Cytokine responses to Mycobacterium leprae ... - Semantic Scholar

Download PDF
0 downloads 0 Views 321KB Size Report
Comment
detect antibodies to M. leprae-specific molecules, such as phenolic glycolipid-I (PGL-I), can identify leprosy patients with strong humoral responses to M. leprae.
Lepr Rev (2011) 82, 422– 431

Cytokine responses to Mycobacterium leprae unique proteins differentiate between Mycobacterium leprae infected and naı¨ve armadillos MARIA PENA* , **, ANNEMIEKE GELUK***, JOLIEN J. VAN DER PLOEG-VAN SCHIP***, KEES L.M.C. FRANKEN***, RAHUL SHARMA* , ** & RICHARD TRUMAN* *Department of Health and Human Services, Health Resources and Services Administration, Bureau of Primary Health Care, National Hansen’s Disease Program, Baton Rouge, LA, USA, 70803 **Department of Pathobiological Sciences, School of Veterinary Medicine, LSU, Baton Rouge, LA, USA, 70803 ***Department of Infectious Diseases, Leiden University Medical Center, Leiden, The Netherlands Accepted for publication 15 November 2011 Summary New diagnostic tools for early detection of leprosy are necessary to help reduce its transmission and severity. M. leprae unique proteins have been used to assess differences in human T-cell responses in leprosy patients, household contacts and endemic controls. In this study, we examined the response of M. leprae-infected armadillos to a variety of M. leprae recombinant antigen candidates currently being examined for diagnostic efficacy in humans. Among recently M. leprae infected armadillos, IFN-g expression was enhanced after stimulation of PBMC with all M. leprae recombinant proteins except for ML2283 (mean: 2·65 Relative Quantification (RQ)). The group mean stimulation index for M. leprae proteins ML0009, ML1601, ML2478 and ML2531 averaged 35·2 RQ and was significantly higher (P , 0·05) than that measured among the non-infected, naı¨ve group (mean 6·2 RQ). Although ML0840 tended to enhance IFN-g levels, the mean IFN-g transcript levels of the currently experimentally inoculated group (20·1 RQ) was not significantly different statistically (P ¼ 0·10) from the mean of the naı¨ve group (7·5 RQ). Also no statistically significant differences were observed in IFN-g transcript levels between the resistant and currently experimentally inoculated group (P . 0·05) or between the resistant and the naı¨ve group (P . 0·05) after stimulation of PBMCs with all M. leprae recombinant proteins. Only low levels of TNF-a were observed across all groups after in vitro stimulation with all the antigens examined. These data suggest that armadillos can be used effectively to help identify M. leprae specific proteins that

Correspondence to: Maria T Pena, NHDP Baton Rouge, Louisiana, USA (e-mail: [email protected])

422

0305-7518/11/064053+10 $1.00

q Lepra

Cytokine responses by armadillos

423

may be applied for monitoring T-cell responses in M. leprae infected hosts as their disease progresses as well as for the early diagnosis of leprosy.

Introduction Although the prevalence of leprosy has decreased worldwide, large numbers of new cases continue to be detected each year and the disease appears to be perpetuated through transmission from a large occult reservoir of untreated cases, subclinically infected individuals or other unknown sources.1 Currently, no effective diagnostic tests are available that can aide surveillance and detection of individuals who might be incubating the infection or may be likely to progress in their disease and develop clinical leprosy. Because of the well known spectrum of immunological responses that different individuals manifest towards Mycobacterium leprae, development of new diagnostic tests that have good sensitivity and specificity throughout the clinical spectrum of leprosy has been challenging. Some assays that detect antibodies to M. leprae-specific molecules, such as phenolic glycolipid-I (PGL-I), can identify leprosy patients with strong humoral responses to M. leprae. However, these assays generally have low sensitivity among patients that develop mainly a cell-mediated immune response (TT/BT) as well as patients at pre- or subclinical stages who are not exhibiting high antibody titers. With completion of the M. leprae genome,2 it became possible to identify large numbers of potential diagnostic antigens and new efforts are being invested in developing molecular tools for leprosy diagnosis. Among the most promising of these are assays based on the selection of recombinant proteins and peptides specific for M. leprae that might be combined in ways to allow detection of disease in its early stages and across the spectrum of leprosy. Recently two studies simultaneously conducted in Brazil,3,15 used comparative genome analysis to identify M. leprae-specific recombinant proteins and peptides likely to have high T-cell recognition. In deployment, they found higher IFN-g production in PBMC assays with samples from paucibacillary patients and household contacts (HHC) of multibacillary leprosy patients compared to samples from tuberculosis patients and endemic controls. Similarly, strong M. leprae-specific serological responses to recombinant proteins among paucibacillary patients were found with little cross-reactivity among TB cases and endemic controls.5 In order to increase assay specificity Geluk et al.4 applied synthetic peptides spanning the sequences of M. leprae-unique proteins to analyse induction of IFN-g responses in leprosy patients, HHC, healthy controls, non-endemic TB patients, and BCG vaccinees. Using the combined T-cell responses towards four of these peptides all (n ¼ 6) PB patients and 13/14 HHC recognised these peptides without compromising specificity. Other than man, nine-banded armadillos (Dasypus novemcinctus) are the only natural hosts of M. leprae. Armadillos are well developed as the hosts-of-choice for in vivo propagation of M. leprae, and they closely recapitulate many of the most significant pathological aspects of leprosy as seen in man, such as extensive neurological involvement.6 They also manifest granulomas to M. leprae which are indistinguishable histopathologically from those seen in humans. Although the majority of armadillos develop a lepromatous form of leprosy, the full spectrum of histopathological responses can be observed among armadillos and the animals can be classified according to the Ridley-Jopling scale from lepromatous (LL) to tuberculoid (TT) using lepromin skin testing.7 Like humans, the response of individual armadillos is idiosyncratic, and a reliable proportion of the animals appear to be naturally

424

M. Pena et al.

resistant to experimental infection with M. leprae. Early studies showed that the PGL-I IgM antibody response of infected armadillos generally correlated with the bacterial load within the animal’s reticuloendothelial tissues, and could be used to monitor the progress of their experimentally induced disease. More recently, Duthie et al.8 identified a combination of antigens that could yield early and accurate diagnosis of experimentally infected armadillos based on antibody responses. To better inform us about cell mediated cytokine responses among these unique hosts, we examined the response of M. leprae-infected armadillos to a variety of recombinant M. leprae proteins currently under evaluation for diagnosis of leprosy in humans. Materials and Methods ANIMALS AND EXPERIMENTAL INOCULATION

A total of 33 armadillos caught in the wild were used in this study. The animals were conditioned to captivity for a period of 3 to 6 months and screened for pre-existing infections including seropositivity for PGL-I IgM antibodies. Each animal was lepromin skin tested with heat-killed armadillo-derived M. leprae prepared as Lepromin-A using 1·6 £ 107 M. leprae in 0·1 ml of normal saline injected intradermally to the abdominal skin. After 21 days the skin test sites were biopsied using a 4 mm biopsy punch and examined histopathologically. The reactions were classified according to the Ridley-Jopling scale as described previously.9 Animals that are not seropositive for PGL-I IgM antibodies were considered ‘naı¨ve’. For in vivo propagation of M. leprae, following conditioning to captivity, naı¨ve animals (PGL-I negative) were intravenously inoculated with a suspension of 1 £ 109 viable M. leprae bacteria derived from passage in nude mice.10 The majority of these animals succumbed to fully disseminated infection within 18 –24 months.11 These animals were designated ‘infected’. Animals that did not develop disseminated leprosy within 36 months were considered ‘resistant’ and removed from propagation.9 Most armadillos will begin to exhibit clinical signs for establishment of M. leprae infection, such as detectable PGL-I IgM antibodies, within 6 to 12 months post infection. The majority of the animals (n ¼ 30) used in this study were classified as LL (lepromatous) phenotype by the lepromin skin test, three were classifed as BL/BT (Table 1). For this study blood samples from armadillos were tested and classified into three groups: 1. naı¨ve armadillos (n ¼ 8) had been lepromin tested and classified histopathologically, but had not been experimentally inoculated with viable M. leprae nor showed any detectable PGL-I IgM antibodies within . 6 months of captivity. One animal was classified BL/BT. 2. Currently experimentally inoculated armadillos (n ¼ 18), that had been incubating M. leprae infection for less than 36 months at the beginning of this study. Two of these animals were classified as BL/BT. All of these animals exhibited detectable PGL-I IgM12 antibodies, although the titer for three of them had waned to non-detectable levels during the course of this study. 3. Resistant armadillos (n ¼ 7) consisted of animals that had been experimentally inoculated with M. leprae for longer than 36 months and had never shown any detectable PGL-I IgM antibodies or other signs of systemic dissemination of M. leprae during that period or since. All studies with animals were conducted in accordance with established ethical guidelines of the U.S. Public Health Service for the care and use of research animals under assurance number A3032-1.

LL LL LL LL LL LL LL LL LL LL LL LL LL LL LL LL BL/BT BL/BT BL/BT LL LL LL LL LL LL LL LL LL LL LL LL LL LL

I I I I I I I I I I I I I I I I I I N N N N N N N N R R R R R R R

þ þ þ þþ þ þþ þ þþ þ þ þ þþ þ þþ þþ þ – – – þþ þþ þ – – – – – – – – – – – – – – –

54·5 24·6 2·01 13·9 4·8 59·2 17 2·3 415 10·9 8·2 7·5 3·9 85·5 123 25·7 7·2 19·5 4·4 8·9 2 0·1 22·6 – 12·5 7·6 21·8 3·7 42·9 10·6 119 3·3 0·2

ML PGL-I 0009

51·9 45·1 7 6·8 2·5 26·6 10·9 7·9 50·7 3·07 1·3 9·3 0·9 26·4 82·9 14·7 2·8 10·9 5 3·3 1·5 0·5 28·9 – – – 33·1 6·3 70·4 5 70·4 3·1 0·2

ML 0840 20 9 4·4 6·6 3·5 33 20 0·8 255 10·7 5·2 15·7 2·3 14·1 21·3 13·5 5·9 23·2 6·4 3·2 1·8 0·04 8·5 5·7 21·4 0·2 28·6 5·6 41·6 17·8 25·1 3·3 0·2

ML 1601 4·4 1·7 3·1 2·6 2·8 2·7 1·8 2·3 9·2 0·9 0·9 0·5 0·5 3·1 1·8 1·3 1·5 6·6 2·5 4·6 0·6 0·05 0·7 0·2 5·6 9·8 5·2 4·5 23·3 3 2·9 0·9 0·05

ML 2283 29·3 9·8 4·1 12·7 4·1 162 14·8 3·1 189 21·6 6·6 10·9 2·4 22·7 16·9 21·6 8 174 8·2 1·9 2·9 0·03 9·8 10 13·2 2·3 16 2 31·7 11·2 14·2 2·4 0·2

ML 2478 6 5·7 2·8 15·4 2·4 140 8·6 14·1 5·8 6·3 1·9 2·7 – 19·8 29·2 74·9 3·2 102 3·1 5·3 1·5 0·06 12·1 3·9 5·6 – 16 2·3 5·6 27·9 17·2 3 0·1

ML 2531 182 189 95·4 354 28·9 369 38·9 10·4 305 96·8 19·9 54·9 6 74·7 43·1 233 44·1 148 65·9 89·8 89·8 42·4 26·1 17·8 388 41·6 349 11·2 8·6 174 30 70·9 21·5

3·1 9·8 5·4 2 3·4 5·7 5·5 1·5 9·4 3·7 0·7 2·5 1·7 3·7 5·3 5 1·5 2·8 1·9 1·1 2·8 2·2 6·7 – 1·8 5·2 4·9 2·1 2·9 4·3 1·4 0·2 3·5

ML ConA 0009 3·3 5·6 2 1·5 1·5 4·1 2·8 3·2 1·8 1 1 1·2 0·8 2·4 4·9 2·9 1·2 1·8 1·4 0·8 1·1 1·7 3·1 – 0·7 0·8 1·9 1·7 1·7 0·8 1·2 0·3 3·3

ML 0840

TNF-a (RQ)

3·5 3·1 2 1·5 1·7 3·8 5 1·5 3·7 1·7 1·8 2·3 1·1 2·5 2·7 3·7 2·1 3·3 1·7 0·9 2·2 1·2 2·1 2·3 1·2 0·2 3·4 1·8 2·1 1·2 1·2 0·2 2·7

ML 1601 2·8 1·9 1·3 1·2 0·7 2·7 1·6 1·6 1·4 0·8 1·7 0·9 0·9 1·7 1·2 2·2 1·7 1·7 1·4 1·3 0·9 1·2 1·3 0·5 1·2 0·5 1·5 1·8 1·5 1·3 1·8 0·2 1·8

ML 2283 3·2 2·6 2·2 1·8 2 41 4·1 1·5 5·2 3·1 2·4 1·7 1·3 2·5 3·1 3·9 1·7 7·7 1·4 0·7 1·3 1·8 2·6 2·5 1·5 1·9 3·2 1·8 1·5 3·4 1·2 0·2 3·3

ML 2478 3 2·7 3·3 2 1·9 98 3·4 2·5 1·8 4·1 1·6 1·9 – 2·9 2·5 5·4 2·3 4·5 2·9 0·4 1·3 1·2 2·7 2·7 0·9 4·9 3·8 1·3 2·6 1·3 0·7 0·3 3·3

ML 2531

3·9 2·9 9·1 2·3 6·3 6·2 7·3 2·6 4·3 5·3 4·2 3·6 2 4 2·6 5·5 6·9 6·3 74·6 3·5 3·5 2·9 3·2 9·7 18·9 5·8 3·8 1·8 2·7 9·2 3·3 1·5 0·4

ConA

G: group, I: Infected, N: Naive and R: Resistant. #: Animal ID, Lep: lepromin test, PGL-I: þ þþ (.0·1 OD), þ þ(0·8–0·1 OD), þ (0·7– 0·8 OD), – (undetectable). High, mid and low positive by ELISA. Comparison of antibody and CMI responses to candidate M. leprae antigens. Results of in vitro stimulation of armadillos PBMCs with M. leprae recombinant proteins are expressed as Relative Quantification (RQ) and indicates fold increase of transcript levels relative to the control stimulus (medium alone).

8T14 8T54 7R02 8S16 8T72 9B17 9D91 10W21 8U62 8U75 8X107 8S05 9B58 8X117 8X83 8S01 5R110 9W79 6-25 10-32 10-31 8-110 9-78 9-60 9.105 10-700 3R07 6R04 6L35 5L59 7R65 3V76 3X119

Lep

G #

IFN-g (RQ)

Table 1. Comparison of Antibody and CMI responses to candidate M. leprae antigens

Cytokine responses by armadillos 425

426

M. Pena et al.

RECOMBINANT M. LEPRAE PROTEINS

The genes for ML0009, ML0840, ML1601, ML2283, ML2478 and ML2531 were amplified by PCR from genomic DNA of M. leprae (generously provided by the late Dr. M.J. Colston) and cloned using the Gateway technology platform (Invitrogen, Carlsbad, CA, USA) with pDEST17 expression vector containing an N-terminal histidine tag (Invitrogen, Carlsbad, CA, USA).13 Sequencing was performed on selected clones to confirm identity of all cloned DNA fragments. Recombinant proteins were overexpressed in E. coli BL21(DE3) and purified as described to remove any traces of endotoxin. The purified protein was analysed by 12% SDS-PAGE followed by Coomassie Brilliant Blue staining and Western-blotting with an anti-His antibody (Invitrogen, Carlsbad, CA, USA) to confirm size and purity. Endotoxin contents were below 50 IU per mg recombinant protein as tested using a Limulus Amebocyte Lysate (LAL) assay (Cambrex, East Rutherford, NJ, USA). To exclude protein non-specific IFN-g release or cellular toxicity ML2531 was tested in IFN-g release assays using PBMC or whole blood of M. leprae-unexposed, BCG-negative, Mantoux skin test negative healthy donors. For each antigen only one batch preparation was used. IN VITRO ASSAYS

Armadillo peripheral blood mononuclear cells (PBMCs) were purified from 8 ml peripheral blood collected in BD Vacutainerw CPT Mononuclear Cell Preparation Tubes (BD Biosciences, San Jose, CA) and mononuclear cells were isolated after centrifugation (1600 £ g for 45 minutes, 25 8C). The mononuclear cell layer was removed, washed three times with cold PBS and resuspended in culture medium (RPMI 1640 medium containing 2 mM glutamine and HEPES) supplemented with 10% fetal bovine serum (FBS). 100 ml of the cell suspension (4 £ 106 cells/ml) was added to a 96 well round bottom tissue culture plate containing 100 ml complete media with 2ME and the antigens (20 ml) and the plate was incubated for 18 hours at 33 8C in 5% CO2 humidified atmosphere. Six different M. leprae recombinant proteins (ML0009, ML0840, ML1601, ML2283, ML2478 and ML2531) at a final concentration of 10 mg/ml were used for in vitro stimulation. Duplicate wells containing concanavalin A (Con A 40 mg/ml) (Sigma, St. Louis, MO) or media alone were used as positive control for cytokine production or indicator of non-stimulation, respectively. After overnight incubation the plate was centrifuged and the supernatants removed. PBS was added to the cell pellet followed by a second centrifugation and 350 ml of RLT buffer with 2ME (10 ml/mL) was added and then transferred to a 1·5 ml centrifuge tube which was stored at 2 70 8C for RNA isolation. RNA was isolated using RNeasyw Plus Mini kit (Qiagen,Valencia, CA) according to the manufacturer’s recommendations. RT-PCR AND RELATIVE QUANTIFICATION

D. novemcinctus IFN-g cDNA sequence (GI: DQ094083) was obtained from NCBI and primer sequences constructed as previously described.14 Bioinformatic tools were used to identify the putative nucleotide sequence of Armadillo TNF-a. H. sapiens TNF-a nucleotide sequence of (GI:224589818) was used to search for homologous sequences in the D. novemcinctus whole genome sequence (WGS) trace files (6X) using BLASTn (http:// www.ncbi.nlm.nih.gov/BLAST/). Consensus sequence from three different trace files was obtained. Armadillo specific gene specific Primers (TNF-a F: 50 - TGGTGCCTCAGCCT-

Cytokine responses by armadillos 0

0

0

427

0

CTTCTC-3 TNF-a R: 5 - GCCGATCACCCCAAACTG-3 , IFN- gF: 5 -GAATTACACGGGCTATCTCTTAGCTT-30 & IFN- g R: 50 - AAGGTCGGCCTGGCAGTAG-3) and probes (TNF-a: CCACCGCGCTTTTCTGCCTGC and IFN-g:TCAGCTTTGCATCATTTTGGGTTCTTCTAGC) were designed by using Primer Expressw Software v3.0 (Applied Biosystems, Carlsbad, CA). Briefly, cDNA was made from RNA using Advantage RT for PCR kit (Clontech Laboratories, Mountain View, CA) according to manufacturer recommendations. Real time PCR was run for 40 cycles 15 seconds at 95 8C and 1 minute at 60 8C in ABI 7300/7500 (Applied Biosystems, Foster City, CA) Real Time PCR system. Relative expression of these cytokines was analysed in cDNA from PBMC treated with different M. leprae recombinant proteins and control (medium alone) using the DDCt method,13 where GAP3DH served as a normaliser. The results are expressed as fold change increase relative to the control stimulus (medium alone). STATISTICAL ANALYSIS

Differences in cytokine responses after in-vitro stimulation of PBMCs from Infected, Resistant and Naives armadillos with M. leprae recombinant proteins were analysed with unpaired t test using Graph Pad software (version 3.0) (GraphPad Software, Inc, La Jolla, CA) and P values , 0·05 were considered statistically significant and compared to linear regression using SigmaPlot (11·0). Results In this study, currently experimentally inoculated armadillos recognised five out of six recombinant M. leprae proteins examined (ML0009, ML0840, ML1601, ML2478 and ML2531) by producing high IFN-g responses (Figure 1). Within this group, PBMCs from 10 armadillos showed higher IFN-g transcript levels whereas PBMCs from eight armadillos showed lower IFN-g production after stimulation with five out of six recombinant proteins. When we examined T-cell reactivity to M. leprae antigens versus anti-PGL-I antibody levels, we found that three out of 10 armadillos that showed high T-cell responses had low anti-PGL-I antibody responses. Although the trend was not significant statistically, 8/8 armadillos that showed low IFN-g responses had high anti-PGL-I antibody titer. Despite the variability of the response to M. leprae recombinant proteins among the animals in the currently experimentally inoculated group, the mean IFN-g transcript production in this group was significantly higher than that of the naı¨ve group for ML0009 (P ¼ 0·04), ML1601 (P ¼ 0·02), ML2478 (P ¼ 0·01) and ML2531 (P ¼ 0·03). No statistically significant differences (P ¼ 0·10) in IFN-g responses were seen for ML0840 between the currently experimentally inoculated (20·1 RQ) and the naı¨ve group (7·5 RQ). Also no statistically significant differences were observed in IFN-g responses between the resistant and currently experimentally inoculated group (P . 0·05) or between the resistant and the naı¨ve group (P . 0·05) after stimulation of PBMCs with all M. leprae recombinant proteins. For ML2283, little or no IFN-g upregulated expression was seen after stimulation of PBMCs among all the test groups. Linear regression analysis between PGL-I as independent variable and RQ as dependent variable resulted in no association between these variables for all the antigens tested. In general, M. leprae recombinant proteins did not elicit enhanced TNF-a transcript production in PBMCs of armadillos (Figure 2).

428

M. Pena et al.

Fold increase relative to control (media)V

IFN-γ response to M. leprae recombinant proteins in infected-, naïve- and resistant armadillos 200

P = 0·04

P = 0·33

P = 0·51

200

150

150

100

100

50

50

0

0 Naïve

Infected

Resistant

P = 0·78 P = 0·10

Naïve

Fold increase relative to control (media)V

ML0009

200

P = 0·02

P = 0·64

P = 0·22

200

150 100

100

50

50

0

0 Infected

Resistant

Naïve

Fold increase relative to control (media)

P = 0·55

200

150

150

100

100

50

50

0

0 Naïve

Infected ML2478

P = 0·50

Infected

Resistant

ML2283

P = 0·08 P = 0·01

Resistant

P = 0·64 P = 0·26

ML1601

200

Infected ML0840

150

Naïve

P = 0·42

Resistant

P = 0·23 P = 0·03

Naïve

Infected

P = 0·5

Resistant

ML2531

Infected armadillos with PGL-I values that waned

BL/BT armadillos

Figure 1. IFN-g mRNA expression in response to M. leprae recombinant proteins in naı¨ve, infected (experimentally M. leprae inoculated with fully disseminated leprosy) and resistant (experimentally inoculated without disease) armadillos. IFN-g mRNA expression was analyzed after overnight in vitro stimulation of PBMCs of infected (n ¼ 18), naı¨ve (n ¼ 8) and resistant (n ¼ 7) armadillos with M. leprae proteins. Results are expressed as Relative Quantification (RQ) and indicates fold increase of transcript levels relative to the control stimulus (medium alone).

The currently experimentally inoculated group showed significantly higher TNF-a expression after stimulation of PBMCs with ML1601 (P ¼ 0·007), and ML2478 (P ¼ 0·04) when compared to the naı¨ve group. Additionally, the currently experimentally inoculated group showed a significantly higher production of TNF-a transcript after stimulation ML1601 (P ¼ 0·04) than the resistant group. Animals in the currently experimentally inoculated group of which PGL-I IgM antibody titers had waned showed the highest overall responses in the

Cytokine responses by armadillos

429

TNF-α response to M. leprae recombinant proteins in infected-, naïve- and resistant armadillos P = 0·11

Fold increase relative to control (media)

P = 0·18

14 12 10 8 6 4 2 0

P = 0·43

Naïve

P = 0·59

Infected

14 12 10 8 6 4 2 0

Resistant

P = 0·05

Naïve

Infected

ML0009

Fold increase relative to control (media)

P = 0·007

Naïve

P = 0·4 P = 0·86

Infected

14 12 10 8 6 4 2 0

Resistant

P = 0·027

Naïve

Fold increase relative to control (media)

P = 0·04

Naïve

P = 0·09

Infected

P = 0·55

Infected

ML1601 >40 14 12 10 8 6 4 2 0

Resistant

ML0840

P = 0·04

14 12 10 8 6 4 2 0

P = 0·86

Resistant

ML2283 P = 0·99

Resistant

>40 14 12 10 8 6 4 2 0

P = 0·05 P = 0·08

Naïve

ML 2478 Infected armadillos with PGL-I values that waned

P = 0·68

Infected

Resistant

ML 2531 BL/BT armadillos

Figure 2. TNF-a mRNA expression in response to M. leprae recombinant proteins in naı¨ve, infected (experimentally M. leprae inoculated with fully disseminated leprosy) and resistant (experimentally inoculated without disease) armadillos. TNF-a mRNA expression was analysed after overnight in vitro stimulation of PBMCs of infected (n ¼ 18), naı¨ve (n ¼ 8) and resistant (n ¼ 7) armadillos with M. leprae proteins. Results are expressed as Relative Quantification (RQ) and indicates fold increase of transcript levels relative to the control stimulus (medium alone).

group. The currently experimentally inoculated armadillos showed a higher IFN-g transcript levels than naı¨ve armadillos after in vitro stimulation of PBMCs with most M. leprae recombinant proteins tested here. Monitoring the cell mediated immune response towards these M. leprae proteins may be an effective indicator of recent exposure to M. leprae.

430

M. Pena et al.

Discussion These data indicate that specific M. leprae recombinant proteins can elicit strong IFN-g responses in experimentally infected armadillos. Although these animals generally develop a multibacillary-type of disease, T-cell based assays can be used to differentiate exposure status to M. leprae among armadillos and may contribute to longitudinal monitoring as this infection progresses. Armadillos are natural hosts of M. leprae which have extensive exposure to potential cross-reactive antigens from soil-borne organisms and environmental mycobacteria. Their response to the M. leprae -recombinant proteins tested here appeared to be highly specific and it seems likely that armadillos can be used to help develop and evaluate new T-cell based diagnostic assays for human leprosy. A previous study that also used M. leprae recombinant proteins demonstrated that two M. leprae specific antigens, ND-O-BSA and LID-1 evoked antibody responses in experimentally infected armadillos. In the current study, we examined T-cell responses to recombinant M. leprae proteins among animals currently experimentally inoculated with M. leprae and progressing in their experimentally induced disease (infected) animals which had been experimentally infected at least 3 years before but had resisted M. leprae (resistant) and naı¨ve animals not yet infected with M. leprae (naı¨ve). The currently experimentally inoculated group showed significantly higher IFN-g responses (P # 0·04) than the naı¨ve group. When we examined T-cell reactivity to M. leprae antigens versus anti-PGL-I antibody levels we found that all the armadillos with low IFN-g responses had high anti-PGL-I antibody titers and three out of 10 animals with high IFN-g responses had low anti-PGL-I antibody titers. Likewise, other studies3,4 – 16 have observed that paucibacillary leprosy patients and household contacts who have low humoral responses tended to evoke higher T-cell responses to M. leprae specific antigens. These findings and previous work5,15,4 suggest that M. leprae-unique antigens can be used to identify M. leprae infection exposure in individuals in absence of detectable levels of anti-PGL-I antibodies and when used in combination with other tests that index the humoral responses, such as PGL-I IgM antibodies, may be an effective contribution to aid the early diagnosis of leprosy. Armadillos showed varying responses to M. leprae -recombinant proteins and additional longitudinal studies are needed in order to fully assess the cytokine response patterns that may be associable with different disease states. Within the recombinant proteins we tested, ML0840 and ML1601 are known to have homologs in M. avium,15 an environmental mycobacterium that armadillos are commonly exposed to in nature. Although ML1601 is present in other mycobacterial species, it was recognised here only by the currently experimentally inoculated group but not by the naı¨ve group indicating that this protein is mainly detecting an M. leprae response and that it can be considered together with ML0009, ML2478 and ML2531 for leprosy diagnosis purposes. Interestingly, ML2283, which is unique to M. leprae, and appears to induce significant IFN-g levels in PB- and reactional leprosy patients15,16 but not MB patients, was the only protein examined that did not induce IFN-g transcript in armadillo PBMC cultures. In contrast to its potential for human disease, ML2283 may not be appropriate for diagnostic use in armadillos and differential recognition of antigens can be an important limitation when using animal models. Alternatively, this could be due to the method of analysing the IFN-g response as for humans standard ELISA were used after PBMC stimulation for 6 days.15,3 These data show that M. leprae-unique proteins selected on the basis of their specific recognition by T cells derived from M. leprae exposed humans also specifically produce

Cytokine responses by armadillos

431

IFN-g transcript in M. leprae infected armadillos. Major variations in individual responses to these antigens were observed among animals at varying stages of infection, and longitudinal monitoring of their response over the course of experimental infection in the armadillo may be informative for the development of improved diagnostic assays for human leprosy.

Acknowledgements The authors thank Roena Stevenson and Vilma Marks for helping to obtain and process the armadillo samples. This study was supported by the Netherlands Leprosy Relief Foundation (NLR) ILEP#: 702.02.65 and ILEP#: 701.02.49, The Turing Foundation and the Q.M. Gastmann-Wichers Foundation. LUMC and NHDP are part of the IDEAL (Initiative for Diagnostic and Epidemiological Assays for Leprosy) Consortium. The U.S. Health Resources and Services Administration, and the National Institutes of Allergy and Infectious Disease IAA-2646. The authors are independent from the funders. References 1 2 3 4

5

6 7 8

9 10 11 12 13

14

15 16

Truman R, Fine PE. ‘Environmental’ sources of Mycobacterium leprae: issues and evidence. Lepr Rev, 2010; 81: 89–95. Cole ST, Eiglmeier K, Parkhill J et al. Massive gene decay in the leprosy bacillus. Nature, 2001; 409(6823): 1007–1011. Spencer JS, Dockrell HM, Kim HJ et al. Identification of specific proteins and peptides in Mycobacterium leprae suitable for the selective diagnosis of leprosy. J Immunol, 2005; 175: 7930–7938. Geluk A, van der Ploeg J, Teles RO et al. Rational combination of peptides derived from different Mycobacterium leprae proteins improves sensitivity for immunodiagnosis of M. leprae infection. Clin Vaccine Immunol, 2008; 15: 522–533. Spencer JS, Kim HJ, Wheat WH et al. Analysis of antibody responses to Mycobacterium leprae phenolic glycolipid I, lipoarabinomannan, and recombinant proteins to define disease subtype-specific antigenic profiles in leprosy. Clin Vaccine Immunol, 2011; 18: 260– 267. Scollard DM, Lathrop GW, Truman RW. Infection of distal peripheral nerves by M. leprae in infected armadillos; an experimental model of nerve involvement in leprosy. Int J Lepr Other Mycobact Dis, 1996; 64: 146 –151. Job CK, Kirchheimer WF, Sanchez RM. Tissue response to lepromin, an index of susceptibility of the armadillo to M. leprae infection – a preliminary report. Int J Lepr Other Mycobact Dis, 1982; 50: 177–182. Duthie MS, Truman RW, Goto W et al. Insight toward early diagnosis of leprosy through analysis of the developing antibody responses of Mycobacterium leprae-infected armadillos. Clin Vaccine Immunol, 2011; 18: 254–259. Job CK, Truman RW. Mitsuda-negative, resistant nine-banded armadillos and enhanced Mitsuda response to live M. leprae. Int J Lepr Other Mycobact Dis, 1999; 67: 475–477. Truman RW, Krahenbuhl JL. Viable M. leprae as a research reagent. Int J Lepr Other Mycobact Dis, 2001; 69: 1–12. Truman RWaS RM. Armadillos: models for leprosy. Lab Animal, 1990; 22: 28– 32. Truman RW, Job CK, Hastings RC. Antibodies to the phenolic glycolipid-1 antigen for epidemiologic investigations of enzootic leprosy in armadillos (Dasypus novemcinctus). Lepr Rev, 1990; 61: 19–24. Franken KLCM, Hiemstra HS, van Meijgaarden KE, Subronto Y, den Hartigh J, Ottenhoff TH, Drijfhout JW. Purification of his-tagged proteins by immobilized chelate affinity chromatography: the benefits from the use of organic solvent. Protein Expr. Purif., 2000; 18: 95 –99. Pena MT, Adams JE, Adams LB et al. Expression and characterization of recombinant interferon gamma (IFN-gamma) from the nine-banded armadillo (Dasypus novemcinctus) and its effect on Mycobacterium lepraeinfected macrophages. Cytokine, 2008; 43: 124 –131. Geluk A, Klein MR, Franken KL et al. Postgenomic approach to identify novel Mycobacterium leprae antigens with potential to improve immunodiagnosis of infection. Infect Immun, 2005; 73: 5636–5644. Geluk A, van der Ploeg-van Schip JJ, van Meijgaarden KE et al. Enhancing sensitivity of detection of immune responses to Mycobacterium leprae peptides in whole-blood assays. Clin Vaccine Immunol, 2010; 17: 993 –1004.