using Pole Bioinformatique Lyonnaise network protein sequence analysis (http://npsa-pbil.ibcp.fr). The charged residues of the proteins are indicated at the top. Conserved residues in the four homolog proteins are indicated by bold type.

function as cell wall channels. This result suggests that CdPorA is accessible from the surface by anti-PorA antibodies, which means that it could be used as an antigenic structure also in vaccination. Approximately the same concentration of protein on the surface was observed on C. glutamicum and C. diphtheriae cells, indicating that the cell walls of the two species contain the same number of channels. Control experiments with preimmune serum demonstrated that the antibodies were highly specific for both cell surfaces (Fig. 6). In addition, the antibodies did not react with cell wall proteins of members of the mycolata other than C. diphtheriae, C. glutamicum, Corynebacterium efficiens, and C. callunae (data not shown). In particular, they did not react with cell wall extracts of Corynebacterium xerosis and Corynebacterium amycolatum (60), suggesting that the immune reaction described here was not a nonspecific interaction. This finding also suggested that these corynebacteria do not contain PorA-like proteins. Identification of the gene coding for the cell wall channel of C. diphtheriae ATCC 11913. The immunological cross-reactivity between PorA and the cell wall channel of C. diphtheriae ATCC 11913 suggested an interesting homology between the two proteins. Similarly, we previously observed Southern hybridization of the porA gene with DNA from C. diphtheriae (41), suggesting that this organism contains a porA-like gene. An NCBI BLAST translation tool search (1, 77) using porA of C. glutamicum with the known genome of C. diphtheriae NCTC 13129 (16) suggested that this genome contained an open reading frame (ORF) between the genes coding for GroEL2 (DIP2020) (6) and a putative secreted protein (DIP2017) that could code for a low-molecular-mass cell wall protein similar to PorA (Fig. 7). This means that the ORF is localized in a region homologous to the region in the C. glutamicum genome containing porA. Primers were designed to clone the whole region between the DIP2020 (GroEL2) and DIP2017 genes using DNA of C. diphtheriae ATCC 11913 as a template (Table 1). The PCR product was cloned into the TOPO 2.1 vector and was sequenced. It contained the ORF (132 bp) coding for a PorA-like protein that showed only some minor amino acid changes (11 residues) compared with the corresponding protein of C. diphtheriae NCTC 13129 (Fig. 7). The protein was designated CdPorA (for C. diphtheriae pore-forming protein A). CdPorA is 43 amino acids long (with the inducer methionine) and has a (calculated) molecular mass of 4,640 Da. The

CdporA studied here has one more negatively charged amino acid than the strain NCTC 13129 protein (a total of five glutamic and aspartic acids, compared to four lysines), which agrees with its small cation selectivity. This is in contrast to the highly cation-selective PorA channel of C. glutamicum (five negatively charged amino acids, compared with a single lysine) and possibly also to the hypothetical PorA protein of C. efficiens (four negatively charged amino acids, compared with two lysines [Fig. 7]). Positive and negative amino acids are balanced for CdporA of strain NCTC 13129. A 5⬘-AAAGG-3⬘ sequence was found eight nucleotides upstream of the start codon of cdporA, which could act as a ribosome binding site. Comparative analysis with the accessible genome of C. diphtheriae NCTC 13129 revealed the same result. A stem-loop structure suitable to be a putative termination signal of mRNA transcription could be identified downstream from the stop codon (TAG) with the tool TransTermHP (http://transterm .cbcb.umd.edu). TransTermHP is an algorithm to find rho-independent terminators in bacterial genomes (34). The palindromic sequences of C. diphtheriae ATCC 11913 (5⬘-AAAAGGGCCC GCATCTAAAAGCGGGTCCTTTT-3⬘) and C. diphtheriae NCTC 13129 (5⬘-ATAAGGGCCCGCATCTAAAAGCGG GCCCTTTT-3⬘) have free energy levels of ⫺15.5 and ⫺17.8 kcal/mol, respectively (http://www.genebee.msu.su). CdporA of both strains also does not contain any C-terminal sorting signal for targeting to the cell wall similar to that of PorA and PorH of C. glutamicum (30, 41). On the other hand, as demonstrated here, CdporA is clearly a protein localized in the cell wall of C. diphtheriae. The absence of any obvious signal peptide suggests that its translocation through the cytoplasmic membrane requires an export system different from the Sec system normally responsible for protein sorting and export in gram-positive bacteria (24, 47, 58, 68). Expression of cdporA in C. glutamicum ATCC 13032⌬porA⌬ porH and study of its channel-forming ability. The results of the search for a gene encoding a channel-forming protein in the genome of C. diphtheriae NCTC 13129 suggested that CdporA could be the channel-forming protein in the cell wall. cdporA was expressed in C. glutamicum ATCC 13032⌬porA⌬porH, and whole cells were extracted with organic solvents. Proteins were precipitated with ether in the cold. The precipitate was dissolved in 1% Genapol X-80, and channel formation was inves-

VOL. 189, 2007


7717

700 pS in 1 M KCl (17, 18). This result revealed the close structural and functional relationship between PorA and CdporA. It is noteworthy that the cell wall porin of C. diphtheriae had no properties similar to those of the porins found in the cell walls of other distantly related actinomycetes, which have molecular masses of about 20 kDa (49, 63) (see Table 3 for a comparison of cell wall channels from a variety of different actinomycetes). ACKNOWLEDGMENTS We thank Franziska G. Rieß for her contribution in the early stages of this study and Christian Andersen for helpful discussions. This investigation was supported by grants from the Deutsche Forschungsgemeinschaft (grant BE865-12/1) and the Fonds der Chemischen Industrie. REFERENCES

FIG. 8. (A) Single-channel recording for a PC–n-decane membrane in the presence of organic solvent extracts of C. glutamicum ATCC 13032⌬porA⌬porH cells transfected with shuttle vector pXMJ19 dissolved in Genapol X-80. Expression of CdporA was induced with 1 mM IPTG. The aqueous phase contained 1 M KCl and 10 mM Tris-HCl (pH 7), and 20 ng/ml of the organic solvent extract was added about 2 min before the start of the recording. The applied membrane potential was 20 mV, and the temperature was 20°C. Trace II shows the results for a control performed with 20 ng/ml organic solvent extract of C. glutamicum ATCC 13032⌬porA⌬porH cells added about 2 min before the start of the recording. (B) Histogram of the probability of the occurrence of a given conductivity observed with membranes formed with PC–n-decane in the presence of 20 ng/ml of the organic solvent extract of C. glutamicum ATCC 13032⌬porA⌬porH cells transfected with shuttle vector pXMJ19 dissolved in Genapol X-80. The aqueous phase contained 1 M KCl and 10 mM Tris-HCl (pH 7). The applied membrane potential was 20 mV, and the temperature was 20°C. The average single-channel conductance was 2.25 nS for 101 single-channel events.

tigated with the lipid bilayer assay using membranes prepared from PC–n-decane. The precipitate had high channel-forming activity with a single-channel conductance of 2.25 nS, the same as that of purified CdporA under the same conditions (Fig. 8A). Control experiments with extracts from PorA/PorH-deficient C. glutamicum cells showed only a limited number of small channels that were presumably caused by PorB/PorC (Fig. 8A), which forms small channels with a conductance of

1. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403–410. 2. Anderson, G. S., and J. B. Penfold. 1973. An outbreak of diphtheria in a hospital for the mentally subnormal. J. Clin. Pathol. 26:606–615. 3. Barksdale, L. 1959. Lysogenic conversions in bacteria. Bacteriol. Rev. 23: 202–212. 4. Barksdale, L. 1970. Corynebacterium diphtheriae and its relatives. Bacteriol. Rev. 34:378–422. 5. Barksdale, L. 1981. The genus Corynebacterium, p. 1827–1837. In M. P. Starr, H. Stoll, H. G. Tru ¨per, A. Balows, and H. G. Schlegel (ed.), The prokaryotes. Springer-Verlag, Berlin, Germany. 6. Barreiro, C., E. Gonzalez-Lavado, M. Patek, and J. F. Martin. 2004. Transcriptional analysis of the groES-groEL1, groEL2, and dnaK genes in Corynebacterium glutamicum: characterization of heat shock-induced promoters. J. Bacteriol. 186:4813–4817. 7. Benz, R. 1988. Structure and function of porins from Gram-negative bacteria. Annu. Rev. Microbiol. 42:359–393. 8. Benz, R. 1994. Solute uptake through the bacterial outer membrane, p. 397–423. In J. M. Ghuysen and R. Hakenbeck (ed.), Bacterial cell wall. Elsevier Science B.V., Amsterdam, The Netherlands. 9. Benz, R. 2001. Porins—structure and function, p. 227–246. In G. Winkelmann (ed.), Microbial transport systems. Wiley-VCH, Weinheim, Germany. 10. Benz, R., K. Janko, W. Boos, and P. La üger. 1978. Formation of large, ion-permeable membrane channels by the matrix protein (porin) of Escherichia coli. Biochim. Biophys. Acta 511:305–319. 11. Benz, R., K. Janko, and P. La üger. 1979. Ionic selectivity of pores formed by the matrix protein (porin) of Escherichia coli. Biochim. Biophys. Acta 551: 238–247. 12. Bonnet, J. M., and N. T. Begg. 1999. Control of diphtheria: guidance for consultants in communicable disease control. Commun. Dis. Public Health 2:242–249. 13. Brennan, P. J., and H. Nikaido. 1995. The envelope of mycobacteria. Annu. Rev. Biochem. 64:29–63. 14. Bricaire, F. 1996. Diphtheria: apropos of an epidemic. Presse Med. 25:327– 329. 15. Burkovski, A. 1997. Rapid detection of bacterial surface proteins using an enzyme-linked immunosorbent assay system. J. Biochem. Biophys. Methods 34:69–71. 16. Cerdeno-Tarraga, A. M., A. Efstratiou, L. G. Dover, M. T. Holden, M. Pallen, S. D. Bentley, G. S. Besra, C. Churcher, K. D. James, A. De Zoysa, T. Chillingworth, A. Cronin, L. Dowd, T. Feltwell, N. Hamlin, S. Holroyd, K. Jagels, S. Moule, M. A. Quail, E. Rabbinowitsch, K. M. Rutherford, N. R. Thomson, L. Unwin, S. Whitehead, B. G. Barrell, and J. Parkhill. 2003. The complete genome sequence and analysis of Corynebacterium diphtheriae NCTC13129. Nucleic Acids Res. 31:6516–6523. 17. Costa-Riu, N., A. Burkovski, R. Kra ¨mer, and R. Benz. 2003. PorA represents the major cell wall channel of the gram-positive bacterium Corynebacterium glutamicum. J. Bacteriol. 185:4779–4786. 18. Costa-Riu, N., E. Maier, A. Burkovski, R. Kra ¨mer, F. Lottspeich, and R. Benz. 2003. Identification of an anion-specific channel in the cell wall of the gram-positive bacterium Corynebacterium glutamicum. Mol. Microbiol. 50: 1295–1308. 19. Daffe´, M., and P. Draper. 1998. The envelope layers of mycobacteria with reference to their pathogenicity. Adv. Microb. Physiol. 39:131–203. 20. Daffe´, M., P. J. Brennan, and M. McNeil. 1990. Predominant structural features of the cell wall arabinogalactan of Mycobacterium tuberculosis as revealed through characterisation of oligoglycosyl alditol fragments by gas chromatography/mass spectrometry and by NMR-analyses. J. Biol. Chem. 265:6734–6743.

7718

SCHIFFLER ET AL.

21. Dixon, J. M. S., W. C. Noble, and G. R. Smith. 1990. Diphtheria; other corynebacterial and coryneform infections, p. 55–79. In M. T. Parker and L. H. Collier (ed.), Principles of bacteriology, virology and immunity. Bacterial diseases, vol. 3. Toppley and Wilson’s Arnold, London, United Kingdom. 22. Eggeling, L., and H. Sahm. 1999. Glutamate and L-lysine: traditional products with impetuous developments. Appl. Microbiol. Biotechnol. 52: 146–153. 23. Faller, M., M. Niederweis, and G. E. Schulz. 2004. The structure of a mycobacterial outer-membrane channel. Science 303:1189–1192. 24. Freudl, R. 1992. Protein secretion in gram-positive bacteria. J. Biotechnol. 23:231–240. 25. Galazka, A. M., and S. E. Robertson. 1995. Diphtheria: changing patterns in the developing world and industrialized world. Eur. J. Epidemiol. 11:107– 117. 26. Goodfellow, M., M. D. Collins, and D. E. Minnikin. 1976. Thin-layer chromatographic analysis of mycolic acid and other long-chain components in whole organism methanolysates of coryneform and related taxa. J. Gen. Microbiol. 96:351–358. 27. Harnisch, J. P., E. Tronca, C. M. Nolan, M. Turck, and K. K. Holmes. 1989. Diphtheria among alcoholic urban adults. Ann. Intern. Med. 111:71–82. 28. Holmes, R. K. 2000. Biology and molecular epidemiology of diphtheria toxin and the tox gene. J. Infect. Dis. 181:116–120. 29. Holt, J. G., N. R. Krieg, P. H. A. Sneath, J. T. Staley, and S. T. Williams (ed.). 1994. Bergey’s manual of determinative biology, 9th ed., p. 625–650. The Williams and Wilkins Co., Baltimore, MD. 30. Hu ¨nten, P., N. Costa-Riu, D. Palm, F. Lottspeich, and R. Benz. 2005. Identification and characterization of PorH, a new cell wall channel of Corynebacterium glutamicum. Biochim. Biophys. Acta 1715:25–36. 31. Jarlier, V., and H. Nikaido. 1990. Permeability barrier to hydrophilic solutes in Mycobacterium chelonae. J. Bacteriol. 172:1418–1423. 32. Keilhauer, C., L. Eggeling, and H. Sahm. 1993. Isoleucine synthesis in Corynebacterium glutamicum: molecular analysis of the ilvB-ilvN-ilvC operon. J. Bacteriol. 175:5595–5603. 33. Khyse-Andersen, J. 1984. Electroblotting of multiple gels: a simple apparatus without buffer tank for rapid transfer of proteins from polyacrylamide to nitrocellulose. J. Biochem. Biophys. Methods 10:203–209. 34. Kingsford, C. L., K. Ayanbule, and S. L. Salzberg. 2007. Rapid, accurate, computational discovery of Rho-independent transcription terminators illuminates their relationship to DNA uptake. Genome Biol. 8:R22. 35. Kinoshita, S., S. Udaka, and M. Shimono. 1957. Studies on the amino acid fermentation. Production of L-glutamate by various microorganisms. J. Gen. Appl. Microbiol. 3:193–205. 36. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680–685. 37. Leuchtenberger, W. 1996. Amino acids—technical production and use. Products of primary metabolism, p. 465–502. In H. J. Rehm, A. Pu ¨hler, G. Reed, and P. J. W. Stadler (ed.), Biotechnology, vol. VI. Wiley-VCH, Weinheim, Germany. 38. Lichtinger, T., A. Burkovski, M. Niederweis, R. Kra ¨mer, and R. Benz. 1998. Biochemical and biophysical characterization of the cell wall channel of Corynebacterium glutamicum: the channel is formed by a low molecular mass subunit. Biochemistry 37:15024–15032. 39. Lichtinger, T., B. Heym, E. Maier, H. Eichner, S. T. Cole, and R. Benz. 1999. Evidence for a small anion-selective channel in the cell wall of Mycobacterium bovis BCG besides a wide cation-selective pore. FEBS Lett. 454:349– 355. 40. Lichtinger, T., G. Reiss, and R. Benz. 2000. Biochemical identification and biophysical characterization of a channel-forming protein from Rhodococcus erythropolis. J. Bacteriol. 182:764–770. 41. Lichtinger, T., F. G. Riess, A. Burkovski, F. Engelbrecht, D. Hesse, H. D. Kratzin, R. Kramer, and R. Benz. 2001. The low-molecular-mass subunit of the cell wall channel of the Gram-positive Corynebacterium glutamicum. Immunological localization, cloning and sequencing of its gene porA. Eur. J. Biochem. 268:462–469. 42. Ludwig, O., V. De Pinto, F. Palmieri, and R. Benz. 1986. Pore formation by the mitochondrial porin of rat brain in lipid bilayer membranes. Biochim. Biophys. Acta 860:268–276. 43. MacGregor, R. R. 1995. Corynebacterium diphtheriae, p. 1865–1872. In G. L. Mandell, J. E. Bennett, and R. Dolin (ed.), Principles and practices of infectious diseases. Churchill Livingstone, New York, NY. 44. Marienfeld, S., E.-M. Uhlemann, R. Kra ¨mer, and A. Burkovski. 1997. Ultrastructure of the Corynebacterium glutamicum cell wall. Antonie Leeuwenhoek 72:291–297. 45. Minnikin, D. E. 1987. Chemical targets in cell envelopes, p. 19–43. In M. Hopper (ed.), Chemotherapy of tropical diseases. John Wiley & Sons Ltd., Chichester, United Kingdom. 46. Minnikin, D. E., P. V. Patel, and M. Goodfellow. 1974. Mycolic acids of representative strains of Nocardia and the ‘rhodochrous’ complex. FEBS Microbiol. Lett. 39:322–324. 47. Navarre, W. W., and O. Schneewind. 1999. Surface proteins of gram-positive

J. BACTERIOL.

48.

49.

50. 51. 52. 53.

54.

55.

56.

57. 58.

59.

60.

61.

62.

63.

64.

65.

66.

67.

68.

69. 70.

71. 72. 73.

74.

bacteria and mechanisms of their targeting to the cell wall envelope. Microbiol. Mol. Biol. Rev. 63:174–229. Neuhoff, V., N. Arnold, D. Taube, and W. Erhardt. 1988. Improved staining of proteins in polyacrylamide gels including isoelectric focusing gels with clear background at nanogram sensitivity using Coomassie Brilliant Blue G-250 and R-250. Electrophoresis 9:255–262. Niederweis, M., S. Ehrt, C. Heinz, U. Klo ¨cker, S. Karosi, K. M. Swiderek, L. W. Riley, and R. Benz. 1999. Cloning of the mspA gene encoding a porin from Mycobacterium smegmatis. Mol. Microbiol. 33:933–945. Nikaido, H. 1992. Porins and specific channels of bacterial outer membranes. Mol. Microbiol. 6:435–442. Nikaido, H. 2003. Molecular basis of bacterial outer membrane permeability revisited. Microbiol. Mol. Biol. Rev. 67:593–656. Nikaido, H., and V. Jarlier. 1991. Permeability of the mycobacterial cell wall. Res. Microbiol. 142:437–443. Nikaido, H., S. H. Kim, and E. Y. Rosenberg. 1993. Physical organisation of lipids in the cell wall of Mycobacterium chelonae. Mol. Microbiol. 8:1025– 1030. Ochi, K. 1995. Phylogenetic analysis of mycolic acid-containing wall chemotype IV actinomycetes and allied taxa by partial sequencing of ribosomal protein AT-L30. Int. J. Syst. Bacteriol. 45:653–660. Osborn, M. J., J. E. Gander, E. Parisi, and J. Carson. 1972. Mechanism of assembly of the outer membrane of Salmonella typhimurium. Isolation and characterization of cytoplasmic and outer membrane. J. Biol. Chem. 247: 3973–3986. Oteo, J., B. Aracil, A. J. Ignacio, and L. J. Gomez-Garces. 2001. Significant bacteremias by Corynebacterium amycolatum: an emergent pathogen. Enferm. Infect. Microbiol. Clin. 19:103–106. Pappenheimer, A. M., and J. R. Murphy. 1983. Studies on the molecular epidemiology of diphtheria. Lancet ii:923–926. Peyret, J. L., N. Bayan, G. Joliff, T. Gulik-Krzywicki, L. Mathieu, E. Schechter, and G. Leblon. 1993. Characterization of the cspB gene encoding PS2, an ordered surface-layer protein in Corynebacterium glutamicum. Mol. Microbiol. 9:97–109. Prospero, E., M. Raffo, M. Bagnoli, R. Appignanesi, and M. M. D’Errico. 1997. Epidemiological update and review of prevention strategies. Eur. J. Epidemiol. 13:527–534. Puech, V., M. Chami, A. Lemassu, M. Laneélle, B. Schiffler, P. Gounon, N. Bayan, R. Benz, and M. Daffe´. 2001. Structure of the cell envelope of corynebacteria: importance of the non-covalently bound lipids in the formation of the cell wall permeability barrier and fracture plane. Microbiology 147:1365–1382. Raynaud, C., G. Etienne, P. Peyron, M. A. Laneelle, and M. Daffe. 1998. Delineation of extracellular enzymic activities potentially involved in the pathogenicity of Mycobacterium tuberculosis. Microbiology 144:577–587. Rieß, F. G., and R. Benz. 2000. Discovery of a novel channel-forming protein in the cell wall of the non-pathogenic Nocardia corynebacteroides. Biochim. Biophys. Acta 1509:485–495. Rieß, F. G., T. Lichtinger, R. Cseh, A. F. Yassin, K. P. Schaal, and R. Benz. 1998. The cell wall channel of Nocardia farcinica: biochemical identification of the channel-forming protein and biophysical characterization of the channel properties. Mol. Microbiol. 29:139–150. Rieß, F. G., U. Do ¨rner, B. Schiffler, and R. Benz. 2001. Study of the properties of a channel forming protein of the cell wall of the gram-positive bacterium Mycobacterium phlei. J. Membr. Biol. 182:147–157. Sahm, H., L. Eggeling, B. Eikmanns, and R. Kra ¨mer. 1996. Construction of L-lysine-, L-threonine-, and L-isoleucine-overproducing strains of Corynebacterium glutamicum. Ann. N. Y. Acad. Sci. 782:25–39. Scha ¨gger, H., and G. von Jagow. 1987. Tricine-sodium dodecyl sulfatepolyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 KDa. Anal. Biochem. 166:368–379. Scha ¨gger, H., and G. von Jagow. 1991. Blue native electrophoresis for isolation of membrane protein complexes in enzymatically active form. Anal. Biochem. 199:223–231. Schneewind, O., D. Mihaylova-Petkov, and P. Model. 1993. Cell wall sorting signals in surface proteins of gram-positive bacteria. EMBO J. 12:4803–4811. Sutcliffe, I. C. 1997. Macroamphiphilic cell envelope components of Rhodococcus equi and closely related bacteria. Vet. Microbiol. 56:287–299. Trias, J., and R. Benz. 1993. Characterization of the channel formed by the mycobacterial porin of Mycobacterium chelonae in lipid-bilayer membranes: demonstration of voltage dependent regulation and the presence of negative point charges at the channel mouth. J. Biol. Chem. 268:6234–6240. Trias, J., and R. Benz. 1994. Permeability of the cell wall of Mycobacterium smegmatis. Mol. Microbiol. 14:283–290. Trias, J., V. Jarlier, and R. Benz. 1992. Porins in the cell wall of mycobacteria. Science 258:1479–1481. Udaka, S. 1960. Screening method for microorganisms accumulating metabolites and its use in the isolation of Micrococcus glutamicus. J. Bacteriol. 79:745–755. van der Rest, M. E., C. Lange, and D. Molenaar. 1999. A heat shock

VOL. 189, 2007 following electroporation induces highly efficient transformation of Corynebacterium glutamicum with xenogeneic plasmid DNA. Appl. Microbiol. Biotechnol. 52:541–545. 75. Weiss, M. S., A. Kreusch, E. Schlitz, U. Nestel, W. Welte, J. Weckesser, and G. E. Schultz. 1991. The structure of porin from Rhodobacter capsulatus at 1.8A resolution. FEBS Lett. 280:379–382.


7719

76. Yano, I., and K. Saito. 1972. Gas chromatographic and mass spectrometric analysis of molecular species of corynomycolic acids from Corynebacterium ulcerans. FEBS Lett. 23:352–356. 77. Zhang, J., and T. L. Madden. 1997. PowerBLAST: a new network BLAST application for interactive or automated sequence analysis and annotation. Genome Res. 7:649–656.