Detection of cytomegalovirus DNA in sera of liver transplant recipients.

JOURNAL OF CLINICAL MICROBIOLOGY, June 1994, p. 1431-1434 0095-1 137/94/$04.00+0 Copyright (C 1994, American Society for Microbiology

Vol. 32, No. 6

Detection of Cytomegalovirus DNA in Sera of Liver Transplant Recipients ROBIN PATEL,' THOMAS F. SMITH,2 MARK ESPY,2 RUSSELL H. WIESNER,3 RUUD A. F. KROM,3 DANIEL PORTELA,4AND CARLOS V. PAYAl.4* Division of Infectious Disease and Internal Medicine,' Division of Clinical Microbiology, 2 Transplantation Unit, 3 and Division of Experimental Pathology,4 Mayo Clinic, Rochester, Minnesota 55905 Received 8 October 1993/Returned for modification 26 January 1994/Accepted 4 March 1994

We prospectively studied the utility of the amplification of cytomegalovirus (CMV) DNA in the sera of liver transplant recipients in order to predict symptomatic CMV infection, thus enabling preemptive therapy with antiviral agents. Serum samples obtained at biweekly intervals from 20 sequential liver transplant recipients for at least 8 weeks following transplantation were tested by the PCR amplification procedure. Results were correlated with blood and urine cultures, histopathological findings from infected organs, and clinical manifestations. Six patients (30%) developed symptomatic CMV infection; in five (83%) of these patients, CMV DNA was detected prior to symptomatic CMV infection, and in one (17%) of these patients, CMV DNA was detected at the time of symptomatic CMV infection. CMV DNA was detected a mean of 13 days (range, 0 to 23 days) prior to the onset of symptomatic CMV infection. In addition, CMV DNA was detected in the sera of four of five patients with asymptomatic viremia and two patients with asymptomatic viruria. Lastly, the PCR was negative for sera from seven patients with no evidence of CMV infection. We found that PCR was able to detect the presence of CMV DNA in the sera of liver transplant recipients at a sensitivity of 92% and a specificity of 100%v for CMV infection, while the sensitivity and specificity for symptomatic infection were 100 and 57%, respectively.

Cytomegalovirus (CMV) is the single most frequent cause of infection in liver transplant recipients (11). In addition to causing significant morbidity and mortality in this patient population, CMV has been associated with an immunosuppressive state, superinfection with other opportunistic pathogens, and allograft rejection (15). Although ganciclovir is used to treat symptomatic CMV infection in liver transplant recipients, its role in the prophylaxis of symptomatic CMV infection remains unclear (9), and the cost of therapy, the emergence of resistant viral strains, and side effects are major concerns. An alternative to universal prophylaxis is preemptive therapy, which theoretically involves the administration of an antimicrobial agent to a subgroup of patients deemed to be at risk for symptomatic infection, but prior to its occurrence. In comparison with a prophylactic approach of administering drug to all patients, only patients at risk of developing symptomatic CMV infection would receive specific antiviral therapy. Therefore, fewer patients would receive the drug and would probably receive the drug for a shorter period of time; this would provide advantages in terms of the cost of therapy and likely reductions in the emergence of resistant viral strains and the side effects of the drug. In order to carry out preemptive therapy for CMV, it is necessary to have a laboratory marker or patient characteristic which identifies a subgroup of individuals at high risk of symptomatic infection before it occurs and which identifies a time when antiviral intervention would be maximally effective in aborting the impending disease process (10). Several laboratory techniques could be used for this purpose, including shell vial and conventional tube cell viral cultures, antigenemia tests, and molecular biological methods, including PCR, which can be used to detect CMV DNA or RNA in clinical specimens. The

value of CMV viremia and/or antigenemia as a useful marker of impending symptomatic CMV infection in liver transplant recipients remains to be established. Detection of CMV DNA by PCR in peripheral blood leukocytes is a sensitive but nonspecific marker of CMV disease following liver transplantation (2). A major disadvantage of most of these methods is that labor-intensive techniques, such as the use of FicollHypaque gradients, are required to separate peripheral blood leukocytes from whole blood (8); furthermore, specimens must be processed within hours of being obtained from patients. In comparison with leukocytes, serum or plasma have the advantage of being easier substrates to process for PCR. CMV DNA has been successfully detected in serum by three investigators in non-liver transplant populations (1, 5, 13), and a recent study indicates that PCR of plasma can be used to predict the onset of CMV disease in bone marrow and kidney transplant recipients (14). It is unknown whether plasma and serum are equivalent substrates for the amplification of CMV DNA, and techniques with neither of these substances have been studied in liver transplant recipients. In order to evaluate the utility of PCR for the detection of CMV DNA in the sera of liver transplant recipients, especially to predict the development of symptomatic CMV infection, enabling preemptive therapy, we prospectively studied 185 serum samples from 20 liver transplant recipients using DNA amplification techniques and correlated the results with blood culture and clinical data.

MATERIALS AND METHODS Samples. Serum samples were collected pretransplantation and 1 to 2 weeks posttransplantation from 20 sequential orthotopic liver transplant recipients at the Mayo Clinic for a minimum of 8 weeks posttransplantation. Serum and plasma samples were additionally obtained from eight solid-organ transplant recipients at the Mayo Clinic within 3 days of a positive blood culture, as determined by the rapid shell vial

* Corresponding author. Mailing address: Division of Infectious Diseases, Mayo Clinic, Rochester, MN 55905.

1431

1432

J. CLIN. MICROBIOL.

PATEL ET AL.

technique, for use in a comparison study of serum and plasma. Serum and plasma samples were stored at -70°C until the samples were tested by PCR. EDTA was used in the collection of plasma. Serology and viral culture. Anti-CMV immunoglobulin G (IgG) was measured by an anticomplement immunofluorescence assay, and IgM antibody to the virus was measured by an indirect immunofluorescence assay (12). Blood cultures were prepared by tube cell and rapid shell vial techniques, and urine cultures were prepared by shell vial techniques at weekly intervals for a minimum of 4 weeks posttransplantation and whenever CMV infection was clinically suspected (7). Clinical definitions. CMV infection was defined as the isolation of CMV from any body fluid or tissue, the detection of CMV in tissue specimens by its characteristic histologic findings, immunohistochemistry and/or DNA hybridization, and/or the detection of IgM against CMV in serum. CMV infection was deemed asymptomatic when clinical symptoms and signs and laboratory abnormalities were absent and was deemed symptomatic when clinical symptoms or signs and/or documented evidence of organ invasion (as evidenced by a tissue biopsy specimen demonstrating cytomegalic inclusion bodies, positive cultures, DNA hybridization, and/or positive immunofluorescence for CMV) were present. Dilution of serum and plasma for comparison study. Thirty microliters of serum or plasma from each patient in the comparison study was added to 170 [I1 of 10 mM Tris-HCl (pH 8.3) and was diluted five times at 1:5 in 10 mM Tris-HCI (pH

8.3). Extraction of nucleic acids. Nucleic acids were extracted from serum as described previously, with minor modifications (1). A 200-pl sample of serum (or a 200-pl sample of a serum or plasma dilution in the case of the comparison study between plasma and serum) was treated for 4 h at room temperature with 300 pl of a lysis solution (10 mM Tris-HCI [pH 8.3], 0.25 mg of proteinase K [Boehringer GmbH, Mannheim, Germany] per ml, 0.5% sodium dodecyl sulfate). tRNA (Calbiotech, San Diego, Calif.) was added as a carrier to a final concentration of 10 pg/ml. The nucleic acid was extracted twice with phenolchloroform and once with chloroform-isoamyl alcohol, precipitated with ethanol, and dissolved in 40 pL. of distilled water. Oligonucleotides. PCR for the detection of CMV was performed by using previously described oligonucleotide primers and a probe from the EcoRI fragment D region of CMV strain AD169 (13). These primers and probe have previously been shown not to amplify other herpesviruses or cellular DNA (13). The 20-nucleotide upstream primer (GATCCGACCCATTGT CTAAG) and the 20-nucleotide downstream primer (GGC AGCTATCGTGACTGGGA) amplify a 152-bp segment of DNA. The 40-nucleotide probe (ATTCGTGGTCGTGGCC AACTGGTGCTGCCGGTCGCGCTTA) corresponding to the region between the two primers was synthesized and end labeled with [y-32P]ATP. PCR. Reaction mixtures consisted of 5 pL. of target, 100 pmol of each of the oligonucleotide primers, 1.25 U of the enzyme Taq polymerase (Perkin-Elmer Cetus, Norwalk, Conn.), 200 pLM (each) deoxynucleotide triphosphate (Boehringer Mannheim, Indianapolis, Ind.), 5 p.l of lOx reaction buffer (500 mM KCl, 100 mM Tris-HCl [pH 8.3]), 15 mM MgCl2, 0.01% gelatin), 10 p.l of a 50% glycerol solution, 25 pg of isopsoralen per ml, and high-pressure liquid chromatography-grade distilled water to a total volume of 50 p.l in a microcentrifuge tube. The tubes were overlaid with two drops of mineral oil and were subjected to 35 cycles of amplification (94°C for 1 min, 55°C for 2 min, and 72°C for 3 min). Amplified PCR products were electrophoresed on an agarose gel, transferred onto a

Serum

Plasma

.i 10F