Cell Transplantation, Vol. 21, pp. 2313–2324, 2012 Printed in the USA. All rights reserved. Copyright 2012 Cognizant Comm. Corp.
0963-6897/12 $90.00 + .00 DOI: http://dx.doi.org/10.3727/096368912X636867 E-ISSN 1555-3892 www.cognizantcommunication.com
Dermal Papilla Cells Serially Cultured With Wnt-10b Sustain Their Hair Follicle Induction Activity After Transplantation Into Nude Mice Yukiteru Ouji,*† Shigeaki Ishizaka,† and Masahide Yoshikawa*† *Department of Pathogen, Infection, and Immunity, Nara Medical University, Kashihara, Nara, Japan †Program in Tissue Engineering, Department of Parasitology, Nara Medical University, Kashihara, Nara, Japan
Dermal papilla (DP) cells are associated with the development of hair follicles (HFs) and regulation of the hair cycle. However, primary DP cells prepared from cultured HFs are known to lose their ability to induce HF after culturing in standard media, for example, fibroblast growth conditions. We explored a new culture condition by which DP cells maintained their HF induction ability. The addition of Wnt-10b to the first culture of primary DP cells promoted their proliferation and maintained their Wnt responsiveness and HF induction ability. Furthermore, DP cells in Wnt-10b-containing medium sustained those characteristics after 10 passages (100 days), which encompassed the entire experimental period. These results suggest that Wnt-10b plays a pivotal role in proliferation and maintenance of DP cells in vitro. Key words: Dermal papilla (DP); Transplantation; Wnt signaling; Wnt-10b; Hair growth; Hair reconstitution
INTRODUCTION Dermal papilla (DP) cells are specialized fibroblasts located in hair follicles (HFs) and deeply associated with the development of HFs and regulation of the hair cycle (1,5,24). Therefore, DP cells are an important target for elucidating the mechanism of HF induction and hair growth. Technical advances in isolation of DP cells from HFs and subsequent in vitro culture have made it possible to investigate the ability of these cells to induce HFs and promote hair growth (15,17,22,26). It is well known that DP cells lose their ability for HF induction and do not promote hair growth after culturing in standard media for fibroblasts [e.g., Dulbecco’s modified Eagle’s medium (DMEM) containing 10% fetal bovine serum (FBS)] (12,16,26). Therefore, it is considered important to establish an effective culture method by which the functions of DP cells are maintained. Although the effectiveness of conditioned medium obtained from cultures of skin epithelial cells has been reported (12), the medium components were not chemically elucidated in that study. As a defined chemical substance, fibroblast growth factor-2 (FGF-2) has been reported to promote DP cell proliferation along with an ability of HF induction (26). Furthermore, DP cells cocultured with Wnt-3a-producing chick embryonic
fibroblasts were demonstrated to sustain their ability to induce HFs (17), suggesting that canonical Wnts may be important for DP cells. Another study provided supportive evidence concerning the role of Wnts, as it reported that a glycogen synthase kinase (GSK) inhibitor [(2¢Z,3¢E)6-bromoindirubin-3¢-oxime (BIO)] acted favorably for maintaining DP function (43). Wnts are expressed in HFs, which are composed of epithelial cells and DP cells (10), throughout life from embryo to adult (32). We previously investigated the effects of Wnts (Wnt-3a, -5a, -10b, -11) on the differentiation of mouse primary skin epithelial cells and found that only Wnt-10b promoted differentiation of cultured epithelial cells and shaft growth of cultured hair follicles (27–29). However, there are no reports documenting the direct effects of Wnt proteins on DP cells. In the present study, we investigated the effects of Wnt-10b on primary DP cells prepared from DP cultures and DP cells after serial passages. MATERIALS AND METHODS Animals Inbred 4-week-old C3H/HeN and 8-week-old Balb/c nude (nu/nu) mice were purchased from Japan SLC (Hamamatsu, Japan). Adult C3H/HeN mice were used
Received August 7, 2011; final acceptance December 1, 2011. Online prepub date: April 2, 2012. Address correspondence to Yukiteru Ouji or Masahide Yoshikawa, Department of Pathogen, Infection, and Immunity, Nara Medical University, 840 Shijo-cho, Kashihara, Nara, 634-8521, Japan. Tel: +81-744-29-8847; Fax: +81-744-29-8847; E-mail:
[email protected] (Y.O.) or
[email protected] (M.Y.)
2313
2314
for preparation of DP cells, while postnatal day 2 (P2) C3H/HeN mice were used for preparation of primary skin epithelial cells and dermal fibroblasts, and the Balb/c nude mice were used for hair reconstitution experiments. All animal procedures were conducted in accordance with our institutional guidelines as well as those of the National Institutes of Health. Primary Cultures of DPs After Isolation From Vibrissa (Fig. 1) DPs were isolated from mouse vibrissa of 4-week-old C3H/HeN mice using a microdissection method, as previously reported (26). Briefly, the mystacal pad was cut open, the skin was inverted, and follicles were removed with microscissors (Fig. 1B-a). The collagen capsules surrounding vibrissae follicles were removed to expose the follicle base, and DPs were dissected out using fine forceps (Fig. 1B-b). Each DP was placed on a 6-cm dish and quietly cultured for 4 days in DMEM containing 10% FBS (Fig. 1B-c). DP cells appeared only around the DPs and began to show rapid outgrowth over the following 2 days (Fig. 1B-d). By day 10, cells had spread throughout all areas of the dishes (Fig. 1B-e) and a high level of alkaline phosphatase (ALP) activity was expressed in nearly all of the cultured DP cells (Fig. 1B-f). At the end of 10 days, DP outgrowths were harvested with 0.25% trypsin-EDTA and used for culturing of DP cells after washing with saline. Preparation of rWnt-10b We previously established a Wnt-10b-secreting COS [CV-1 (simian) in Origin and carrying the SV40 genetic material] cell line (Wnt-COS cells) by introducing the Wnt-10b cDNA gene (29). mock-COS and Wnt-COS cells were seeded into 10-cm dishes and then cultured for 48 h in DMEM containing 10% FBS. After 48 h, the supernatants were collected and used as culture media for DP cells after filtration with a 0.22-mm filter membrane. It has been reported that the culture supernatant of WntCOS cells (Wnt-COS supernatant) contains bioactive Wnt-10b protein, whereas the culture supernatant of mock-COS cells (mock-COS supernatant) does not (29). Culture of DP Cells Outlines of the DP and DP cell culture protocols are shown in Figure 1A. One thousand harvested primary DP cells from DP cultures were seeded into 6-cm culture dishes and cultured in DMEM containing 10% FBS, COS supernatant, or Wnt-COS supernatant, with the medium changed every 4 days. DP cells were harvested on day 10 using 0.25% trypsin-EDTA and used for RT-PCR experiments, TOPFLASH assays, or transplantation. DP cells cultured in Wnt-COS supernatant were passaged every 10 days until the end of the 10th culture.
Ouji, Ishizaka, and Yoshikawa
Alkaline Phosphatase (ALP) Activity The expression of ALP was observed using an alkaline phosphatase kit (Sigma), according to the manufacturer’s protocol. Briefly, the cells were washed twice in saline, fixed in fixation solution at room temperature, and washed with water. Dye solution was added, and incubation was performed at room temperature for 30 min. The cells were then rinsed well with water for three to four times and observed under a light microscope (2,20). Proliferation Assay DP cells were plated at a density of 50 cells per well in flat-bottom 96-well plates, and cultured with or without recombinant Wnt-10b. The culture plates were subjected to cell proliferation assays with a CyQUANT® Cell Proliferation Assay Kit (Molecular Probes, CA). TOPFLASH Assay Involvement of the canonical Wnt signaling pathway was examined using reporter assays. Two reporter plasmids, pTOPFLASH, carrying the T-cell factor (TCF)binding consensus sequence followed by the luciferase gene, and pFOPFLASH, carrying the dominantnegative TCF-binding sequence instead of the wildtype sequence in pTOPFLASH, were kindly supplied by Dr. B. Vogelstein (19). DP cells were transfected with the reporter plasmids, and then 4 h later, the cell culture medium was removed and replaced with medium with or without Wnt-10b. After 48 h of incubation, the cells were lysed and luciferase activity was quantified using a luciferase reporter assay kit (Clontech, Worcester, MA), as recommended by the manufacturer, and normalized using the level of b-galactosidase (b-gal) as the internal control. RT-PCR Total RNA was purified using Trizol (Invitrogen, Carlsbad, CA) following the protocol of the manufacturer. One microgram of DNase-treated total RNA was used for first-strand cDNA. This reaction was performed using a random primer (Invitrogen) and Moloney murine leukemia virus (M-MLV) reverse transcriptase (Promega, Madison, WI). For PCR analysis, 0.5 mg of cDNA was used as a template, and amplification was performed using the primer sequences shown in Table 1. The general PCR conditions were 25–30 cycles at 94°C for 2 min, 94°C for 30 s, 52–62°C for 30 s, and 72°C for 1 min. The PCR products were run on 1.5% agarose gels. Hair Reconstitution Assay A hair reconstitution experiment was performed as previously reported (18,28). Briefly, epidermal keratinocytes were isolated from the dorsal skin areas of C3H/HeN mice on postnatal day 2. The isolated skin samples were washed
Wnt-10b-TREATED DP CELLS MAINTAIN PROPERTIES
2315
Figure 1. Experimental design and procedures. (A) Outline of the experiments. Dermal papilla (DP) cultures: DPs were isolated from vibrissa of C3H/HeN mice using a microdissection method, then placed in 6-cm dishes, and quietly cultured in Dulbecco’s modified eagle’s medium (DMEM) containing 10% fetal bovine serum (FBS). DP outgrowths were harvested with 0.25% trypsin-EDTA on day 10 and then used for DP cell cultures. DP cell cultures: Primary DP cells (1 ´ 103) harvested from DP cultures were seeded into 6-cm culture dishes and cultured in DMEM containing 10% FBS, COS supernatant (mock-COS sup), or Wnt-COS supernatant (Wnt-COS sup). DP cells were harvested on day 10 and used for RT-PCR and TOPFLASH assays or transplantation. DP cells cultured in Wnt-COS sup were passaged every 10 days until the end of the 10th culture. (B) Isolation and cultivation of DP cells. (a) Vibrissa follicles were isolated from 4-week-old C3H/HeN mice. (b) The collagen capsule surrounding each follicle was removed to expose the follicle base, and then the DP (enclosed by dotted line) was dissected. Scale bars: 250 mm (in a and b). (c) DP cells appeared only around the DP (arrow) on day 4. (d) During the following 2 days, DP cells showed rapid outgrowth. (e, f) By day 10, DP cells had spread to all areas of the dishes and showed alkaline phosphatase (ALP) activity. Scale bars: 100 mm (in c–f). (C) Experimental procedures for hair reconstitution assay. Epidermal keratinocytes from P2 C3H/HeN mice (2.5 ´ 106) and DP cells (2.5 ´ 106) were used for transplantation into Balb/c nude mice. (a) Silicon transplantation chambers were implanted into dorsal sites of Balb/c nude mice, and then a mixture of cells was injected into each of the chambers. (b) One week after transplantation, the roof of the chamber was cut off. (c) The chamber was removed 2 weeks after transplantation. (d) Two weeks after removing the chambers, hair follicle formation in the reconstituted skin was assessed.
2316
Ouji, Ishizaka, and Yoshikawa
Table 1. Gene-Specific Primers Used in the Present Study Genes Versican Lef-1 Ptc-1 Gli-1 Gapdh
Primer Sequences
Product Size (bp)
GeneBank Accession No.
Temp. (°C)
Forward: 5¢- gacgactgtcttggtgg Reverse: 5¢- atatccaaacaagcctg Forward: 5¢- actgtcaggcgacacttcc Reverse: 5¢- tgcacgttgggaaggagc Forward: 5¢- tcctcatatttggggccttc Reverse: 5¢- ctgatccatgtaacctgtctcc Forward: 5¢- tccaatgactccaccacaag Reverse: 5¢- cattgaaccccgagtagagtc Forward: 5¢- accacagtccatgccatcac Reverse: 5¢- tccaccaccctgttgctgta
285
NM_001081249
58
541
NM_010703
58
338
NM_008957
58
493
NM_010296
58
452
NM_008084
58
Lef-1, lymphoid enhancer binding factor-1; Ptc-1, patched homolog-1; Gli-1, GLI-Kruppel family member GLI-1; Gapdh, glyceraldehyde-3-phosphate dehydrogenase.
several times with PBS and incubated for 2 h at 37°C in 0.25% trypsin. Detachment of the dermis from the epidermis was performed gently using forceps, after which cells were scrubbed from the epidermis-facing surface of the dermis using the belly of the forceps. The keratinocytes thus obtained were suspended in EpilifeTM serumfree culture medium and plated in 10-cm dishes coated with collagen type I and incubated for 2 days and then used as keratinocytes for transplantation. Mixture solutions containing epidermal keratinocytes (2.5 ´ 107/ml) and DP cells (2.5 ´ 107/ml) passaged with DMEM, mockCOS supernatant, or Wnt-COS supernatant were used for transplantation into Balb/c nude mice (n = 3 or 5) (Fig. 1C). Silicon transplantation chambers, kindly supplied by Dr. J. Kishimoto, were implanted into dorsal sites of the Balb/c nude mice (Fig. 1C-a) where the skin had been removed, and then 100 µl of mixture was injected into each of the chambers. One week after transplantation, the roof of the chamber was cut off to facilitate drying of the injured site (Fig. 1C-b), and the chamber was removed 2 weeks after transplantation (Fig. 1C-c). Two weeks after removing the chambers, skin tissues were harvested, embedded in OCT compound, and stained with hematoxylin–eosin, and then hair follicle formation in the reconstituted skin was assessed (Fig. 1C-d). Immunohistochemistry On day 28, grafted mice were terminally anesthetized using an overdose of pentobarbital IP, after which the grafted skin tissues were removed and postfixed for 24 h in 4% paraformaldehyde in PBS at 4°C and then sectioned. The sections were equilibrated in 10% sucrose in PBS for 4 h at 4°C, then 15% sucrose in PBS for 4 h at 4°C, and finally in 20% sucrose in PBS overnight at 4°C. Next, they were embedded in OCT compound (Tissue-TEK, Miles, Elkhart, IN) and frozen in liquid nitrogen. The sections were cut into 10-µm thick slices using a cryostat and placed on
3-aminopropyltriethoxysilane-coated slides. After rinsing in PBS, they were permeabilized in methanol at –20°C for 5 min. The sections were then blocked with HISTOMOUSETM blocking solution (Zymed Lab., Carlsbad, CA) and exposed to primary antibodies, followed by secondary antibodies. The following antibodies and dilutions were used: AE13 and AE15 (mouse, diluted 1:100, kindly provided by Dr. T. T. Sun) (3) and Alexa 546-conjugated antimouse antibodies (diluted 1:200, Molecular Probes). AE13 and AE15 are known to recognize the cortex (cytokeratin) and inner root sheath (trichohyalin), respectively, of mouse hair follicle tissue (21). Nuclei were stained with DAPI (4¢6¢-diamidino2-phenylindole). Fluorescence was examined using a FLUOVIEW FV1000 confocal analyzer (OLYMPUS, Japan) or Zeiss Axiovert 200 microscope. Statistical Analysis Data are expressed as the mean ± SD of five independent experiments. Statistical significance was tested using Tukey’s test. Results were considered significant at p
