JOURNAL OF BACTERIOLOGY, Jan. 2007, p. 410–421 0021-9193/07/$08.00⫹0 doi:10.1128/JB.01205-06 Copyright © 2007, American Society for Microbiology. All Rights Reserved.
Vol. 189, No. 2
Cys303 in the Histidine Kinase PhoR Is Crucial for the Phosphotransfer Reaction in the PhoPR Two-Component System in Bacillus subtilis䌤 Amr Eldakak† and F. Marion Hulett* Laboratory for Molecular Biology, Department of Biological Sciences, University of Illinois at Chicago, Chicago, Illinois 60607 Received 2 August 2006/Accepted 23 October 2006
The PhoPR two-component system activates or represses Pho regulon genes to overcome a phosphate deficiency. The Pho signal transduction network is comprised of three two-component systems, PhoPR, ResDE, and Spo0A. Activated PhoP is required for expression of ResDE from the resA promoter, while ResD is essential for 80% of Pho induction, establishing a positive feedback loop between these two-component systems to amplify the signal received by the Pho system. The role of ResD in the Pho response is via production of terminal oxidases. Reduced quinones inhibit PhoR autophosphorylation in vitro, and it was proposed that the expression of terminal oxidases leads to oxidation of the quinone pool, thereby relieving the inhibition. We show here that the reducing environment generated by dithiothreitol (DTT) in vivo inhibited Pho induction in a PhoR-dependent manner, which is in agreement with our previous in vitro data. A strain containing a PhoR variant, PhoRC303A, exhibited reduced Pho induction and remained sensitive to inhibition by DTT, suggesting that the mechanisms for Pho reduction via PhoRC303A and DTT are different. PhoR and PhoRC303A were similar with regard to cellular concentration, limited proteolysis patterns, rate of autophosphorylation, stability of PhoR⬃P, and inhibition of autophosphorylation by DTT. Phosphotransfer between PhoR⬃P or PhoRC303A⬃P and PhoP occurred rapidly; most label from PhoR⬃P was transferred to PhoP, but only 10% of the label from PhoRC303A⬃P was associated with PhoP, while 90% was released as inorganic phosphate. No difference in PhoP⬃P or PhoR autophosphatase activity was observed between PhoR and PhoRC303A that would explain the release of inorganic phosphate. Our data are consistent with a role for PhoRC303 in PhoR activity via stabilization of the phosphoryl-protein intermediate(s) during phosphotransfer from PhoR⬃P to PhoP, which is stabilization that is required for efficient production of PhoP⬃P. In prokaryotes, two-component signal transduction systems are ubiquitous and allow bacteria to sense fluctuations in the environment and create the appropriate cellular response. Bacillus subtilis is a gram-positive bacterium which lives in the soil, an environment in which the amount of organic phosphate is limited (45). Upon receiving an environmental signal of phosphate limitation, the histidine kinase PhoR is autophosphorylated and activates the Pho regulon genes by phosphorylating its cognate response regulator, PhoP (23, 35). Together, the products of the Pho regulon genes allow the cell to overcome the phosphate limitation in the environment (Pho response), at least temporarily. The Pho regulon genes include genes encoding high-affinity phosphate transporters (15, 51), alkaline phosphatases and phosphodiesterases (2, 9, 12, 13, 24, 25, 29), and biosynthetic cell wall polymers (33, 34, 36, 40), as well as genes with unknown functions (e.g., ykoL) (1, 52). We have identified a network of at least three signal transduction systems that have a role in the phosphate deficiency response of B. subtilis. The interconnected pathways involve the PhoP-PhoR system, whose primary role is the phosphate deficiency response (8, 22, 23, 58), the Spo0 phosphorelay required for initiation of sporulation (10), and a signal trans-
duction system, ResD-ResE, which also has a role in aerobic and anaerobic respiration (41, 42, 49, 59, 65). Two parallel pathways positively regulate the Pho response via PhoP-PhoR. One pathway includes the ResD-ResE system, while the other involves a transition state regulator, AbrB (23, 58). The Spo0 system represses the Pho response by negatively regulating both pathways. A ⌬spo0A strain hyperinduces the Pho regulon (500%). Deletion mutations in resD reduce Pho induction by 80%, and deletion mutations in abrB reduce Pho induction by 20%. ⌬spo0A ⌬abrB or ⌬spo0A ⌬resD double mutants hyperinduce the Pho regulon 200 and 300%, respectively (23, 58). A ⌬abrB ⌬resD double mutant is as Pho negative as a ⌬phoPR mutant, as is a ⌬spo0A ⌬abrB ⌬resD triple mutant. Thus, the two upstream pathways are as important to Pho regulation as phoPR and the phosphate deficiency signal. PhoP has a direct role in activating the Res system during phosphate-limited growth, resulting in a positive feedback loop amplifying both two-component systems during phosphate starvation (8). Although a ⌬resD ⌬abrB double mutant grew and Pi culture levels decreased to levels similar to the levels observed for the wild-type strain, this mutant has the same Pho phenotype as ⌬phoPR mutant strain (56). Thus, low concentrations of Pi were not sufficient to induce the Pho response in a ⌬resD ⌬abrB double mutant. In conclusion, Pi is essential, but the level is dependent on ResD and/or AbrB for induction of the Pho response. The role of ResD in Pho regulation is now believed to be indirect, involving positive modulation of the PhoR signal as ResD is essential for synthesis of type a cytochromes aa3 and caa3 that oxidize MKH2 (reduced menaquinone), an inhibitor
* Corresponding author. Mailing address: Laboratory for Molecular Biology, Department of Biological Sciences, University of Illinois at Chicago, 900 S. Ashland Avenue (M/C 567), Chicago, IL 60607. Phone: (312) 996-5460. Fax: (312) 413-2691. E-mail:
[email protected]. † Present address: Stowers Institute for Medical Research, 1000 E. 50th Street, Kansas City, MO 64110. 䌤 Published ahead of print on 3 November 2006. 410
VOL. 189, 2007
EFFECT OF Cys303 ON PhoR REGULATION
411
FIG. 1. Topology of PhoRWT and different PhoR truncations. Boxes TM1 and TM2 represent the transmembrane domains. The arrows labeled PAS represent the predicted PAS domain, which runs from residue 235 to residue 341. The boxes labeled DHP and CA represent the conserved kinase domain (DHp, dimerization and histidine phosphotransfer domain; CA, catalytic and ATP-binding domain). The asterisks indicate the sites of different cysteine residues in the sequence of PhoR. The site of cysteine residue Cys303 is flanked by cationic amino acids. The PAS domain was identified using the CLC protein workbench-pfam software (version 1.2). C15, C21, C160, and C303 indicate the domain positions the cysteine residues in PhoR.
of PhoR autophosphorylation (53). Recent data have shown that a spontaneous null mutation in ydiH (a repressor of cydABCD) allows aberrant expression of bd oxidase (cydABCD) that can bypass the ResD role in cytochrome aa3 and caa3 synthesis required for PhoR signal modulation (53). PhoR is a prototypical histidine kinase (48, 57) which has two hydrophobic transmembrane domains; hence, it resides in the cytoplasmic membrane, enclosing a long periplasmic domain (55). The second transmembrane domain is followed by a long cytoplasmic linker region (179 residues) connecting the N-terminal domain, followed by the highly conserved catalytic domain (54). A putative PAS domain (62) is present in the cytoplasmic linker region (amino acids 235 to 341) closer to the C-terminal domain (Fig. 1). The C-terminal domain contains the dimerization domain, which contains the phosphorylatable histidine residue His360, followed by the catalytic ATP-binding domain (55). A model consistent with our previous results predicts that under phosphate-replete conditions, cells growing exponentially have reduced menaquinones in their membranes that negatively regulate the Pho response through inhibition of PhoR autophosphorylation. Upon phosphate starvation, cells enter the stationary phase and produce ResD in a phoPRdependent manner. ResD is essential for terminal oxidase synthesis, which is required for oxidation of reduced quinones, thereby relieving the inhibition of autophosphorylation of PhoR to fully induce the Pho response. For Escherichia coli, Kobayashi and Ito provided the first link between disulfide bond formation in DsbB and the electron transfer chain (30). Bader et al. showed that ubiquinone is the first electron acceptor of DsbB (3) and that oxidation of reduced quinones is catalyzed by terminal oxidases that finally transfer electrons to oxygen. Bardwell and colleagues showed that there is a novel quinone reduction activity in DsbB through the formation of a disulfide bond and identified a ubiquinone-binding site in DsbB (4, 64). In the Arc system of E. coli, the redox state of quinones was identified as the redox signal, providing another link between the electron transport
chain and gene expression (19). Malpica et al. showed that the formation of an intermolecular disulfide bond between two cytosolic redox-active cysteine residues due to the oxidative power of oxidized quinones results in ArcB silencing (37). Swem et al. showed that in RegB of Rhodobacter capsulatus, the oxidized form of ubiquinone inhibits the autophosphorylation of RegB independent of the redox-active cysteine, Cys265 (60). A ubiquinone-binding site was identified in the periplasmic domain of RegB, and this site is a conserved heptapeptide sequence (GGXXNPF) (60). In this study, we explored the possibility that the reduced form of quinones inhibits the autophosphorylation of PhoR through a redox-active cysteine residue. Here we provide evidence that Cys303 of PhoR is essential for full Pho induction as it is significantly involved in the phosphotransfer between PhoR⬃P and PhoP. MATERIALS AND METHODS Bacterial strains and plasmids. Strains and plasmids used in this study are shown in Table 1. E. coli DH5␣ was used as the host for plasmid construction. E. coli BL21(DE3)/pLysS (Novagen) was used as the host for overexpressing the PhoR and PhoP proteins. To construct MH7133 (Pspac-phoPR173::Tetr amyE::phoA-lacZ Spr), primer FMH557 with a 5⬘ HindIII site and primer FMH558 with a 5⬘ SmaI site were used to amplify the phoP gene using JH642 chromosomal DNA as the template. The PCR product was cloned into pCR2.1 (Invitrogen) to create pAE01, and the phoP sequence was confirmed by sequencing. The phoP fragment in pAE01 was released by digestion with HindIII and SmaI and cloned into the complementary sites in pLS53 (55) to create pAE07. Plasmid pAE07 was transformed into MH6110 (11) to create MH7133; successful clones were analyzed for Pho induction of phoA-lacZ on low-phosphate complex medium plates containing 30 g/ml X-Gal (5-bromo-4-chloro-3-indolyl--D-galactoside) with or without 1 mM isopropyl--D-thiogalactopyranoside (IPTG) (50). To construct MH7134 (⌬phoR::Tetr amyE::tuaA-lacZ Cmr), chromosomal DNA from MH5538 (amyE::tuaA-lacZ Cmr) (33, 34, 36, 40) was used to transform MH5124 (⌬phoR::Tetr) (26). Transformants were selected on tryptose blood agar base plates with 0.5% glucose containing the antibiotics tetracycline (10 g/ml) and chloramphenicol (5 g/ml). Successful clones resistant to both antibiotics were checked on low-phosphate complex medium plates with X-Gal for the right phenotype.
412
ELDAKAK AND HULETT
J. BACTERIOL. TABLE 1. Bacterial strains, plasmids, and primers
Strain, plasmid, or primer
Genotype, characteristics, or sequencea
E. coli strains DH5␣ BL21(DE3)/pLysS XL1-Blue
Source or reference
Lab stock Novagen Stratagene
B. subtilis strains JH642 MH5124 MH5538 MH5913 MH6110 MH6111 MH7133 MH7134 MH7135 MH7136 MH7137 MH7138
pheA1 trpC2 pheA1 trpC2 phoR⌬Bal1::Tetr pheA1 trpC2 amyE::tuaA-lacZ Cmr pheA1 trpC2 ⌬phoPR ⌬EcoRI::Tetr pheA1 trpC2 ⌬phoPR ⌬EcoRI::Tetr amyE::phoA-lacZ Spcr MH6110⍀/pCH102 MH6110⍀/pAE07 pheA1 trpC2 phoR⌬Bal1::Tetr amyE::tuaA-lacZ Cmr MH6110⍀/pAE27 MH6110⍀/pAE28 MH6110⍀/pAE29 MH6110⍀/pAE30
J. Hoch 26 36 11 11 11 This study This study This study This study This study This study
Plasmids pCR2.1 pDH88 pCH102 pLS53 pLS21 pWL32 pAE01 pAE07 pAE27 pAE28 pAE29 pAE30 pAE31 pAE32
Vector for cloning PCR products, Ampr Kanr oriEc Pspac promoter, Cmr pDH88::phoPRWT 5⬘-polA (750 bp) pDH88::Pspac-phoR173 Ampr Cmr pGEX-2T GST-*phoR fusion, Ampr pET16b::phoP, Ampr pCR2.1:: P, Ampr pDH88::phoPR173 pDH88::phoPWTRC15A 5⬘-polA (750 bp) pDH88::phoPWTRC21A 5⬘-polA (750 bp) pDH88::phoPWTRC160A 5⬘-polA (750 bp) pDH88::phoPWTRC303A 5⬘-polA (750 bp) pGEX-2T GST-*phoRC303A fusion, Ampr pET16b::phoPD53A, Ampr
Invitrogen D. Henner 11 55 This study 55 This study This study This study This study This study This study This study This study
140
phoPD53A/pAE32 phoRC15A/pAE27 phoPD53A/pAE32 phoRC15A/pAE27 phoRC21A/pAE28 phoRC21A/pAE28 phoRC160A/pAE29 phoRC160A/pAE29 phoRC303A/pAE30 phoRC303A/pAE30 phoP/pAE01 phoP/pAE01
Primersb FMH892 FMH896 FMH893 FMH897 FMH898 FMH899 FMH900 FMH901 FMH902 FMH903 FMH557c FMH558c
CTGATTTGATTGTGCTTGCGGTGATGCTTCCAAAATTG177 GTATTCGTTGTCGCCATGATTCTGGTGTTTTG62 177 CAATTTTGGAAGCATCACCGCAAGCACAATCAAATCAG140 62 CAAAACACCAGAATCATGGCGACAACGAATAC31 48 GATTCTGGTGTTTGCCGTCCTCGGGCTGTTTTTAC82 82 GTAAAAACAGCCCGAGGACGGCAAACACCAGAATC48 462 GCTGACGGCCAGTCTTGCCACCGCATTTATCG493 493 CGATAAATGCGGTGGCAAGACTGGCCGTCAGC462 891 GACGGAGACAAAGAAAGCCAAGCTGTTAAGACTG924 924 CAGTCTTAACAGCTTGGCTTTCTTTGTCTCCGTC891 ATAAGCTT⫺11GGAGGCACAGCATGAACAAGAAAATTTTAG19 CACCCGGG723TTATTCATTCATTTTTGGCTCCTCCAG697 31
Tetr, tetracycline resistance; Cmr, chloramphenicol resistance; Spcr, spectinomycin resistance; Ampr, ampicillin resistance; Kanr, kanamycin resistance. The numbers are relative to the PhoP or PhoR ⫹ 1 start site (ATG). c The underlined sequences are added restriction sites. FMH558 has a HindIII site, and FMH588 has a SmaI site. a b
To generate B. subtilis strains with IPTG-inducible phoPR operons with different cysteine mutations in phoR, pCH102 (11) was used as a template for site-directed mutagenesis. Using a QuickChange site-directed mutagenesis kit (Stratagene) and different primers (Table 1) to change each cysteine codon in phoR (Cys15, Cys21, Cys160, and Cys303) individually to an alanine codon, plasmids pAE27 (C15A), pAE28 (C21A), pAE29 (C160A), and pAE30 (C303A) were generated. All the mutated plasmids were transformed into E. coli XL1Blue competent cells, and clones were selected on LB plates with ampicillin (100 g/ml). Cysteine mutations in successful clones were confirmed by sequencing. Each plasmid (pAE27 to pAE30) was transformed into MH6110, where it integrated into the chromosome by Campbell insertion. Chloramphenicol-resistant transformants were checked to determine the position of homologous integration (3⬘ or 5⬘ of the Tet gene in the chromosome) by PCR, and strains with integration 3⬘ of the Tet gene were selected. Strains MH7135 to MH7138 grown in low-phosphate defined medium (LPDM) (24) were analyzed for IPTG-depen-
dent Pho induction. Successful clones that had the complete phoPR operon (with different cysteine mutations) under control of the Pspac promoter were selected for our in vivo experiments. pLS21 (55) was used as a template for changing Cys303 to alanine using the QuickChange site-directed mutagenesis kit to generate pAE31, which was used for overexpression and purification of *PhoRC303A. The required mutation was confirmed by DNA sequencing, pAE31 was transformed into E. coli XL1-Blue (Stratagene), and the successful transformant was used to overexpress the PhoRC303A protein. To generate pAE32, pWL32 was used as a template to change Asp53 in PhoP to alanine using the QuickChange site-directed mutagenesis kit. Enzyme assays. Alkaline phosphatase (APase) specific activity was determined in cells that had been grown in LPDM as described previously (24) with 1 mM IPTG added to the medium at time zero. The APase specific activity was expressed as the ratio of the number of units of APase activity (mol/min
VOL. 189, 2007
EFFECT OF Cys303 ON PhoR REGULATION
p-nitrophenol at 37°C) to the optical density at 540 nm of the culture. The method of Ferrari et al. was used to determine the -galactosidase specific activity (units per mg protein), using O-nitrophenol--D-galactopyranoside as the substrate (16). One unit was defined as 0.33 mol of O-nitrophenol produced at 37°C. The amount of total cell protein was calculated as described previously (13). Overexpression and purification of proteins. E. coli strain BL21(DE3)/pLysS was used as a host for plasmids pLS21, pAE31, pAE32, and pWL32 to overexpress GST-*PhoR, GST-*PhoRC303A, His10-PhoPD53A, and His10-PhoP, respectively (Table 1). *PhoR is the soluble cytoplasmic part of the PhoR protein (from amino acid 231 to the end of the C terminus). Glutathione S-transferase (GST)tagged *PhoR was overexpressed and purified, and the GST tag was removed as described previously (55). Overexpression and purification of His-tagged PhoP in E. coli and cleavage of the His tag were performed as described previously (35). Autophosphorylation of PhoR and PhoRC303A with or without menaquinone. Purified *PhoRWT and *PhoRC303A (2 M) were incubated with 5 Ci of [␥-32P]ATP (specific activity, 6,000 Ci/mmol; 10 mCi/ml; GE Healthcare) and 50 M ATP at room temperature in P buffer (50 mM HEPES [pH 8.0], 50 mM KCl, 50 mM MgCl2) with or without the soluble form of menadione, MK3 (2 mM; Sigma-Aldrich), and/or dithiothreitol (DTT) (5 mM; Invitrogen). To start the reaction, [␥-32P]ATP was added, and samples were removed at different times (see Fig. 5). The reaction was terminated by adding 3 l of 5⫻ sodium dodecyl sulfate (SDS) loading sample buffer. Ten-microliter samples were loaded onto 12% SDS–polyacrylamide gel electrophoresis (PAGE) gels (32). The radioactivity of PhoR⬃P on the dried gels was determined using a PhosphorImager (Molecular Dynamics) and was quantitated by using ImageQuant (version 5.1). To determine the stability of *PhoRC303A⬃P in vitro relative to the stability of *PhoRWT⬃P, glutathione beads (400 mg) were washed with P buffer and then mixed with 200 g GST-*PhoRC303A or GST-*PhoRWT on a rocker at room temperature for 15 min. The beads were washed with 20 volumes of P buffer to remove the unbound component, and the extra buffer was removed by centrifugation for 10 s. Bound protein was autophosphorylated by adding 200 Ci [␥-32P]ATP to the beads and incubating the preparation for 20 min at room temperature. The beads were washed thoroughly with P buffer until the flowthrough was free of ATP. The beads with bound protein were suspended in 400 l of P buffer containing 50 U of thrombin (Sigma-Aldrich) and incubated at room temperature for 20 min. The released *PhoRC303A⬃P or *PhoRWT⬃P was recovered by centrifugation through Micro Bio-Spin P-30 chromatography columns (Bio-Rad). Phosphorylated proteins were incubated at room temperature, samples were removed at different times, and 5⫻ SDS loading buffer (2.0 l) was added to stop the reaction. Samples were analyzed on SDS-PAGE gels and dried, and radioactivity was determined with a PhosphorImager and quantitated with ImageQuant. Phosphotransfer assays. To determine if *PhoRC303A can phosphorylate PhoP at a rate comparable to the rate observed for *PhoRWT, purified *PhoRWT⬃P or PhoRC303A⬃P free of ATP was prepared as described above. For phosphotransfer assays, either *PhoRWT⬃P or *PhoRC303A⬃P free of ATP was mixed with PhoP (molar ratio, 1:1) in P buffer. Samples were removed at different times (see Fig. 6B) and mixed with 5⫻ SDS loading buffer (0.2 volume) to terminate the reaction. Samples were applied to 12% SDS–PAGE gels and dried, and radioactivity was determined with a PhosphorImager and quantitated with ImageQaunt. To determine if the interaction of *PhoRC303A⬃P with PhoP triggers phosphatase activity, *PhoRC303A was autophosphorylated as described above. *PhoRC303A⬃P (with no trace of radioactive ATP) was mixed with PhoPD53A (molar ratio, 1:1) at room temperature for 20 min. Samples were removed at different times (see Fig. 7) and treated as described above. To check the other possibility, that the interaction of *PhoRC303A with PhoPWT⬃P triggers phosphatase activity, PhoPWT was phosphorylated using *PhoRWT (55). PhoPWT⬃P was mixed with *PhoRC303A (molar ratio, 1:1) at room temperature for 20 min. Samples were removed at different times (see Fig. 7), and the procedures described above were performed. Thin-layer chromatography. To determine if *PhoRC303A⬃P lost radioactive label as Pi, a 3-l sample of each phosphotransfer reaction mixture was spotted onto a silica gel plate. Potassium phosphate buffer (0.25 M; pH 8.0) was used as the run buffer, and all procedures were performed as described previously (55).
RESULTS Repression of Pho induction in vivo by the reducing power generated by DTT is PhoR dependent. Autophosphorylation of *PhoRWT (Fig. 1) was inhibited in the presence of the reduced form of MK3, while addition of the oxidized form did not affect
413
*PhoRWT autophosphorylation (53). These results suggested that *PhoR autophosphorylation was affected by the redox state of quinones in vitro. B. subtilis MH6111, a strain containing the phoPRWT operon under control of the IPTG-inducible Pspac promoter (11), was used to test whether the reducing power in vivo inhibited the autophosphorylation of PhoR, resulting in attenuation of Pho induction. The phoPR173 operon encoding a truncated form of PhoR (Fig. 1) was cloned in plasmid pDH88 downstream of the IPTG-inducible Pspac promoter to construct pAE07 (Pspac-phoPR173) for use in determining if the transmembrane domains were required for the action of DTT. Plasmid pAE07 was transformed into B. subtilis strain MH6110 (⌬phoPR::Tetr phoA-lacZ), and B. subtilis strain MH7133 (Pspac-phoPR173) transformants were selected. Expression of the phoA-lacZ fusion was measured as a reporter for Pho induction. MH6111 (Fig. 2A) and MH7133 (Fig. 2B) were grown in LPDM until the onset of Pho induction; each culture was split into two flasks, a flask to which 10 mM DTT was added and a flask without DTT. Addition of DTT to the culture did not affect the growth of the strains, while Pho induction, as indicated by phoA-lacZ expression, was reduced about 75% in both strains (Fig. 2A and B). These data suggested that the intracellular reducing environment generated by DTT inhibited Pho induction. This raised the question of whether DTT repression of the Pho system PhoR is dependent or not dependent. Expression of most known Pho regulon genes that have been tested is dependent on PhoR; the exceptions are the pstS and tuaA promoters, which showed low levels of expression in the absence of phoR (34, 51). In contrast, no expression of any Pho regulon gene, including the pstS and tuaA promoters, has been observed in a phoP mutant. Competent cells of MH5538 (tuaA-lacZ) were transformed with chromosomal DNA from MH5124 (⌬phoR::Tetr) to generate MH7134 (⌬phoR::Tetr tuaA-lacZ). Addition of DTT (10 mM) to an MH5538 culture resulted in repression of Pho induction, as indicated by tuaAlacZ fusion expression (Fig. 2C), while in an MH7134 culture (⌬phoR::Tetr) the DTT-generated reducing environment did not affect the level of tuaA-lacZ expression (Fig. 2D). Similar results with DTT using a ⌬phoR mutant and the wild-type strain were obtained when a pstS-lacZ fusion was used (data not shown). The repression of Pho induction when DTT was added to a wild-type culture (Fig. 2C) but not when DTT was added to a ⌬phoR culture (Fig. 2D) suggested that the PhoPR system was repressed by the reducing environment inside the cell and that redox sensing was mediated exclusively through the histidine kinase PhoR. Cys303Ala mutation reduces Pho induction. Redox cysteine centers have been identified in different proteins, including ArcB (37), CtrJ (39), and RegB (61). Malpica et al. showed that the formation of an intermolecular disulfide bond between two cytosolic redox-active residues results in ArcB silencing due to the oxidative power of oxidized quinones (37). PhoR contains four cysteine residues (Fig. 1), three in the transmembrane domains (Cys15, Cys21, and Cys160) and Cys303 in the linker region. To test whether any cysteine residue is involved in the PhoR sensing of the redox state of quinones, all four cysteine residues (Fig. 1) in the phoPR operon in pCH102, a plasmid which contains the phoPR operon under control of the IPTG-induc-
414
ELDAKAK AND HULETT
J. BACTERIOL.
FIG. 2. Repression of Pho induction in vivo by the reducing power generated by DTT is PhoR dependent. (A and B) The reducing power generated by DTT repressed Pho induction in vivo in PhoRWT and truncated PhoR173: effect of DTT on growth and phoA-lacZ expression by B. subtilis strains MH6111 (Pspac-PRWT) (A) and MH7133 (Pspac-phoPR173) (B) cultured in LPDM containing IPTG. (C and D) Repression of Pho induction by DTT is PhoR dependent: effect of DTT on growth of and tuaA-lacZ expression by B. subtilis strains MH5538 (PRWT) (C) and MH7134 (⌬phoR) (D) cultured in LPDM. Solid symbols, growth; open symbols, -galactosidase specific activity; squares, no DTT added; circles, DTT added at zero time. OD540, optical density at 540 nm; Beta-gal and -gal, -galactosidase.
ible Pspac promoter, were mutated individually (11). For details see Materials and Methods. Total APase specific activity was used as a reporter for Pho induction. During growth in LPDM, the APase expression in JH642 (PWT-phoPRWT) (Fig. 3A) was greater than that in MH6111 (Pspac-phoPRWT) (Fig. 3B). B. subtilis strains MH7135 (Pspac-phoPRCys15A), MH7136 (Pspac-phoPRCys21A), and MH7137 (Pspac-phoPRCys160A) had APase levels similar to the level in MH6111 (Pspac-phoPRWT), while the expression in strain MH7138 (Pspac-phoPRCys303Ala) was reduced ⬃60%. These in vivo data showed that a Cys303Ala mutation in PhoR negatively affected Pho induction under phosphate starvation conditions.
Western immunoblotting using cell lysates of phoPRWT (MH6111), phoPR deletion (MH5913), and phoPRC303A (MH7138) strains grown in LPDM indicated that the reduction in Pho induction was not due to degradation of the PhoRC303A variant protein inside the cell but was due to the in vivo activity of PhoRC303A (data not shown). These results indicated that Cys303 in PhoR is required for full activation of the Pho system in vivo. Cys303Ala mutation reduces Pho induction independent of the repression effect of the DTT-generated reducing power. It was central for our study to determine whether the histidine kinase PhoR requires the Cys303 residue for sensing the redox state inside the cell via menaquinone. Compared to MH6111
VOL. 189, 2007
EFFECT OF Cys303 ON PhoR REGULATION
415
FIG. 3. Effects of different cysteine mutations in PhoR on Pho induction. The Cys303Ala mutation reduced Pho induction in LPDM. Growth of and APase production by B. subtilis strains cultured for 12 h in LPDM with IPTG were determined. Solid symbols, growth; open symbols, APase production. (A) JH642 (wild type); (B) MH6111 (Pspac-phoPRWT); (C to F) strains with different cysteine mutations in PhoR. IPTG was added at time zero to all cultures. OD540, optical density at 540 nm.
(Pspac-phoPRWT), the strain containing the PhoRC303A variant (MH7138) exhibited an approximately 60% reduction in Pho induction as judged by the total amount of APase (Fig. 3F) and a similarly decreased level when phoA-lacZ expression was used as the Pho reporter (Fig. 4). The reducing power generated by the cell-penetrating reductant DTT repressed phoAlacZ expression about 75% in either the strain containing the phoPRWT operon (MH6111) or strain MH7138 with the phoPRC303A operon (Fig. 4). Although DTT-generated reducing power in the MH7138 culture (Fig. 4) repressed Pho induction about 75%, a reduction similar to the reduction due to DTT inhibition in MH6111 (phoPRWT), the total inhibition (C303A mutation and DTT) was greater in MH7138 (about 90%) than in wild-type strain MH6111 (about 75%). If residue Cys303 were solely responsible for PhoR sensing
of the redox state inside the cell, it would be expected that the inhibition of Pho induction in a wild-type strain by addition of DTT would be similar to that in phoPRC303A strain MH7138 (Fig. 4) grown without DTT. In contrast, our results indicated that residue Cys303 is involved in the PhoR regulation of Pho induction through a different mechanism because the level of repression of Pho induction showed a cumulative effect of both PhoRC303A mutation and the reducing environment generated by addition of DTT. *PhoRC303A is structurally similar to *PhoRWT. Soluble truncated forms of PhoR, *PhoR (55), and *PhoRC303A were purified from E. coli to determine the effect of Cys303 on the PhoR function in vitro. Limited proteolysis was used to determine if the conformation of the *PhoRC303A variant protein was similar to that of *PhoRWT. The proteinase K degradation
416
ELDAKAK AND HULETT
FIG. 4. Cys303Ala mutation reduces Pho induction through a mechanism different from the repression effect of the reducing power: effect of DTT on phoA-lacZ expression in B. subtilis strains cultured in LPDM containing IPTG. Circles, MH6111 (Pspac-phoPRWT); squares, MH7138 (Pspac-phoPRC303A); solid symbols, without DTT; open symbols, with DTT. DTT was added to appropriate cultures at time zero. Beta-gal, -galactosidase.
profiles of *PhoRC303A and *PhoRWT were similar, suggesting that the conformation of the *PhoRC303A protein was not dramatically different than the conformation of *PhoRWT (data not shown).
J. BACTERIOL.
Cys303Ala mutation does not change the rate of autophosphorylation or the effect of reduced menaquinone on the rate of autophosphorylation. To determine if autophosphorylation of *PhoRC303A was affected, purified *PhoRWT or *PhoRC303A protein was incubated with [␥-32P]ATP. Samples of each reaction mixture were collected at different times, analyzed by SDS-PAGE, dried, and exposed with a PhosphorImager (Fig. 5A, right panel). Quantitation of autophosphorylation (Fig. 5A, left panel) showed that the rates of the reactions for *PhoRC303A and *PhoRWT were similar. Our previous work showed that the autophosphorylation of PhoR is inhibited in the presence of the reduced form of menaquinone (53). In vivo data (Fig. 4) suggested that residue Cys303 was not responsible for the inhibitory effect of the reduced environment on Pho induction; rather, Cys303 was apparently required for PhoR regulation through a different mechanism. To test these in vivo results, the *PhoRC303A response to the redox state of menaquinone was tested in vitro. Purified *PhoRC303A protein was incubated with [␥-32P]ATP in the presence and absence of MK3 and/or DTT (Fig. 5B). Unlike MK3 in the oxidized form or DTT alone, the reduced form of MK3 (DTT reduced) caused significant inhibition of *PhorC303A autophosphorylation. This experiment showed that the Cys303Ala mutation did not change the *PhoRC303A response to the redox state of MK3 from what was previously reported for *PhoRWT (53). Together, the in vitro data suggested that *PhoRC303A is similar to *PhoRWT with respect to conformation, autophosphorylation (Fig. 5A), and the response to the redox state of
FIG. 5. Autophosphorylation analysis of *PhoRC303A in vitro. (A) Comparison of the rates of autophosphorylation of *PhoRC303A and PhoRWT in vitro. Purified proteins were incubated with [␥-32P]ATP. The right panels show autoradiograms of different reactions, while in the left panel quantitation of radioactive *PhoRC303A⬃P is expressed in arbitrary units, as determined using ImageQuant. (B) Effect of the redox state of menaquinone on the rate of autophosphorylation of *PhoRC303A. Purified proteins were incubated with [␥-32P]ATP in the presence or absence of menaquinone and/or DTT. The results were analyzed on SDS-PAGE gels. Samples were removed from each reaction mixture at different times. The reaction was terminated by addition of SDS loading buffer. Samples were analyzed by SDS-PAGE and dried, and radioactivity was quantified. E, *PhoRC303A plus ATP; 䊐, *PhoRC303A plus ATP plus menadione; ‚, *PhoRC303A plus ATP plus menadione plus DTT; 〫, *PhoRC303A plus ATP plus DTT.
VOL. 189, 2007
EFFECT OF Cys303 ON PhoR REGULATION
417
FIG. 6. PhoRC303A is defective for the ability to phosphotransfer to PhoP. (A) Stability of *PhoRWT⬃P and *PhoRC303A⬃P in vitro. Purified proteins (*PhoRWT⬃P and *PhoRC303A⬃P free of ATP) were incubated at room temperature, and samples were removed at different times. Adding 5⫻ SDS loading buffer stopped the reactions, and samples were analyzed by SDS-PAGE, dried, and exposed to a PhosphorImager. Radioactivity was quantified using ImageQuant (left panel). (B) *PhoRWT and *PhoRC303A were phosphorylated by incubating the proteins with [␥-32P]ATP. Excess [␥-32P]ATP was removed. *PhoR⬃P was mixed with an equimolar amount of PhoP, and samples were collected at different times. Reactions were stopped with 5⫻ SDS loading buffer, samples were subjected to 12% SDS–PAGE, and autoradiographs were developed. (C) Three-microliter samples from *PhoRC303A phosphotransfer reaction mixtures (reactions were stopped with 5⫻ SDS loading buffer) were applied to a silica gel plate and developed in potassium phosphate buffer to separate *PhoRC303A and labeled Pi (lanes 2 to 10). Labeled 32P was used as a control (lane 1). The silica gel plate was dried and exposed to a PhosphorImager. The radioactive released Pi was quantified using ImageQuant.
MK3 (Fig. 5B). Thus, the in vivo and in vitro results indicated that residue Cys303 is not required for the repression pathway via reduced menaquinone; rather, it regulates the activity of the histidine kinase PhoR through an unknown mechanism. Efficiency of phosphotransfer of *PhoR to its cognate response regulator, PhoP, is decreased by Cys303Ala mutation. To determine the stability of *PhoRC303A⬃P in vitro relative to the stability of *PhoRWT⬃P, purified *PhoRC303A⬃P and *PhoRWT⬃P proteins were incubated at room temperature, samples were removed at different times (Fig. 6A), 5⫻ SDS loading buffer was added to stop the reaction, and samples
were analyzed as described above. *PhoRC303A⬃P is stable at room temperature, with a half-life of more than 2 h (Fig. 6A). Analysis of the 3-h autophosphorylation reactions showed that the stability of *PhoRC303A⬃P is similar to the stability of *PhoRWT⬃P. The in vivo results indicated that residue Cys303 of PhoR is crucial for full activation of the Pho system (Fig. 3), while the in vitro data showed that *PhoRC303A functioned (Fig. 5A and B) similar to *PhoRWT with respect to autophosphorylation and inhibition by reduced MK3. To test the ability of *PhoRC303A to phosphorylate PhoP, purified *PhoRWT and *PhoRC303A proteins were phosphory-
418
ELDAKAK AND HULETT
lated with [␥-32P]ATP for 20 min, and the excess [␥-32P]ATP was removed. Phosphorylated proteins were mixed with an equimolar amount of PhoP, and samples were collected at different times and analyzed using SDS-PAGE and autoradiographs. Figure 6B (top right panel) shows that phosphotransfer from *PhoRWT⬃P to PhoP occurred in less than 5 s and that after this the sum of the radiolabel in *PhoRWT⬃P and the radiolabel in PhoP⬃P was approximately equal to the label in *PhoRWT⬃P at the start of the reaction. Figure 6B (lower panels) also shows that the phosphotransfer between *PhoRC303A⬃P and PhoP also occurred within 5 s. However, a significant amount of label (approximately 70%) was lost from the two proteins within 5 s. Samples taken during the phosphotransfer from *PhoRC303A⬃P to PhoP (Fig. 6B, lower panels) were applied to a silica gel plate and developed in potassium phosphate buffer (pH 8.0). Using thin-layer chromatography, radioactive label (samples obtained at 5 to 120 s) migrated with the radioactive 32P control (lane 1), showing that radioactive label lost from the PhoR and/or PhoP proteins was released as radioactive Pi (Fig. 6C). These results showed that *PhoRC303A⬃P remained stable at room temperature, with a half-life of more than 2 h (Fig. 6A). Upon addition of the response regulator PhoP, *PhoRC303A lost the labeled phosphate but could not phosphorylate PhoP to the same extent as *PhoRWT. Thus, residue Cys303 is involved in the phosphotransfer activity of PhoR to its cognate response regulator PhoP such that mutation of this residue (Cys303Ala) resulted in decreased PhoP⬃P concentrations, which presumably translated into reduced Pho induction in vivo. PhoRC303A variant does not have an elevated PhoR phosphatase activity for PhoP⬃P or a PhoR autophosphatase activity upon interaction with PhoP. The major decay route for PhoP⬃P involves a PhoR⬃P intermediate, followed by formation of ATP in the presence of ADP (56). Slow release of Pi from PhoP⬃P in the presence of PhoR was also observed and was not affected by ATP. To check the possibility that *PhoRC303A has elevated phosphatase activity with PhoP⬃P, purified PhoPWT was phosphorylated using *PhoRWT. PhoPWT⬃P was purified from *PhoRWT and mixed with *PhoRWT or *PhoRC303A. The reactions in samples collected at different times were terminated by adding SDS loading buffer, and the samples were analyzed on SDS-PAGE gels as described above. No increase in the loss of radioactive label from PhoPWT⬃P was observed throughout the course of the reaction with *PhoRC303A compared to the reaction with *PhoRWT, suggesting that the rapid Pi release during phosphotransfer (Fig. 6C) was not due to elevated PhoRC303A phosphatase activity for PhoP⬃P (Fig. 7A). The inability of *PhoRC303A⬃P to efficiently phosphorylate PhoP could be due to an autophosphatase activity caused by the mutation that was stimulated through the protein-protein interaction with PhoP. To test this hypothesis, *PhoRC303A⬃P and *PhoRWT⬃P were prepared as described above and mixed with PhoPD53A. The phosphorylation site in PhoPD53A (Asp53) was mutated so that it could not be phosphorylated. *PhoRC303A⬃P was stable, similar to *PhoRWT⬃P, which indicates that the Cys303Ala mutation did not confer autophosphatase activity on *PhoRC303A⬃P upon interaction with PhoPD53A (Fig. 7B). These results indicated that *PhoRC303A does not stimulate
J. BACTERIOL.
FIG. 7. *PhoRC303A has no phosphatase activity. (A) PhoP⬃P is stable in the presence of *PhoRC303A. PhoPWT was phosphorylated using *PhoRWT⬃P, purified PhoPWT⬃P was mixed with either *PhoRWT or *PhoRC303A, and samples were removed and reactions were terminated at the times indicated above the gels. Samples were analyzed on SDS-PAGE gels, and dried gels were subjected to PhosphorImager analysis. (B) *PhoRC303A⬃P is stable in the presence of PhoPD53A. *PhoRWT and *PhoRC303A were incubated with [␥-32P]ATP, and free ATP was removed. *PhoRWT⬃P and *PhoRC303A⬃P were incubated with PhoPD53A (no phosphorylation site), and the reactions were terminated at different times. Samples were analyzed on SDS-PAGE gels as described above.
phosphatase or autophosphatase activity but that residue Cys303 is required for efficient phosphotransfer between PhoR and its cognate response regulator, PhoP. DISCUSSION Results presented here showed that a reducing environment in vivo (Fig. 2) and a reduced form of quinones in vitro (53) inhibited PhoR activity, suggesting that the thiol side chain of a cysteine residue may be oxidized for full Pho induction. Strains containing the PhoRC303A variant exhibited approximately 60% reductions in Pho reporter expression in vivo when they were grown without DTT and 90% reductions when they were grown with DTT (Fig. 4) compared to wild-type expression levels, which were reduced 75% in the presence of DTT. These results suggested that Cys303 regulates PhoR activity through an input separate from that of the redox state of quinones. This idea was strengthened by the fact that the wild-type autophosphorylation maintained by *PhoRC303A was inhibited in vitro by the reduced form of quinones (Fig. 5), similar to *PhoRWT (53). Together, these data indicated that the inhibitory effect of reduced quinones on PhoR autophosphorylation is independent of the Cys303 residue. There is a growing list of different proteins that are regulated by redox-active cysteine residues (6, 21, 46), including the transcriptional regulator CtrJ (39) and sensor kinase RegB (14, 61) in Rhodobacter capsulatus, transcriptional factor Yap1 in
VOL. 189, 2007
Saccharomyces cerevisiae (31, 63), chaperone Hsp33 (20, 27) and quinone reductase DsbB (4, 64) in E. coli, anti-sigma factor RsrA in Streptomyces coelicolor (5, 47), and the repressor OhrR in B. subtilis (17). The RegB/RegA two-component system is under redox control to exert transcriptional regulation for diverse cellular processes, such as respiration, photosynthesis, carbon fixation, and nitrogen fixation. Under anaerobic conditions, RegB autophosphorylates and activates RegA, while under oxidizing conditions the kinase activity of RegB is inhibited through the formation of an intermolecular disulfide bond by the redoxactive residue Cys265 (61). In vivo, strains with the RegBC265A variant were constitutively active. In vitro, the oxidized form of quinone inhibited the autophosphorylation of the truncated cytosolic form of RegB and, surprisingly, the full-length RegBC265A variant (60, 61). A RegBC265A mutation partially abolished the redox regulation of RegB/A in vivo. These data plus identification of the quinone binding site in a periplasmic loop of RegB led to the proposal that additional redox inputs other than Cys265 could be involved in the redox regulation of RegB activity (60). In ArcB the oxidative power of oxidized quinones silenced the activity of ArcB through the formation of a disulfide bond between Cys180 and Cys241 (37), while Cys265 regulated RegB independent of the redox state of quinones (60). Our results suggested that the regulatory role of Cys303, which affects the phosphotransfer between PhoR and PhoP, is independent of the redox state of menaquinone (as an electron donor) that affects PhoR autophosphorylation. The current data do not rule out the possibility that the redox state in the cytosol might affect the oxidation state of Cys303 in wild-type PhoR, which in turn might cause an allosteric modification in the structure of PhoR that is crucial for PhoPR phosphotransfer. Further investigations to identify the menaquinone-binding domain(s) in PhoR and to assess possible redox control of Cys303 may differentiate the effect of the redox state of menaquinone from the regulatory role of Cys303 with PhoR. Several observations led to the hypothesis that PhoRCys303 may be a candidate for a redox-reactive cysteine. The PhoRCys303 residue is in a pocket of basic amino acids, KKCK, as is RegBCys265 (RCR). Cationic residues are known to reduce the pKa for cysteine deprotonation, increasing the possibility of deprotonation at a physiological pH. As a highly reactive species, deprotonated cysteine can react with H2O2 to form SOH (sulfenic acid), which can also be an intermediate in disulfide bond formation (28, 46, 61). *PhoR was shown to form covalent homodimers under oxidizing conditions but not under reducing conditions at a physiological pH (data not shown), while the PhoRC303A protein variant did not form homodimers under the same conditions. Furthermore, Cys303 is located in a PAS domain. The fact that PAS domains have been associated with oxygen and redox potential sensing and proteinprotein interactions caused us to ask if this position is important for the role of Cys303 in Pho regulation. One question raised by the present studies is how Cys303Ala reduced Pho induction in vivo while autophosphorylation of *PhoRC303A in vitro remained similar to autophosphorylation of PhoRWT. This mutation was shown to affect the efficiency of the phosphotransfer reaction (Fig. 6) between PhoR and its cognate response regulator, PhoP, while it did not affect other
EFFECT OF Cys303 ON PhoR REGULATION
419
activities of *PhoRC303A in vitro. B. subtilis strains that contained only the catalytic domain of PhoR, PhoR350 (Fig. 1), exhibited 20% Pho induction compared to the wild-type levels in vivo, and both the phosphotransfer rate and efficiency of phosphotransfer from PhoR350 to PhoP were reduced in vitro compared to the phosphotransfer rate and efficiency of phosphotransfer observed for *PhoR (55). Cys303 is probably not involved in the specificity of PhoR and PhoP because the catalytic domain of PhoR350, which lacks Cys303, was capable of phosphorylating PhoP in vitro and induced the Pho response exclusively under phosphate starvation conditions in vivo, implying that PhoP recognition was intact. Mutation of only Cys303 in the linker region of *PhoR resulted in an approximately 85% reduction in the efficiency of phosphotransfer to PhoP and loss of radioactive label as Pi from both proteins in vitro (Fig. 6C). This phenotype indicated either that the nature of this mutation triggered a phosphatase activity in *PhoRC303A or that Cys303 is required to stabilize the interaction between *PhoRC303A and PhoP during the phosphotransfer reaction. Our data showed that the Cys303Ala mutation did not cause a PhoR phosphatase activity on PhoP⬃P or autophosphatase activity in *PhoRC303A⬃P upon interaction with PhoP. It is possible that Cys303 is required to stabilize the interaction between PhoR and PhoP. It is not unprecedented that the redox state of a cysteine residue could affect the interaction of a histidine kinase with another protein. It has been shown that in E. coli the oxidized form of CheAS (CheA short), which lacks the N-terminal portion of CheAL (CheA long), including ␣-helices A to C and the N-terminal half of ␣-helix D, which form the monomeric four-helix bundle containing the CheA H box in ␣ helix B, does not bind CheZ (CheY⬃P phosphatase), while the reduced form of CheAS interacts and enhances the activity of CheZ (43). This finding was attributed to Cys120, which resides in ␣-helix E, the fifth and final helix of the phosphotransfer domain (P1) of CheA (7). It was suggested that under oxidized conditions, Cys120 forms a disulfide bond, which leads to covalent dimerization and loss of CheZ binding activity in the case of CheAS. Interestingly, in CheAL, which contains the whole P1 domain, Cys120 is buried and is not solvent accessible. No conditions were identified that resulted in binding between CheAL and CheZ in vitro. It was proposed that the solvent accessibility of Cys120 appears to be important for the interaction between CheAS and CheZ (43). In the majority of histidine kinases, referred to as class I histidine kinases, which includes PhoR, the four-helix bundle is formed from the dimerization and phosphotransfer (DHp) domains of two histidine kinase monomers via dimerization that yields a four-helix bundle containing two conserved H-box sequences that can be phosphorylated at the His residue (7). The four-helix bundle domain was shown to be sufficient for the specificity between the response regulator DivK in Caulobacter crescentus and its cognate histidine kinase in vivo (44). Recently, Hendrickson and colleagues described the crystal structure of the four-helix bundle (DHp domain) and the CA domain of ORF 0853 of the thermofile Thermatoga maritima (38). In a homodimer of ORF 0853, each protomeric subunit consists of two domains, an N-terminal helical hairpin domain and a C-terminal ␣/ domain, which are connected by a short linker. The interactions between the parallel coiled coil in the
420
ELDAKAK AND HULETT
helical hairpin generates a small cavity, and the hydrogen bonding between Asp248 and its symmetry mate, Asp248⬘, closes the top of this cavity (38). PhoRCys303 resides in the linker region N terminal to a coiled coil containing an H box, and this may provide flexibility for residues in this linker region (e.g., Cys303) to stabilize the PhoP-PhoR interaction during the phosphotransfer reaction. As indicated by Hendrickson and colleagues, any subtle changes in the linker region could affect the helical hairpin and hence the disposition of the phosphoaccepting His residue and its role in the phosphotransfer reaction. The cytoplasmic linker, including Cys303, may stabilize the phosphotransfer intermediates or may act as a binder to strengthen the PhoP-PhoR interaction during the phosphotransfer through the interaction with different residues within the phosphorylation active site. Cys303 may mediate an induced fit between the kinase PhoR and PhoP in a way that prevents water access to phosphorylation intermediate(s) during the phosphotransfer reaction. Our data suggest that PhoR residue Cys303 may trigger an essential closed conformation upon interaction with PhoP that is required to stabilize the phosphorylated protein intermediates. In enzyme I of the phosphoenolpyruvate (PEP):sugar phosphotransferase system, Cys502 induces the closed conformation upon interaction with the substrate PEP (18). The high-energy transition state during enzyme I-PEP phosphorylation induces Cys502 interaction with PEP, yielding a lower-energy closed conformation. The optimal orientation of Cys502 for catalysis takes place only during the transition state (18). Any role of PhoR Cys303 depends primarily on the signal received from the upstream sensors/modulators in PhoR (e.g., periplasmic domain, PAS domain, HAMP domain) and secondarily on the possibility that Cys303 monitors the redox state inside the cell. Depletion of cellular energy can be quickly monitored through the electron transport chain or the proton motive force before any drop in ATP levels can be observed (62). The histidine kinase PhoR monitors the environmental inorganic phosphate level (external signal), most probably through the periplasmic domain. While inside the cell, PhoR monitors the consequences of phosphate starvation via the components of the electron transport chain or the different electron carriers (internal signal). PhoR, which senses and responds to the redox state of quinones in vitro (53), has a potentially redoxreactive cysteine residue, Cys303, and likely has unknown redundant regulation of the catalytic domain, PhoR350 (55), which function together to induce the Pho response exclusively under phosphate starvation conditions. All these layers of PhoR regulation support the importance of a last rescue operation (the Pho response) before the cell yields to sporulation. Obviously, removing any one of these layers did not result in constitutive Pho expression (53, 55). A complete understanding of the regulatory systems involved should allow dissection of the layers individually. Together, our data are consistent with a role for Cys303 in stabilization of the phosphoryl-protein intermediate(s) during phosphotransfer from PhoR⬃P to PhoP, which is stabilization that is required for efficient production of PhoP⬃P. Further studies to solve the cocrystal structure of the cytoplasmic domain of PhoR with its cognate molecule PhoP should result in greater understanding of the diverse roles played by different residues, including Cys303. Together, the data show that
J. BACTERIOL.
Cys303 plays a crucial role in amplification of the Pho response during phosphate starvation by regulating the level of PhoP⬃P in vivo. ACKNOWLEDGMENT This work was supported by National Institutes of Health grant GM-33471 to F.M.H. REFERENCES 1. Abdel-Fattah, W. R., Y. Chen, A. Eldakak, and F. M. Hulett. 2005. Bacillus subtilis phosphorylated PhoP: direct activation of the EA- and repression of the EE-responsive phoB-PS⫹V promoters during Pho response. J. Bacteriol. 187:5166–5178. 2. Antelmann, H., C. Scharf, and M. Hecker. 2000. Phosphate starvationinducible proteins of Bacillus subtilis: proteomics and transcriptional analysis. J. Bacteriol. 182:4478–4490. 3. Bader, M., W. Muse, D. P. Ballou, C. Gassner, and J. C. Bardwell. 1999. Oxidative protein folding is driven by the electron transport system. Cell 98:217–227. 4. Bader, M. W., T. Xie, C. A. Yu, and J. C. Bardwell. 2000. Disulfide bonds are generated by quinone reduction. J. Biol. Chem. 275:26082–26088. 5. Bae, J. B., J. H. Park, M. Y. Hahn, M. S. Kim, and J. H. Roe. 2004. Redox-dependent changes in RsrA, an anti-sigma factor in Streptomyces coelicolor: zinc release and disulfide bond formation. J. Mol. Biol. 335:425– 435. 6. Barford, D. 2004. The role of cysteine residues as redox-sensitive regulatory switches. Curr. Opin. Struct. Biol. 14:679–686. 7. Bilwes, A. M., L. A. Alex, B. R. Crane, and M. I. Simon. 1999. Structure of CheA, a signal-transducing histidine kinase. Cell 96:131–141. 8. Birkey, S. M., W. Liu, X. Zhang, M. F. Duggan, and F. M. Hulett. 1998. Pho signal transduction network reveals direct transcriptional regulation of one two-component system by another two-component regulator: Bacillus subtilis PhoP directly regulates production of ResD. Mol. Microbiol. 30:943–953. 9. Bookstein, C., C. W. Edwards, N. V. Kapp, and F. M. Hulett. 1990. The Bacillus subtilis 168 alkaline phosphatase III gene: impact of a phoAIII mutation on total alkaline phosphatase synthesis. J. Bacteriol. 172:3730– 37307. 10. Burbulys, D., K. A. Trach, and J. A. Hoch. 1991. Initiation of sporulation in B. subtilis is controlled by a multicomponent phosphorelay. Cell 64:545–552. 11. Chen, Y., W. R. Abdel-Fattah, and F. M. Hulett. 2004. Residues required for Bacillus subtilis PhoP DNA binding or RNA polymerase interaction: alanine scanning of PhoP effector domain transactivation loop and alpha helix 3. J. Bacteriol. 186:1493–1502. 12. Chesnut, R. S., C. Bookstein, and F. M. Hulett. 1991. Separate promoters direct expression of phoAIII, a member of the Bacillus subtilis alkaline phosphatase multigene family, during phosphate starvation and sporulation. Mol. Microbiol. 5:2181–2190. 13. Eder, S., L. Shi, K. Jensen, K. Yamane, and F. M. Hulett. 1996. A Bacillus subtilis secreted phosphodiesterase/alkaline phosphatase is the product of a Pho regulon gene, phoD. Microbiology 142:2041–2047. 14. Elsen, S., L. R. Swem, D. L. Swem, and C. E. Bauer. 2004. RegB/RegA, a highly conserved redox-responding global two-component regulatory system. Microbiol. Mol. Biol. Rev. 68:263–279. 15. Eymann, C., H. Mach, C. R. Harwood, and M. Hecker. 1996. Phosphatestarvation-inducible proteins in Bacillus subtilis: a two-dimensional gel electrophoresis study. Microbiology 142:3163–3170. 16. Ferrari, E., S. M. Howard, and J. A. Hoch. 1986. Effect of stage 0 sporulation mutations on subtilisin expression. J. Bacteriol. 166:173–179. 17. Fuangthong, M., and J. D. Helmann. 2002. The OhrR repressor senses organic hydroperoxides by reversible formation of a cysteine-sulfenic acid derivative. Proc. Natl. Acad. Sci. USA 99:6690–6695. 18. Garcia-Alles, L. F., I. Alfonso, and B. Erni. 2003. Enzyme I of the phosphotransferase system: induced-fit protonation of the reaction transition state by Cys-502. Biochemistry 42:4744–4750. 19. Georgellis, D., O. Kwon, and E. C. Lin. 2001. Quinones as the redox signal for the Arc two-component system of bacteria. Science 292:2314–2316. 20. Graumann, J., H. Lilie, X. Tang, K. A. Tucker, J. H. Hoffmann, J. Vijayalakshmi, M. Saper, J. C. Bardwell, and U. Jakob. 2001. Activation of the redox-regulated molecular chaperone Hsp33—a two-step mechanism. Structure 9:377–387. 21. Green, J., and M. S. Paget. 2004. Bacterial redox sensors. Nat. Rev. Microbiol. 2:954–966. 22. Hulett, F. M. 2002. The Pho regulon, p. 193–201. In A. L. Sonenshein, J. A. Hoch, and R. Losick (ed.), Bacillus subtilis and its closest relatives: from genes to cells. ASM Press, Washington, DC. 23. Hulett, F. M. 1996. The signal-transduction network for Pho regulation in Bacillus subtilis. Mol. Microbiol. 19:933–939. 24. Hulett, F. M., C. Bookstein, and K. Jensen. 1990. Evidence for two structural genes for alkaline phosphatase in Bacillus subtilis. J. Bacteriol. 172:735–740.
VOL. 189, 2007 25. Hulett, F. M., E. E. Kim, C. Bookstein, N. V. Kapp, C. W. Edwards, and H. W. Wyckoff. 1991. Bacillus subtilis alkaline phosphatases III and IV. Cloning, sequencing, and comparisons of deduced amino acid sequence with Escherichia coli alkaline phosphatase three-dimensional structure. J. Biol. Chem. 266:1077–1084. 26. Hulett, F. M., J. Lee, L. Shi, G. Sun, R. Chesnut, E. Sharkova, M. F. Duggan, and N. Kapp. 1994. Sequential action of two-component genetic switches regulates the Pho regulon in Bacillus subtilis. J. Bacteriol. 176:1348–1358. 27. Jakob, U., W. Muse, M. Eser, and J. C. Bardwell. 1999. Chaperone activity with a redox switch. Cell 96:341–352. 28. Jones, D. P. 2002. Redox potential of GSH/GSSG couple: assay and biological significance. Methods Enzymol. 348:93–112. 29. Kapp, N. V., C. W. Edwards, R. S. Chesnut, and F. M. Hulett. 1990. The Bacillus subtilis phoAIV gene: effects of in vitro inactivation on total alkaline phosphatase production. Gene 96:95–100. 30. Kobayashi, T., and K. Ito. 1999. Respiratory chain strongly oxidizes the CXXC motif of DsbB in the Escherichia coli disulfide bond formation pathway. EMBO J. 18:1192–1198. 31. Kuge, S., M. Arita, A. Murayama, K. Maeta, S. Izawa, Y. Inoue, and A. Nomoto. 2001. Regulation of the yeast Yap1p nuclear export signal is mediated by redox signal-induced reversible disulfide bond formation. Mol. Cell. Biol. 21:6139–6150. 32. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680–685. 33. Lahooti, M., and C. R. Harwood. 1999. Transcriptional analysis of the Bacillus subtilis teichuronic acid operon. Microbiology 145:3409–3417. 34. Liu, W., S. Eder, and F. M. Hulett. 1998. Analysis of Bacillus subtilis tagAB and tagDEF expression during phosphate starvation identifies a repressor role for PhoP⬃P. J. Bacteriol. 180:753–758. 35. Liu, W., and F. M. Hulett. 1997. Bacillus subtilis PhoP binds to the phoB tandem promoter exclusively within the phosphate starvation-inducible promoter. J. Bacteriol. 179:6302–6310. 36. Liu, W., and F. M. Hulett. 1998. Comparison of PhoP binding to the tuaA promoter with PhoP binding to other Pho-regulon promoters establishes a Bacillus subtilis Pho core binding site. Microbiology 144:1443–1450. 37. Malpica, R., B. Franco, C. Rodriguez, O. Kwon, and D. Georgellis. 2004. Identification of a quinone-sensitive redox switch in the ArcB sensor kinase. Proc. Natl. Acad. Sci. USA 101:13318–13323. 38. Marina, A., C. D. Waldburger, and W. A. Hendrickson. 2005. Structure of the entire cytoplasmic portion of a sensor histidine-kinase protein. EMBO J. 24:4247–4259. 39. Masuda, S., C. Dong, D. Swem, A. T. Setterdahl, D. B. Knaff, and C. E. Bauer. 2002. Repression of photosynthesis gene expression by formation of a disulfide bond in CrtJ. Proc. Natl. Acad. Sci. USA 99:7078–7083. 40. Muller, J. P., Z. An, T. Merad, I. C. Hancock, and C. R. Harwood. 1997. Influence of Bacillus subtilis phoR on cell wall anionic polymers. Microbiology 143:947–956. 41. Nakano, M. M., and F. M. Hulett. 1997. Adaptation of Bacillus subtilis to oxygen limitation. FEMS Microbiol. Lett. 157:1–7. 42. Nakano, M. M., Y. Zhu, M. Lacelle, X. Zhang, and F. M. Hulett. 2000. Interaction of ResD with regulatory regions of anaerobically induced genes in Bacillus subtilis. Mol. Microbiol. 37:1198–1207. 43. O’Connor, C., and P. Matsumura. 2004. The accessibility of cys-120 in CheA(S) is important for the binding of CheZ and enhancement of CheZ phosphatase activity. Biochemistry 43:6909–6916. 44. Ohta, N., and A. Newton. 2003. The core dimerization domains of histidine kinases contain recognition specificity for the cognate response regulator. J. Bacteriol. 185:4424–4431. 45. Ozanne, P. G. 1980. Phosphate nutrition of plants—a general treatise, p.
EFFECT OF Cys303 ON PhoR REGULATION
46. 47.
48. 49. 50. 51.
52.
53. 54. 55. 56. 57. 58. 59. 60. 61.
62. 63. 64. 65.
421
559–585. In E. Khasswenh (ed.), The role of phosphorus in agriculture. American Society of Agronomy, Madison, WI. Paget, M. S., and M. J. Buttner. 2003. Thiol-based regulatory switches. Annu. Rev. Genet. 37:91–121. Paget, M. S., J. G. Kang, J. H. Roe, and M. J. Buttner. 1998. Sigma R, an RNA polymerase sigma factor that modulates expression of the thioredoxin system in response to oxidative stress in Streptomyces coelicolor A3(2). EMBO J. 17:5776–5782. Parkinson, J. S., and E. C. Kofoid. 1992. Communication modules in bacterial signaling proteins. Annu. Rev. Genet. 26:71–112. Paul, S., X. Zhang, and F. M. Hulett. 2001. Two ResD-controlled promoters regulate ctaA expression in Bacillus subtilis. J. Bacteriol. 183:3237–3246. Qi, Y., and F. M. Hulett. 1998. Role of PhoP⬃P in transcriptional regulation of genes involved in cell wall anionic polymer biosynthesis in Bacillus subtilis. J. Bacteriol. 180:4007–4010. Qi, Y., Y. Kobayashi, and F. M. Hulett. 1997. The pst operon of Bacillus subtilis has a phosphate-regulated promoter and is involved in phosphate transport but not in regulation of the Pho regulon. J. Bacteriol. 179:2534– 2539. Robichon, D., M. Arnaud, R. Gardan, Z. Pragai, M. O’Reilly, G. Rapoport, and M. Debarbouille. 2000. Expression of a new operon from Bacillus subtilis, ykzB-ykoL, under the control of the TnrA and PhoP-PhoR global regulators. J. Bacteriol. 182:1226–1231. Schau, M., A. Eldakak, and F. M. Hulett. 2004. Terminal oxidases are essential to bypass the requirement for ResD for full Pho induction in Bacillus subtilis. J. Bacteriol. 186:8424–8432. Scholten, M., and J. Tommassen. 1993. Topology of the PhoR protein of Escherichia coli and functional analysis of internal deletion mutants. Mol. Microbiol. 8:269–275. Shi, L., and F. M. Hulett. 1999. The cytoplasmic kinase domain of PhoR is sufficient for the low phosphate-inducible expression of Pho regulon genes in Bacillus subtilis. Mol. Microbiol. 31:211–222. Shi, L., W. Liu, and F. M. Hulett. 1999. Decay of activated Bacillus subtilis Pho response regulator, PhoP⬃P, involves the PhoR⬃P intermediate. Biochemistry 38:10119–10125. Stock, A. M., V. L. Robinson, and P. N. Goudreau. 2000. Two-component signal transduction. Annu. Rev. Biochem. 69:183–215. Sun, G., S. M. Birkey, and F. M. Hulett. 1996. Three two-component signaltransduction systems interact for Pho regulation in Bacillus subtilis. Mol. Microbiol. 19:941–948. Sun, G., E. Sharkova, R. Chesnut, S. Birkey, M. F. Duggan, A. Sorokin, P. Pujic, S. D. Ehrlich, and F. M. Hulett. 1996. Regulators of aerobic and anaerobic respiration in Bacillus subtilis. J. Bacteriol. 178:1374–1385. Swem, L. R., X. Gong, C. A. Yu, and C. E. Bauer. 2006. Identification of a ubiquinone binding site that affects autophosphorylation of the sensor kinase RegB. J. Biol. Chem. 281:6768–6775. Swem, L. R., B. J. Kraft, D. L. Swem, A. T. Setterdahl, S. Masuda, D. B. Knaff, J. M. Zaleski, and C. E. Bauer. 2003. Signal transduction by the global regulator RegB is mediated by a redox-active cysteine. EMBO J. 22:4699– 4708. Taylor, B. L., and I. B. Zhulin. 1999. PAS domains: internal sensors of oxygen, redox potential, and light. Microbiol. Mol. Biol. Rev. 63:479–506. Wood, M. J., G. Storz, and N. Tjandra. 2004. Structural basis for redox regulation of Yap1 transcription factor localization. Nature 430:917–921. Xie, T., L. Yu, M. W. Bader, J. C. Bardwell, and C. A. Yu. 2002. Identification of the ubiquinone-binding domain in the disulfide catalyst disulfide bond protein B. J. Biol. Chem. 277:1649–1652. Zhang, X., and F. M. Hulett. 2000. ResD signal transduction regulator of aerobic respiration in Bacillus subtilis: ctaA promoter regulation. Mol. Microbiol. 37:1208–1219.
