Cytochrome bo Complex in Escherichia coli - The Journal of Biological ...

THEJOURNAL OF BIOLOGICAL CHEMISTRY 0 1992 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 267, No. 3, Issue of January 25, pp, 2096-2104,1992 Printed in U.S.A.

Identification of Heme and Copper Ligands in SubunitI of the Cytochrome bo Complex in Escherichia coli* (Received for publication, August 16, 1991)

Jun Minagawa, TatsushiMogi, Robert B. GennisS, and YasuhiroAnrakuQ From the Department of Biology, Faculty of Science, University of Tokyo, Hongo, Bunkyo-ku, Tokyo113, Japan and the $Departments of Biochemistry and Chemistry, Universityof Illinois, Urbana, Illinois61801

The cytochrome bo complex is a terminal ubiquinol dominant under high oxygen tension (3, 4). The alternative oxidase in the aerobic respiratory chain of Escherichia terminal oxidase, the cytochrome bd complex, is expressed coli (Kita, K., Konishi, K., and Anraku, Y. (1984) J. where oxygen tension is low (5, 6). Mutants lacking one of Biol. Chem. 259, 3368-3374) and functions as a pro- the two terminal oxidases can grow normally, but a mutant ton pump. It belongs to theheme-copper oxidasesuper- lacking both oxidases cannot grow aerobically onnonferc oxidases inmi- mentable carbon sources (7). family with the aa3-type cytochrome tochondria and aerobic bacteria. In order to identify The cytochrome bo complex catalyzes the oxidation of ligands of hemes and copper, we have substituted eight ubiquinol-8 and the reduction of molecular oxygenwhich conserved histidines in subunit I by alanine and, in couple with the generation of an electrochemical proton graaddition, His-106, -284, and -421 by glutamine and dient across the cytoplasmic membrane (1).Previous work methionine. Western immunoblotting analysis showed has shown that the electrochemical proton gradient results that all the mutations do not affect the expression level of subunit I in the cytoplasmic membrane, indicating from a proton pumping mechanism as well as scalar proteothat these histidines are not crucial for its stability. A lytic reactions at the inner and outer surface of the cytosingle copy expression vector carryinga single muta- plasmic membrane (8, 9). Resonance Raman spectroscopy andEPR studies have Histion at the invariant histidines, His-106, His-284, 333, His-334, His-419, and His-421, of subunit I was shown that the cytochrome bo complex contains a hexacoorunable to support the aerobic growth of a strain in dinated low spin heme as well as a pentacoordinatedhigh spin which the chromosomal terminal oxidase genes (the heme (10,ll). Although both hemes have been considered as cy0 and cyd operons) have been deleted. The same protoheme IX for long time (3), a new heme component was mutations caused a complete loss of ubiquinol oxidase found recently to be also containedin the oxidase (12), activity of the partially purified enzymes. Spectro- together with the copper atom (Cu,) as another prosthetic scopic analysis of mutant oxidases in the cytoplasmic group (3). It is suggested that the low spin heme is located membrane revealed that substitutionsof His-106 and close to thequinol oxidation site whereas the high spin heme/ -421 specifically eliminated a 563.6 nm peak of the CuB binuclear center functions as a site for the reduction of low spinheme and that replacements of His-106, -284, molecular oxygen to water (13). Optical absorption spectra of and -419 reduced the extent of the CO-binding high the oxidase show two a-absorption bands (555 and 563.5 nm)’ spin heme. These spectroscopic properties of mutant which are ascribed to a contribution from the low spin heme oxidases were further confirmed with partially puri- (12). The high spin heme has the ability to bind CO and fied preparations. Atomic absorption analysis showed shows a typical CO binding difference spectra with apeak at that substitutions of His-106, -333, -334, and -419 416 nm anda trough at 430 nm. These low spin and high spin eliminated CuBalmost completely. Based on these findings, we conclude that His-106 hemes correspond to cytochrome b5,33.5and o components, and -421function as the axial ligandsof the low spin respectively, and are equivalent to cytochromes a and a3 of heme and His-284 is a possible ligand of the high spin the cytochrome c oxidases, respectively. Recently, we estabheme. His-333, -334, and -419 residues are attributed lished that the enzyme consists of five subunits, as predicted to the ligands of CuB.We present a helical wheel model from the DNA sequence, and showed that subunit I is the of the redox center in subunitI, which consists of the binding site for these prosthetic groups and plays the central membrane-spanning regions 11, VI, VII, and X, and role in redox-coupled proton pumping reaction (14, 15). The genes (cyoABCDE) coding for the cytochrome bo comdiscuss the implications of the model. plex have been cloned (14, 16) and sequenced (16). The products of the cyoA and cyoB genes are assigned to be subunits I1 and I, respectively (3, 14). Subunit I of the cytoThe cytochrome bo complex is one of two terminal oxidases chrome bo complex is related to subunit I of the cytochrome in therespiratory chain of aerobically grown Escherichia coli aa3 complexes of mitochondria and aerobic bacteria in that (1, 2). The expression of the cytochrome bo complex is pre- 37% of the amino acids are identical over a 546-amino acid overlap (16). It is likely that the sequence similarities reflect * This research was supported in part by a grant from the International Human Frontier Science Program Organization (to Y. A.) a common molecular architecture of the reaction center in and a grant-in-aid for encouragement of young scientists (to T.M.) the heme-copper oxidase superfamily, although the cytoThe costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely t o indicate this fact. § To whom correspondence should be addressed. Fax: 81-3-38124929.

Based on our careful spectroscopic determination of cytochromes in the cytochrome bo complex in cytoplasmic membranes and in a purified enzyme, we reevaluate that the oxidase complex has two a peaks (555 and 563.5 nm) at 77 K, rather than the peaks at 555 and 562 nm (3).

2096

Heme and Copper Ligands of E. coli Cytochrome bo Complex chrome bo complex uses ubiquinol as an electron donor in place of reduced cytochrome c and contains hemes different from heme u (17). From the comparison of the primary structures of subunit I of the cytochrome bo complex and its counterparts of the cytochrome uu3 complexes (18), 6 His residues, His-106, His-284, His-333, His-334, His-419, and His-421, are invariable and two His residues, His-54 and His411, are highly conserved in the terminal oxidase superfamily. Among the possible heme-ligand residues other thanhistidine (Met, Tyr,Lys, and Cys), only Lys-55, Tyr-61, Met-110, Tyr288, and Lys-362 are conserved (Fig. 1).Spectroscopic studies on the cytochrome c oxidase suggest that subunit I has two axial ligands for the low spin heme, one axial ligand for the high spin heme, and three ligands for CUB (19). We are taking great advantage of the molecular genetics in E.coli and carrying out the structure-function studies on the cytochrome bo complex to elucidate a mechanism of the redoxcoupled proton pumping (15). We have introduced a series of deletions in which each of the cy0 genes is carried on a single copy expression vector (mini-F plasmid) and found that all five subunits are essential for the in vivo assembly of the functionally active enzyme.' The versatile vector pCYOF2, which is specifically designed for the site-directed mutagenesis and for the expression of the cy0 genes, has facilitated the detailed structure-function studiesof the cytochrome bo complex (15).3 In thisstudy, we have carried out site-directed mutagenesis of eight conserved histidines in subunit I in the hope that these residues must be involved in ligating the low and high spin hemes and CUB.We found that His-106 and -421 function as the axial ligands of the low spin heme and His-284 is a possible ligand of the high spin heme. His-333, -334, and -419 residues are attributed to the ligands of CuB. EXPERIMENTALPROCEDURES

Media-For the preparation of cytoplasmic membranes, E. coli cells were grown in a rich medium (0.68% (w/v) Bacto-yeast extract (Difco), 0.13% (w/v) Bacto-casamino acids (Difco, technical), 1.3 mg/ ml sodium citrate, 2.7 mg/ml (NH4)2S04, 12.0 mg/ml K2HP04,1 mM MgS04, 1%(w/v) glycerol, 10 pg/ml FeS04, and5 pg/ml CuSO,). For the analysis of copper content, the medium to which FeS04 and CuS04were not supplemented was also employed. In the complementationtest for the aerobic growth, Davis and Mingioli minimal medium (20) supplemented with 50 pg/ml FeS0, and25 pg/ml CuS04 was used. Where indicated, 1%(w/v) glucose or glycerol was added as a carbon source. For the large-scale preparation of plasmid DNA, Tartof and Hobbs broth was used (21). Ampicillin was used at 100 pg/ml (for multicopy plasmids) or 15 pg/ml (for mini-F plasmids). Other antibiotics were used as described by Sambrook et al. (21). Bacterial Strains-E. coli strain SCSl (22) was used for the standard plasmid selection and propagation. Strain TG1was obtained from Amersham Corp. and used for production of single-strand DNAs of phagemid pCYOF2 or pCYOF4 which wereused as templates for the oligonucleotide-directed mutagenesis. The cy0cyd double deletion mutant, ST2592, was constructed as follows. First, the Acyd::Km' locus was transduced into the wild-type strain W3110 (23) by P1 phage grown on strain GO103 (24). Second, the Acyo::Cm' locus of ST4674' was transduced into the resultant strain, ST2590, to give strain ST2591. Acquisition of the double mutation was confirmed on Davis and Mingioli minimal plate containing 1% (w/v) glucose or glycerol. Strain ST2591 did not grow aerobically on glycerol but grew on glucose. Finally, the recA mutation was transduced from the strain NK6659 (Hfr srlA::TnlO recA ilu thi thr relA spc) (25). Strain ST4700 (W3110 Acyo::Cmr/pACT7-Iq)for the expression of mutant genes was used with pCYOF2 derivatives where the expression of the cy0 operon is under the control of the T7promoter (15). Genetic Procedures and DNA Manipulations-Generalized trans-

' H. Nakamura, K. Saiki, T. Mogi, and Y. Anraku, unpublished data. T. Mogi, K. Saiki, and Y. Anraku, unpublished data.

2097 Penplasm

A

Cytoplasm 0

I

n mnr v

VIWMIrx

x

XIxnxmXrv

FIG. 1. Secondary structure model for subunit I of the cytochrome bo complex showing location of the conserved residues. The secondary structure model based on the computer-aided prediction of membrane-spanning regions using the algorithm of Klein et al. (52) has been modified by the results of gene fusion experiments (53). Membrane-spanning regions are indicated by rectangles with the numbers of amino acid residues at thebeginning and the end of each transmembrane domain connected by hydrophilic loops. The locations of the eight conserved His residues (His-54, -106,-284,-333,-334,-411,-419, and -421) are indicated by the boldface letter H. The invariable residues are indicated by the standard one-letter abbreviations; these residues are mostly located in the membrane-spanning regions I, 11, VI, VII, VIII, X, and XI, and the loop 11-111. Non-conserved residues are not shown for clarity. ductions by Pluirphage were done as described (26). Restriction enzyme digestion and agarose gel electrophoresis were carried out as described (21). DNA ligation was done using a ligation kit (Takara Shuzo Co., Kyoto, Japan) according to the recommendations of the manufacturer. DNA fragments were purified on agarose gel with a Geneclean kit (Bio'"). Large and small scale preparations of plasmid DNAs were performed according to the alkaline lysis method (21). The oligonucleotide primers for site-directed mutagenesis and for DNA sequencing were synthesized in a model 381A DNA synthesizer (Applied Biosystems Inc.). Purifications of oligonucleotides by denaturing polyacrylamide gel electrophoresis were performed as described (27). Constructions of pCYOF4 and pMF04-Multicopy phagemid pCYOF4 whichcontains the unique NheI site on the upstream region of the cyoB gene has been constructed from pCYOF2 (Fig. 2). The construction was made via site-directed mutagenesis using an in uitro mutagenesis system (Amersham Corp.) and a primer (5'GCTAGGCGCGGCTAGCTTTTCGAACG-3') corresponding to the nucleotides 767-792 of the cyoA gene. The NheI site was introduced without any changes in the amino acid sequence of subunit I1 and can be used for subcloning of the entire cyoB gene fromthe phagemid into aderivative of mini-F plasmid pMFOl (15).' The DNA sequence between the SmaI and SalI sites was confirmed not to contain any unexpected nucleotide changes; we found only Lys-253/Leu-254 codon changes (AAA-CTG to AAG-CTA). Then, the SmaI-SalI fragment containingthe unique NheI sitewas replaced by the counterpart from wild-type phagemid pCYOF2. It is a T7 expression vector carrying the fl replication origin and the intact cy0 gene (15). The Nsp (7524) V-EcoRI fragment (2.6 kb), of pMFOl which carries the F-prime-derived replication origin was replaced by the corresponding region of pCYOF4. The resultant single copy plasmid, pMF04, contains the unique NheI site and was used throughout this study as a wild-type control of the cy0 operon. Site-directed Mutagenesis-Site-directed mutagenesis was done by the method of Tayloret al. (28). Reagents and enzymes for the reaction were obtained from Amersham Corp. The strategy involved in the cassette replacement mutagenesis was as follows. The sequence of the SalI-PstI fragment for the I-H54A5 and I-HlO6A mutants) or the AflII-SplI fragment (for all the other mutants) of pCYOF4 from candidate clones was confirmed to contain the desired codon change by direct plasmid sequencing (29) via the The abbreviations used are: kb, kilobase pair(s); HPLC, high pressure liquid chromatography. The designations for mutants make use of the standard one-letter abbreviations for amino acids. Thus, "I-H54A signifies the mutant in which the histidine at position 54 in subunit I has been replaced by alanine; elsewhere in some figures, it is simply expressed as "H54A."

Heme and Copper Ligands of E. coli Cytochrome bo Complex

2098

.SdIHPStI .vlUt-"--i.w~

FIG. 2. Physical map of the cy0 operon in vector pCYOF4. The restriction sites artificially introduced are marked by asterisks. The Sac1 site was introduced by subcloning of the operon. The NheI site designed for subcloning was introduced via the site-directed mutagenesis without any amino acid changes. The approximate coding regions of the cyoABCDE genes are shown by open rectangles. IH54A and I-HlO6A mutations are located in the unique SalI-PstI fragment (0.2 kb), and all the other mutations are in the unique AflIISplI fragment (1.2 kb). dideoxy method (30). Then, the mutant fragments substituted for their counterparts of the wild-type gene, and these fragments inserted in theconstructs were reconfirmed by sequencing. Preparation of Cytoplasmic Membranes and Purification of Mutant Enzymes-Mutant enzymes encoded by pCYOF4 derivatives were expressed in ST4700 by the T7polymerase/T7 promoter system (15).3 Cytoplasmic membranes were prepared according to the method of Yamato et al. (31) with slight modifications. Spheroplasts were disrupted by two passages through a Frenchpress (1000 kg/cm2). Total membrane vesicles were precipitated by centrifugation (140,000 X g, 1 h). Then, themembrane vesicles suspended in 3 mM sodium EDTA (pH 8.0) were subjected to isopycnic sucrose density gradient centrifugation. The dialysis step was omitted. Mutant enzymes were solubilized by sucrose monolaurate (Mitsubishi-Kasei Food Co., Tokyo) and separated from all the other cytochromes present in the cytoplasmic membrane by HPLC on DEAE-5PW (Tosoh Co., Tokyo) (15).3 Complementation Test for the Aerobic Growth-The mini-F plasmids carrying the mutant genes were introduced into terminal oxidase-deficient strain ST2592 (W3110 Acyo::Cm' AcydKm' recA). Transformants were obtained on LB-ampicillin plates under anaerobic conditions using sealed jars (gas pak anaerobic system, BBL Microbiology Systems, Cockeysville, MD) and then allowed to grow aerobically on minimal glycerol and minimal glucose plates a t 37 "C for 2 days. Spectroscopic Analyses-Measurements of the dithionite-reduced minus air-oxidized difference spectra of cytochromes at 77 K and the CO plus reduced minus reduced difference spectra a t room temperature were performed with a UV-3000 dual wavelength spectrophotometer (Shimadzu Co., Kyoto) as described previously (3). Digital outputs were recorded on a PC-286VS computer (Epson Co., Tokyo) by a program using the subroutines kindly provided by Dr. K. Matsuura (Tokyo Metropolitan University) and transferred to a Macintosh IICX computer (Apple Computer Inc., Cupertino, CA). The digital data were processed and analyzed on the Macintosh by using a software Igor (WaveMetrics, Lake Oswego, OR). The amount of cytochrome o was calculated using a value for a molar extinction coefficient of 254,000 cm" ( 15)3from the reduced plus CO minus reduced difference spectra at a wavelength pair of 416-430 nm. Other Methods-Copper content was determined by atomic absorption analysis using a Perkin-Elmer 370 or Shimadzu AA-640 atomic absorption spectrophotometer. The output signals were calibrated by running standardsof copper (ranging from 0.02 to 0.4 ppm). Ubiquinol-1 oxidase activities were assayed according to Kita et al. (3). Protein concentration was determined by the BCA method (32) with bovine serum albumin as a standard. Sodium dodecyl sulfatepolyacrylamide gel electrophoresis was done essentially by the method of Laemmli (33). Western immunoblotting was performed by the method of Towbin et al. (34) with the following modifications. Filters were blocked in Tris-buffered saline (10 mM Tris-HC1, pH 8.0, and 150 mM NaCl) containing 0.05% Tween 20 and 1%bovine serum albumin for 1h at room temperature. Primaryantibodies on the filter were detected by incubation with alkaline phosphatase-conjugated goat anti-rabbit IgG (Jackson Immunoresearch Laboratory) and staining with 330 pg/ml nitro blue tetrazolium and 165 pg/ml 5bromo-4-chloro-3-indolyl phosphate in 20 mM Tris-HC1, pH 9.5, 100

mM NaCl, and 5 mMMgC12. Anti-subunit I and anti-subunit I1 antisera were kindly provided by Dr. K. Kita (University of Tokyo). Chemicals-Restriction endonucleases and other enzymes for DNA manipulation were purchased from Takara Shuzo or New England BioLabs. Modified T7 DNA polymerase and sequencing reagents were from U. s. Biochemical Corp. Isopropyl thio-P-D-galactopyranoside was from Nova Chemicals. [ W ~ ~ P ] ~ C T PTBq/mmol) was (111 from ICN Radiochemicals. Sep-Pak C18 cartridge was from Millipore Co.. Triethylammonium bicarbonate was purchased from Wako Chemicals, Kyoto. Other chemicals were commercial products of analytical grade. RESULTS

Mutagenesis of the Conserved His Residues in Subunit IIn the primary sequences of subunit I of mitochondrial and bacterial cytochrome c oxidases, six His residues corresponding to His-106, -284, -333, -334, -419,and -421 in subunit I of the E. coli cytochrome bo complex are totally conserved (Table I and Fig. 1)and are implicated as theligands of the prosthetic groups. The other two histidines, His-54 and -411, are also conserved except fungal oxidases (39-41) and Bradyrhizobium juponicum oxidase (37)) respectively. Possible involvements of these histidinesas theligands of the low spin and high spin hemes and copper atom could be tested by amino acid substitutions. Using oligonucleotide-directed site-specific mutagenesis, we have introduced single codon changes for replacement of these eight histidines with an Ala residue (Table 11).His106, -284, and -421 residues were also individually changed to glutamine and methionine. Residues with a small neutral side chain such as alanine can be buriedin a bundle of membranespanning helices. Gln residues has a similarside chain volume and hydrophobicity to Hisresidue, and Met residue may work as an alternative ligand for the hemes. For instance, Met residue works as theaxial ligand of soluble cytochrome bSe2in E. coli (54) and of mitochondrial cytochrome c (55). Nucleotide sequences of the restriction fragments containing the His codon changes were confirmed by direct plasmid sequencing, and the fragments were then replaced with the counterparts in thewild-type cy0 operon. Directional cloning of the fragments was accomplished by choosing the unique SuZI-PstI fragment (0.2 kb) for the His-54 and His-106 mutagenesis and theAflII-SplI fragment (1.2 kb) for all the other subunit I mutations, Thus, we could eliminate the possibility that thephenotypes of the mutantenzymes would beobscured by any unexpected mutations elsewhere which could be introduced throughout the in vitro DNA manipulations. The in Vivo Activity of the Mutant Enzymes-The catalytic activities of the mutant enzymes were first tested by the in vivo complementation test on the ability to support the aerobic growth of the cy0 cyd double deletion mutant, ST2592. In order to avoid multicopy suppression effect, each of the mutant genes was subcloned into a single copy expression vector, pMF04, and expressed aerobically in the double mutant. If mutant enzymes encoded by the plasmids are functional, their catalyticactivities would correlate to the rates of aerobic growth of thetransformantson nonfermentable carbon sources. Thus anaerobic transformants of ST2592 with the pMF04 derivatives were streaked on minimal glycerol and minimal glucose plates andgrown aerobically for 2 days. Only two mutants carrying I-H54A or I-H411A mutation could grow aerobically on minimal glycerol plates as the wild type depending on the oxidative phosphorylation (Fig. 3). This indicates thatboth His-54 and His-411 insubunit I are functionally dispensable. However, mini-F plasmids carrying all the other mutations failed to complement the defects in aerobic growth of the double mutant on the minimal glycerol plates, indicating that substitutions of the totally conserved histidines caused a complete loss of the enzymatic activities.


2099

TABLE I Sequence alignment of His residues in subunitI of the E. coli cytochrome bo complex with corresponding residues in subunitI of the cytochrome a a n complexes Amino acid sequences aligned are: E. coli. (16); thermophilic bacillus PS3 (T. PS3, (35)); Bacillus subtilis (B. subt. (36)); Bradyrhizobium japonicum (37), Paracoccus denitrificans (38), Saccharomyces cerevisiae (yeast) (39), Neurosporacrassa (40), Aspergillus nidulans (41), Chlamydomonus reinhardtii(42), maize (43), soybean (44), Trypanosoma brucei (45), Paramecium aurelia (46). Drosophila melanogaster (fruit fly) (47), Paracentrotus lividas refers to the E. coli sequence. (48),Xenopus luevis (frog) (49), bovine (50), and human (51). The numbering by asterisks. Deletions are markedwith -. The Hisresidues altered in this study are marked 1 1 2 2 2 3 3 3 4 4 4 4 4 5 5 5 5 5 6 6 1 5 9 9 0 9 6 7 8 3 3 7 1 1 2 7 9 5 5 5 7 8 0 5 3 4 7 8 6 5 2 7 4 3 4 8 1 9 1 2 2 0 7 9 9 4 9 0

*

E. coli T. PS3

H V -

B. subtilis B. japonicum P.denitrificans Yeast N. A. nidulans C. reinhardtii Maize Soybean T.brucei P. aureus D. melunogaster P. lividus laevis Bovine Human

crassa

x.

H H H H H A A A H H H H H H H H H H

*

H G Q H H Q Q Q Q Q Q Q I Q Q Q Q H

* * *

* * *

H H Q H N H H H H H H H Y H Y H H H H H H L H Q N H H H H T H H H H L Y L A - - - A H Q N H H H H T H H H H W Y F R E H T N T H H T H H H H R Q H H H G H R Q - - - L H H Q H H H H K H H H H Y H K E - - - L H H S H H H H A H H H H G H V S - - - L H H S H H H H T H H H H G H L S - - - L H H S H H H H T H H H H G H L S - - - L H H A H H H H F H H H H G H V R - - - I H H T H H H H K H H H H G H T K - - - L H H T H H H H K H H H H G H A K - - - F H H S H H H H C H H H H F D C C - - - K H V S H H H H D H H H F G V N F - - - I H H S H H H H S H H H H T H L T - - - I H H T H H H H E H H H H L H P T - - - I H H T H H H H D H H H H L H V I - - - I H H T H H H H S H H H H M H Y N " - I H H T H H H H S H H H H T H Y K - - - -

TABLEI1 Oligonucleotides used for site-directed mutagenesis of conserved His residues in subunitI ~~~

~

~~~

Mutant Mutagenic

-

~~

~

Minimal-glucose H41 IA

(+02)

H419A

~~

oligonucleotide"

Codon change

-

I-H54A 3' AGGCAGCTGCCTTTGCGGAG 5' CAT + GCT - 5' I-HlO6A 3' -AAATGGCGCCGGCCGCACTAA CAC + GCC I-HlOGQ 3' AATGGCGCZCCGCACTAAT - 5' CAC + CAG I-HlO6M 3' GAAATGGCGCKCCGCACTAAT 5' CAC + ATG CAC + GCT I-H284A 3' - CGGACCCCGCCGGCCTTCAA- 5' I-H284Q 3' GGACCCCGGIJGGCCTTCAAA 5' CAC + CAG I-H284M 3' - CCGGACCCCGKGGCCTTCAAA - 5' CAC + ATG I-H333A 3' "XAACCGACLWTGAAGAAA- 5' CAC + GCC I-H334A 3 -AACCGACGTGCCAAGAAATGC- 5' CAC -+ GCC I-H411A 3' -AAGCAAGACETTGTCGGAC 5' CAT + GCT I-H419A 3' - GGACTAACGCEAAGGTATTG - 5' CAC + GCC CAT + GCT I-H421A 3'-ACGCGTGAAGC~rTGCACTAG-5' I-H421Q 3' "XTGAAGGGTTGCACTAGT - 5' CAT + CAG I-H421M 3'-ACGCGTGAAGTACTTGCACTAGT-5' CAT + ATG Sequences of mutagenic primers complementaryto thecyoB sense strand used to replace His codons a t given positions. In each case, the mutagenized codon is underlined, and the nucleotides changed are in boldface type.

H42lA

H334A

b,

control (vector only)

H333A

-

-

-

Inaddition,sinceall the mutants didgrowaerobically on minimal glucose plates via glycolysis, wecould eliminate a possibilitythat these mutationsinduced a largestructural perturbation of the enzyme complex which may alter membrane permeability. Thus, these six histidines are essentialfor the structure-function of the terminal oxidase, such as binding of the prosthetic groups. Quinol Oxidase Actiuity of Partially Purified PreparationsThe catalytic activities of mutant oxidases were further examined invitro. The oxidases were solubilized from cytoplasmic membranes witha nonionic detergent and separated from other cytochromes, such as an alternative quinol oxidase in the aerobic respiratory chain (i.e.the cytochrome bd complex), byionexchangechromatographyusing HPLC.As showninTable 111, the mutantoxidasescarrying H106A,

(no plasmid)

Minirna!-glycerol (+02)

H42 1A

H334A

H333A

1

control (vector only)

H284A \ q

I/ HS4A

WT (pMF04)

Ltrdrnl

(no

plasmid)

FIG. 3. Complementation test for the aerobic growth of the Acyo Acyd double mutant ST2592 with the mini-F plasmid pMF04 containing a single His to Ala mutation. A vector (pHNF-2) without the insert of the cy0 operon was used as a control. Minimal medium plates containing 1%glucose (upper panel) and1% glycerol (lower panel) were used for the aerobic growth a t 37 "C for 2 days.


2 100

H284A,H333A,H334A,H419A, and H421A substitutions lost completely the ubiquinol-1 oxidase activity. Since these mutant oxidases were also defective in the in vivo complementation test, theinvariant histidines in subunit I are likely to be involved in thecatalytic functions of the oxidase. Immunological Analysis of the Mutant Enzymes-Expression levels of the mutant oxidases encodedby the multicopy phagemids were examined byWestern immunoblottinganalysis of the cytoplasmic membranes (Fig. 4). The amounts of polypeptides cross-reactedwith rabbit polyclonal anti-subunit I and anti-subunit I1 antisera did not change significantly by His toAla mutations in subunit I. These results indicate that all the mutations did not alter stability and assembly of the mutant enzymes. SpectroscopicAnalysis of the Mutant Enzymes in Cytoplasmic Membranes-The low spin heme, cytochrome bs3.5, was quantitated by a peak at 563.5 nm in the dithionitereduced minus air-oxidized differencespectra at 77 K, which is specific to the cytochrome bo complex in the aerobic respiratory chain. The high spin heme, cytochrome 0, was determined by CO-reduced minus reduced difference spectra at room temperature. Cytochrome o has typical features with a peak at 416 nm and a trough at 430 nm. Substitutions of His-54, -333, -334, and -411 did not show significant effects on the extents of both low spin and high spin hemes (Fig. 5). Thus, these histidines are unlikely to be hemeligands.,Among all the His to Ala mutations, only substitutions of His-106 and His-421 completelyeliminated a trough at 563.5 nm in the second-orderfinite spectra at 77 K (Fig. 6A), suggesting that these two invariant His residues are theaxial ligands of the low spin heme. On the other hand, the amounts of the CO-binding high spin heme were greatly reduced by substitutions of His-106, -284, and His-419 (Figs. 6B and 7B). Since His-106 can be unambiguously assignedas one of the low spin heme ligands, His-284 and -419 are left as possible ligandsof the high spin TABLEI11 Ubiquinol oxidase activities of subunit Z mutants Activityb Ubiquinol-1 oxidase” Mutant Q,Hdminlmg

protein

%

Wild type 57.2 100 I-H54A 39.1 48.0 I-HlO6A 0.2 1.8 I-H284A 0.5 0.9 I-H333A 2.1 1.6 I-H334A 0.9 1.2 I-H411A 56.0 57.1 I-H419A 0.2 2.9 I-H421A 0.2 0.8 ’Average values from at least three determinations. * Normalized by the amounts of subunit I polypeptide as described in thelegend to Table IV. MUTANT

-5 4 0 M 4 5 0 0

4004404ea

Wavelength (nm)

FIG. 5. Second order finite spectra of dithionite-reduced minus air-oxidized difference spectra ( A ) and CO-reduced minus reduced difference spectra ( B ) of cytoplasmic membranes from the I-H54A, I-H333A, I-H334A, and I-H411A mutants. A, spectra were recorded with a Shimadzu UV-3000 spectrophotometer at 77 K, with the spectral band width of 1nm and the light path of 1 mm. Scan rate was 50 nm/min, and the protein concentrations were 3 mgof protein/ml of 120 mM Tris-HC1 (pH 7.4). B, conditions used wereas for A, except that measurements were done at room temperature and the protein concentrations were 0.5 mgof protein/ml. Procedures of treatment with CO gas were as described previously (3). Strains carrying plasmid pCYOF2 and pCYOFl were used as the wild-type control (WT)and a negative control (control), respectively. A

B

T

+AlO“

0”

+ in, H421A

Wavelength(nm)

FIG. 6. Second order finite spectra of dithionite-reduced minus air-oxidized difference spectra ( A ) and CO-reduced minus reduced difference spectra ( B ) of cytoplasmic membranes from the I-HlOGA and I-H421A mutants. Conditions and procedures were as described in the legend to Fig. 5.

heme. We have also substituted His-106, -284, and -421 by Gln and Met residues and found that their spectroscopic properties are similar to theAla mutations (data not shown). Spectroscopic Properties of Partially Purified Prepara* subunit11 tiom-Spectroscopic properties of some mutant oxidases were (CYaA) further examined in partially purified preparations;thus these FIG. 4. Immunoblotting analysis of cytoplasmic membranesproperties would not be obscured by contributions from other from strains expressing the mutant cy0 operons with antisubunit I and anti-subunit I1 antisera. Cytoplasmic membranes cytochromes (Fig.8). In contrast to the wild-type and H284A were prepared from strain ST4700 harboring pCYOF4 derivatives mutant oxidases, the H106A and H421A mutant oxidases lost which contain a single His to Ala mutation. Five pgof membrane completely the 563.5 nm peak as in cytoplasmic membranes. proteins were loaded per lane on SDS, 12.5% polyacrylamide gel. However, the absorption around 555 nm in these low spin

Oa&OOaee&

Heme and Copper Ligands of E. coli Cytochrome bo Complex A

B

T

.o-2

Wavelength (nm)

FIG. 7. Second order finite spectra of dithionite-reduced minus air-oxidized difference spectra ( A ) and CO-reduced minus reduced difference spectra ( B ) of cytoplasmic membranes from the I-HZ84A and I-H419A mutants. Conditions and procedures were as described in the legend to Fig. 5.

.01

2101

Copper Contents in the Mutant Oxidases-Effects of the His toAla mutations in subunit I on the copper content were examined (Table IV). The cytoplasmic membranes were prepared from the mutant cells grown in the absence of added copper to themedium and used for analysis of copper contents by atomic absorption spectroscopy. The copper contents in the wild-type, His-54, -284, and -411 mutant membranes were found to be stoichiometric to the amountsof the cytochrome bo complex. For example, the wild-type membranes contained 0.75 nmol of copper atom/mg of protein (Table IV) and 0.89 nmol of cytochrome o/mg of protein (Fig. 5). On the other hand, the His-106, -333, -334, and -419 mutant membranes contained only negligible amounts of copper as in the membranes prepared from cells harboring plasmids without the insert of the cy0 operon. In the His-421 mutant membranes, the copper content was reduced to one-fifth of the wild-type control. These defects could be restored by supplementation of excess CuS04 in themedium (Table IV). However, strains carrying these mutant genes were unable to grow aerobically on CuSO*-supplemented minimal glycerol plates, indicating that supplementation of excess copper is not enough for functional restoration. We assumed that copper ions are able to associate with the mutant oxidases where distortion of a CUB-binding site results in decrease of the affinity for copper ions. Taken together these data and those from spectroscopic observation for heme binding (Table V), we suggest that His333, -334, and -419 are ligands of CUB. DISCUSSION

r 400

420

440

I 54 0

.

I 560

.

1 580

Wavelength (nm)

The E. coli cytochrome bo complex, which is encoded by the cyoABCDE operon (16), consists of five subunits and has two a-absorptionpeaks at 555 and 563.5 nm in the low temperature redox spectrum (3, 15). Subunit I has been identified as the cyoB gene product and found to be the binding sites for the low and high spin hemes (14, 15).3 CUBis also assumed to be present in the redox center in subunit I. Resonance Raman spectroscopy (10) and EPR (11)studies have suggested that thehigh spin heme has at least one axial ligand (proximal ligand) and thelow spin heme has two axial ligands. Salerno et al. (13) determinedthe crystal field parameters of the low spin heme from EPR spectra and showed a bishistidine ligation of the low spin heme. The identity of the ligand of the high spin heme remains uncertain, although His residue is most often found in other heme proteins as the proximal ligand. Among 20 His residues in subunit I of the cytochrome bo complex, 6 His residues, His-106, -284, -333, -334, -419, and

FIG. 8. Dithionite-reduced minus air-oxidized difference spectra of partially purified preparations from the I-HlOGA, I-H284A, and I-H421A mutants. Spectra were normalized by the height of Soret peak. Conditions and procedures were as described in the legend to Fig. 5.

TABLEIV Mutant

Copper contents of subunit I mutants +Cu medium" %b -Cumedium"

%b

nrnollrng protein nmol/mg protein

Wild type 1.34 f 0.02 100 0.75 f 0.00 100 heme-deficient oxidases was comparable with that of the wildControl 0.08 f 0.00 0 0.10 f 0.01 0 type oxidases although the contribution of the high spin heme I-H54A 1.00 f 0.02 0.5776 f 0.05 80 to the a absorption band in the wild-type oxidase was estiI-HlO6A 1.17 0.10 f740.02 f 0.01 1 mated to be less than 10% (12). This could be caused by a 1.40 f 0.14 I-H284A 122 0.59 f 0.03 81 I-H333A 1.18 f 0.03 96 0.11 f 0.00 4 loss of interactions of the high spin heme with the low spin I-H334A 1.11 f 0.07 74 0.11 f2 0.01 heme and/or changes in the environment of the high spin I-H411A 1.05 0.06 62 0.55 i 0.00 82 heme. Slight blue shifts (1-2 nm) of the 555 nm peak were I-H419A 1.25 f 0.07 85 0.11 f 0.00 2 observed in the H421A and H284A mutant oxidases, and the I-H421A 1.11 f 0.05 76 0.20 f220.02 H421A oxidases showed a shoulder peak at around 550 nm. Average values from at least three determinations with fS.D. These results indicate that a loss of one of the hemes alters Specific contents of copper were normalized by the amounts of the spectral properties of the other by changing the electron subunit I in each membrane preparation, which were determined by distribution in the other heme or the equilibration of the densitometric analysis of the subunit I band in Western blots using conformational substates. a Shimadzu double-wavelength flying spot scanner CS-9000.

*


2 102

TABLEV Summary of biochemical and growth properties of the mutant oxidases Strain

CytrL;me

Wild type ++ Control I-H54A ++ I-H106A I-HlO6Q I-H106M I-H284A ++ I-H284Q ++ I-H333A ++ I-H334A ++ I-H411A ++ I-H419A ++ I-H421A I-H421Q I-H421M NT, not tested.

Cytochrome

Quinol Complementation oxidase test

++ +++ ++++ ++ + + + NT" NT NT + NT ++ ++ +NT NT - ++ +++ - +++ ++ - ++ ++ + + NT NT + NT NT

+ +

-

-

-

-

+ -

-

FIG. 9. Helical wheel projection model of the redox center in subunit I. The model shows possible spatial interactions between the low and high spin hemes and CUB,and arrangements of putative transmembrane helices 11, VI, VII, and X.The rotational orientations of the helices were selected on the basis of the hydrophobic moment of the helices (65) and theresults of site-specific mutagenesis in this study. Both hemes are oriented with their planes perpendicular to the membrane Plane (66). See text for details.

-421, were found to be invariant in the cytochrome a o 3 complexes of mitochondria and aerobic bacteria (Table I) and are located in the transmembrane regions 11, VI, VII, and X (Fig. 1). Two other His residues, His-54 and -411, are highly temperature redox spectra of cytoplasmic membranes (Fig. 6) conserved and located in the putative hydrophylic loop 0-1 and of Partially purified preparations (Fig. 8). The result and IX-X, respectively. indicates that His-106 and His-421 theare axial ligands of Spectroscopic studies, suchas magnetic circular dichroism, the low spin heme. Preliminary EPR characterization of the extended x-ray absorption finestructure, andelectron nuclear H106A and H421A oxidases in cytoplasmic nmdmmes condouble resonance, of the cytochrome uu3 complexes indicate firmed the loss of the low spin signal.6 From copper analysis that heme a is liganded by two His residues (56, 57), heme a3 of mutant membranes, we found that substitutions Of Hisby one His residue (58, 59), and CuB by three His residues 106, -333, -334, and -419 caused a complete loss of copper in (60-62). The fourthligand of cUB is thought to form a bridge the mutant oxidases. Since His-106 and -421 are unambiguto heme a3. The identity of the fourth ligand is still contra- ously assigned to the ligands of the low spin heme, His-333, versial (19). Since the E. coli cytochrome bo complex belongs -334, and -419 are suggested to be ligands ofC% Supplemento the heme-copper oxidase superfamily (IT), at least three tation of cUso4 to thegrowth medium restored the defect in His residues function as theheme ligands, and the other threebinding of copper atom% suggesting that these His substitu~i~ residues are involved in the binding of cuB, which is tions altered an affinity for copper atom in the CUB-binding electronically coupled to the high spin heme. In order to test site due to a loss Of One ligand and/or perturbations Of a the idea, we have carried out the oligonucleotide-directedsite- tertiary structure of the redox center. Substitutions of Hisspecific mutagenesis of these histidines and examined the 106, -284, and -419 reduced the amount of the CO-binding spectroscop~c properties and the copper in the mutant high spin heme, indicating their involvement in the high spin oxidases. since manipulations of a large DNA segment (iy. 5 heme/CuB binuclear center. Assignments of His-333, -334, kb of the cyo operon) may result in unexpecbd mutations and -419 as ligands of CUB lead us to conclude that the Hiselsewhere in the structure genes, we have designed our mu- 284 residue is a Proximal ligand of the high spin heme. A tagenesis experimentsso that phenotypes of the mutant oxi- defect of the high spin heme binding in the His-106 and -419 be due to a perturbation Of the high dases would not be obscured by any unexpected mutations. mutant enzymes Thus, a portion of the mutagenized fragment has been thor- spin heme/CuB binuclear center. In the His-284 mutant enpresent oughly sequenced to confirm adesired codon change (see Fig. zyme, a binding pocket for the high 'pin heme 's 2) andreintroduced into thewild-type cy0 operon for expres- in the redox center, and a ligand Of the high 'pin heme may sion of the mutant genes. In addition, the expression of the be provided from the nearby CUB-binding site (i.e. His-333 could be an alternative ligand (see Fig. 9). Alternatively, a cy0 operon was tightly controlled by the T7promoter in vector pCYOF4 during DNA manipulations, or the expression level portion of hemes in the low spin heme-binding site may be able to bind CO in this mutant. These results confirmed of the mutant oxidases was mimicked to the level of the possible interactions of His-284, -333, -334, and -419 in the chromosomal copy by using a single copy vector which we binuclear center. We have also substituted His-106, -284, and have developed for expression of the membrane proteins. -421 by Gln and Met residues and obtained similar results. Western immunoblotting analysis of the mutant oxidases Lemieux et ul. (63) substituted seven conserved His residues (Fig. 4) suggested that Ala substitutions of conserved histi- in subunit I by another residue, such as Leu and Gly. All of dines do not affect the assembly of the enzyme complex into these mutations have similar effectsto the Ala mutations in the CfloPlasmic membrane or the stability against Proteolytic this study, indicating that constraints at positions 106, 284, degradation. The in vivo complementation test (Fig. 3) and 333, 334, 419, and 421 in functional enzymes are limited to the in vitro quinol oxidase assay (Table 111) both demon- the His residue. strated that the six invariant histidines are essential for the Thus, we conclude from the site-directed mutagenesisstudcatalytic functions of the cytochrome bo complex. ies that 1) His-106 and -421 are the axial ligands of the low The defects were further examined by optical spectroscopy and copper analysis. Among mutant oxidases, only the H106A 6 J. Minagawa, M. w. Calhoun, T. Magi, R. €3. Gennis, and Y. and H421A oxidases lost the 563.5 nm peak in the low Anraku, unpublished data.

Heme and Copper Ligands of E. coli Cytochrome bo Complex spin heme; 2)His-284 functions as theproximal ligand of the high spin heme; and 3) His-333, -334, and -419 are ligands of CuB.We suggest that these six invariant histidines also serve as the ligands in the cytochrome c oxidases. Furthermore, identifications of the prosthetic groups in subunit I lead us to propose a helical wheel projection model (64) of the redox center in the cytochrome bo complex (Fig. 9). The redox center is provided by at least four putative transmembrane helices, 11, VI, VII, and X, in subunit Iwhich all carry the invariant histidines. The low spin heme-binding site is provided by helices I1 and X, and the binuclear center is formed by helices VI, VII, and X. Four-a-helix bundle is one of the common packing motifs found in protein structures with awide range of functions (67). In thebacterial photosynthetic reaction center, two helices of two distinct subunits form this arrangement (68). However, the redox center of the cytochrome bo complex is not the anti-parallel helix bundle which is an energetically favorable arrangement (69). Thus, it is possible that anotherputative transmembrane helix may be present inbetween these helices. Such a helix with a helix dipole whose direction is opposite to those of helices 11, VI, and X could increase thestability of the helical bundle through electrostatic interactions. Since His-106 and -421 are so crucial in binding of the low spin heme and CuB,they may also serve as the key residues which drive a bundling of the putative transmembrane helices to form a redox center in subunit I through association of the transmembrane region I1 and X via the heme ligation (see Fig. 9). In the model, electron flow from ubiquinol-8 to the high spin heme/CuB binuclear center is mediated via the low spin heme, and the committed reduction of molecular oxygen to water takes place in the binuclear center. Proton pumping must be coupled to these redox reactions; however, besides conserved histidines only two (potentially) charged residues (Glu-286 and Tyr-288 in helix VI) are present in the redox center. These charged residues may be involved in proton translocation by the heme-copper oxidases, as in a lightdriven proton pump, bacteriorhodopsin (70, 71). Invariant aromatic residues such as Tyr-288 in helix VI may be involved in these electron transfer reactions. In the photosynthetic reaction center of Rhodobacter sphaeroides, Tyr-210 in subunit M has been identified as a key residue in the primary electron transfer (72, 73). It is possible that these residues may be involved in ligand binding by stabilizing the ligand molecules with their bulky aromatic side chains or by providing abinding pocket within the bundle of helices (74). Acknowledgments-We thank Dr. K. Kita for antiseraagainst subunits I and I1 of the cytochrome bo complex and encouragement throughout this study, Dr. K. Matsuura for a subroutine of data import for the computer program, Dr. S. Ohsono, Eisai Co., Inc. for the gift of ubiquinone-1, and M. W. Calhoun for valuable discussion. REFERENCES

1. Anraku, Y. (1988) Annu. Reu. Biochem. 57, 101-132 2. Anraku, Y., and Gennis, R. B. (1987) Trends Biochem. Sci. 1 2 , 262-266 3. Kita, K., Konishi, K., and Anraku, Y. (1984) J. Biol. Chem. 2 5 9 , 3368-3374 4. Minagawa, J., Nakamura, H., Yamato, I., Mogi, T., and Anraku, Y. (1990) J. Biol. Chem. 2 6 5 , 11198-11203 5. Kita, K., Konishi, K., and Anraku, Y. (1984) J. Biol. Chem. 2 5 9 , 3375-3381 6. Georgiou, C.D., Dueweke, T. J., and Gennis, R. B. (1988) J. Bacteriol. 1 7 0 , 961-966 7. Au,D. C.-T., Lorence, R. M., and Gennis, R. B. (1985) J. Bacteriol. 1 6 1 , 123-127 8. Kita, K., Kasahara, M., and Anraku, Y. (1982) J. Biol. Chem. 2 5 7 , 7933-7935

2103

9. Puustinen, A,, Finel, M., Virkki, M., and Wikstrom, M. (1989) FEBS Lett. 249,163-167 10. Uno, T., Nishimura, Y., Tsuboi, M., Kita, K., and Anraku, Y. (1985) J. Biol. Chern. 260,6755-6760 11. Hata, A., Kirino, Y., Matsuura, K., Itoh, S., Hiyama, T., Konishi, K., Kita, K., and Anraku, Y. (1985) Biochim. Biophys. Acta 810,62-72 12. Puustinen, A., Finel, M., Haltia, T., Gennis, R. B., and Wikstrom, M. (1991) Biochemistry 30,3936-3942 13. Salerno, J. C., Bolgiano, B., Poole, R.K., Gennis, R. B., and Ingledew, W. J. (1990) J.Biol. Chem. 265,4364-4368 14. Nakamura, H., Yamato, I., Anraku, Y., Lemieux, L., and Gennis, R. B. (1990) J. Biol. Chem. 265,11193-11197 15. Mogi, T., and Anraku, Y. (1990) in International Symposium on Bioenergetics of Proton Pumps: Biochemistry,Cell Biology, and Molecular Pathology (Fukui, T., Futai, M., Maeda, M., Moriyama, Y., and Tanizawa, K., eds) pp. 96-99, Osaka University Press, Osaka, Japan 16. Chepuri, V., Lemieux, L., Au, D. C.-T., and Gennis, R. B. (1990) J. Biol. Chem. 265,11185-11192 17. Gennis, R. B. (1991) Biochim. Biophys. Acta 1 0 5 8 , 21-24 18. Saraste, M. (1990) Q.Rev. Biophys. 2 3 , 331-366 19. Capaldi, T. (1990) Arch. Biochem. Biophys. 2 8 0 , 252-262 20. Davis, B. D., and Mingioli, E. S. (1959) J. Bacteriol. 6 0 , 17-28 21. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 22. Hanahan, D. (1983) J.Mol. Biol. 1 6 6 , 557-580 23. Bachmann, B. J. (1987) in Escherichia coli and Salmonella typhimurium Cellular and Molecular Biology (Neidhardt, F. C., Ingraham, J. L., Low, K. B., Magasanik, B., Schaechter, M., and Umbarger, E., eds) pp. 1190-1219, American Society for Microbiology, Washington, D. C. 24. Oden, R. L., DeVeaux, L. C., Vibat, C. R. T., Cronan, J. E., Jr., and Gennis, R. B. (1990) Gene 96,29-36 25. Murakami, H., Kita, K., Oya,H., and Anraku, Y. (1984) Mol. Gen. Genet. 1 9 6 , 1-5 26. Miller, J. H.(1972) Experiments in Molecular Genetics, pp. 201205, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 27. Lo, K.-M., Jones, S. S., Hackett, N. R., and Khorana, H. G. (1984) Proc. Natl. Acad. Sci. U. S. A. 8 1 , 2285-2289 28. Taylor, J. W., Ott, J., and Eckstein, F. (1985) Nucleic Acids Res. 13,8764-8785 29. Zhang, H., Scholl, R., Browse, J., and Somerville, C. (1987) Nucleic Acids Res. 1 6 , 1220 30. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc.Natl. Acad. Sci. U. S. A. 74,5463-5467 31. Yamato, I., Anraku, Y., and Hirosawa, K. (1975) J . Biochem. ( T o ~ Y o77,705-718 ) 32. Smith,-P. K.,. Krohn, R. I., Hermanson, G. T., Mallia, A. K., Gartner, F. H., Provenzano, M. D., Fujimoto, E. K., Goeke, N. M., Olson, B. J., and Klenk, D. C. (1985) Anal. Biochem. 1 5 0 , 76-85 33. Laemmli, U. K. (1970) Nature 227, 680-685 34. Towbin, H., Staehelin, T., and Gordon, J. (1979) Proc. Natl. Acad. Sci. U. S. A. 76,4350-4354 35. Ishizuka, M., Machida, K., Shimada, S., Mogi, A., Tsuchiya, T., Ohmori, T., Souma, Y., Gonda, M., and Sone, N. (1990) J. Biochem. (Tokyo) 108,866-873 36. Saraste, M., Metso, T., Nakari, T., Jalli, T., Lauraeus, M., and Van del Oost, J. (1991) Eur. J. Biochem. 195,517-525 37. Bott, M., Bollinger, M., and Hennecke, H. (1990) Mol. Microbiol. 4,2147-2157 38. Holm, L., Saraste, M., and Wikstrom, M. (1987) EMBO J. 6 , 2819-2823 39. Bonitz, S. G., Coruzzi, G., Thalenfeld, B. E., Tzagoloff, A., and Macino, G. (1980) J. Biol. Chem. 2 5 5 , 11927-11941 40. Burger, G., Scriven, C., Machleidt, W., and Werner, S. (1982) EMBO J. 1,1385-1391 41. Waring, R.B., Brown, T. A., Ray, J. A.,Scazzocchio, C., and Davies, R. W. (1984) EMBO J. 3 , 2121-2128 42. Boer, P. H., Bonen, L., Lee, R. W., and Gray, M. W. (1985) Proc. Natl. Acad. Sci. U. S. A . 8 2 , 3340-3344 43. Isaac, P. G., Jones, V. P., and Leaver, C. J. (1985) EMBO J. 4 , 1617-1623 44. Grabau, E. A. (1986) Plant Mol. Biol. 7 , 377-384 45. Hensgens, L. A.M., Brakenhoff, J., de Vries, B. F., Sloof, P.,

2 104

46. 47. 48. 49. 50. 51.

52. 53. 54. 55. 56. 57. 58.

Heme and Copper Ligands of E.coli Cytochrome bo Complex

Tromp, M. C., Van Boom, J. H., and Benne, R. (1984) Nucleic Acids Res. 12, 7327-7344 Pritchard, A.E., Seilhamer, J. J., and Cummings, D. J. (1986) Gene (Amst.) 44,243-253 de Bruijn, M. H. L. (1983) Nature 3 0 4 , 234-241 Cantatore, P., Roberti, M., Rainaldi, G., Gadaleta, M. N., and Saccone, C. (1989) J. Biol. Chem. 264, 10965-10975 Roe, B. A., Ma, D.-P., Wilson, R. K., and Wong, J. F.-H. (1985) J. Biol. Chem. 260,9759-9774 Anderson, S., de Bruijn, M. H. L., Coulson, A. R., Eperon, I. C., Sanger, F., and Young, I. G. (1982) J. Mol. Biol. 156, 683-717 Anderson, S., Bankier, A. T., Barrell, B. G., de Bruijn, M. H. L., Coulson, A. R., Drouin, J., Eperon, I. C., Nierlich, D. P., Roe, B. A., Sanger, F., Schreier, P. H., Smith, A. J. H., Staden, R., and Young, I. G. (1981) Nature 2 9 0 , 457-465 Klein, P., Kaneshisa, M., and DeLisi, C. (1985) Biochim. Biophys. Acta 815,468-476 Chepuri, V., and Gennis, R. B. (1990) J. Biol. Chern. 2 6 5 , 1297812986 Lederer, F., Glatigny, A., Bethge, P. H., Bellamy, H. D., and Mathews, F. S. (1981) J. Mol. Biol. 1 4 8 , 427-448 Bushnell, G. W., Louie, G. V., and Brayer, G. D. (1990) J. Mol. Biol. 214,585-595 Babcock, G. T., Callahan, P. M., Ondrias, M. R., and Salmeen, I. (1981) Biochemistry 20,959-966 Eglinton, D. G., Hill, B. C., Greenwood, C., and Thomson, A. J. (1984) J. Znog. Biochem. 2 1 , 1-8 Blokzijl-Homan, M. F., and Gelder, B. F. V. (1971) Biochirn. Biophys. Acta 234,493-498

59. Stevens, T. H., and Chan, S. I. (1981) J. Biol. Chern. 2 5 6 , 10691071 60. Cline, J., Reinhammar, B., Jensen, P., Venters, R., and Hoffman, B. M. (1983) J. Biol. Chem. 2 5 8 , 5124-5128 61. Li, P. M., Gelles, J., Chan, S. I., Sullivan, R. J., and Scott, R. A. (1987) Biochemistry 26,2091-2095 62. Scott, R. A., Li, P. M., and Chan, S. I. (1988) Ann. N. Y. Acad. Sci.550, 207-222 63. Lemieux, L.J., Calhoun, M. W., Thomas, J. W., Ingeldew, W. J., and Gennis, R. B. (1992) J. Biol. Chem. 267,2105-2113 64. Schiffer, M., and Edmundson, A.B. (1967) Biophys. J. 7 , 121135 65. Eisenbere. D.. Schwarz. E.. Komaromv. . - , M.. and Wall.. R. (1984) J. Mol.-Bioi 1 7 9 , 125-142 66. Salerno. J. C.. and Ineledew. W. J. 11991) . . Eur. J. Biochem. 198, 789-792 ’ 67. Weber, P. C., and Salemme, F. R. (1980) Nature 287,82-84 68. Chang, C.-H., El-Kabbani, 0.. Tiede, D., Norris, J., and Schiffer, M. (1991) Biochemistry 30,5352-5360 69. Gilson, M. K., and Honig, B. (1989) Proc. Nutl. A d . Sei. U. S. A. 86,1624-1528 70. Mogi, T., Stern, L. J., Marti, T., Chao, B. H., and Khorana, H. G. (1988) Proc. Nntl. Acud. Sei. U. S. A. 85,4148-4152 71. Stern, L. J., and Khorana, H. G . (1989) J. Biol. Chem. 2 6 4 , 14202-14208 72. Finkele, U., Lauterwasser, C., Zinth, W., Gray, K. A., and Oesterhelt, D. (1990) Biochemistry 29, 8517-8521 73. Nagarajan, V., Parson, W. W., Gaul, D., and Schenck, C. (1990) Proc. Natl. Acud. Sci. U. S. A. 87,7888-7892 74. Mogi, T., Marti, T., and Khorana, H.G. (1989) J. Biol. Chem. 2 6 4 , 14197-14201 I

-