Methods in Cell Science 17: 1-15, 1995. © 1995 Kluwer Academic Publishers. Printed in the Netherlands.
Detection of telomerase activity in h u m a n cells and tumors by a telomeric repeat amplification protocol (TRAP) Mieczyslaw A. Piatyszek ~, Nam W. Kim 2, Scott L. Weinrich 2, Keiko Hiyama 3, Eiso Hiyama 4, Woodring E. Wright l & Jerry W. Shay I i Department of Cell Biology and Neurosciences, University of Texas Southwestern Medical Center, Dallas, Texas, USA; 2Geron Corporation, Menlo Park, California, USA; 3 Second Department of Internal Medicine, and Department of General Medicine, Hiroshima University School of Medicine, Hiroshima, Japan
Accepted in revised form 9 February 1995
Abstract. The association of human telomerase activity with an indefinite replicative capacity of cells in vitro and advanced tumors in vivo is gaining wide support. The increasing interest in studying various aspects of telomerase expression in cancer required the development of a sensitive and reliable protocol for the extraction and detection of telomerase activity in cell culture material, and from small tissue samples obtained from biopsy, surgical reaction of tumors, and autopsy. Recently a novel procedure for the extraction and detection of telomerase activity was developed (Science 1994; 266: 2011-2015) which
resulted in an estimated 10 4 fold improvement in detectability compared with previous methods. The described procedures not only dramatically increased sensitivity but also allowed fast and efficient detection of telomerase activity in a large number of samples. A number of technical aspects which are of critical importance for reproducibility and reliability of this assay using clinical material are addressed in this report. In addition, new methods to perform telomerase assays without the use of radioisotopes are described.
Key words: Cancer, Cellular immortality, Telomerase, Telomeres Abbreviations: AEBSF = 4-(2-aminoethyl)-benzenesulfonyl fluoride hydrochlorine; BCA = bicinchoninic acid; CCD camera = charged coupled device camera; CHAPS = 3-[(3-cholamidopropyl)-dimethyl-ammonio]1-propanesulfonate; DEPC, diethyl pyrocarbonate; DPBS = Dulbecco's phosphate buffered saline; EGTA = ethylene glycol-bis([3-aminoethyl ether)-N,N,N',N'-tetraacetic acid; HPLC = high pressure liquid chromatography; HPV = human papillomavirus; PDA = piperazine diacrylamide; PCR = polymerase chain reaction; T4g32 protein = T4 gene 32 protein; TRAP = telomeric repeat amplification protocol; TRF = terminal restriction fragment
1. Introduction
The spontaneous immortalization of human cells in vitro (a cell culture term for unlimited proliferative capacity) is an extremely rare event requiring alteration/mutations in several genes which are normally involved in the regulation of cellular senescence or aging [1-5]. Cellular immortalization may be a critical and perhaps rate limiting step in the development of human cancers [6, 7]. There is increasing evidence that the clock controlling the timing of cellular senescence may be the gradual loss of telomeric repeats (TTAGGG) sequences [8-14]. Telomeres are specialized heterochromatic structures at the ends of eukaryotic chromosomes and have been implicated in stabilizing and protecting ('capping') the chromosomes, anchoring chromosomes within the nucleus, and facilitating the replication of linear DNA [15]. However, DNA polymerase cannot repli-
care the very 5' end of a linear DNA molecule (known as the 'end replication problem' [16, 17], and therefore all somatic cells lose 50-200 nucleotides of telomeric sequences per cell division [8, 13]. This progressive shortening may be an important molecular mechanism by which cells count their divisions. When telomeres become sufficiently short they may signal replicative senescence (also called Mortality Stage 1, or M1) [7]. While still uncertain, replicarive senescence may be initiated by a check point arrest mechanism involving p53 [18] or due to heterochromatin effects changing the expression of genes near telomeres [14, 19]. Alterations in the function of the tumor suppressor genes, such as Rb and p53, enable most human cells to escape the mechanisms that control the M1 stage of replicative senescence [1, 4, 5, 20]. In these instances, cells continue to divide and lose telomeric repeats until they have become so short that the cells again
undergo a growth arrest called crisis, or the Mortality Stage 2 [5, 18]. Only a rare cell that escapes the M2 growth arrest can proliferate indefinitely. It has been shown that chromosome terminal restriction fragments (TRFs), a measure of telomere length, can be drastically reduced in some tumors to 2 - 4 kb [12, 21-25] while in germline and fetal cells TRFs are over 20 kb [8, 13, 26]. However, in contrast to normal cells, immortal cells and tumor cell lines that have escaped the M2 stage show no net loss of average telomere length with cell division, suggesting that in most instances telomere length stability may be required for cells to escape from replicative senescence and proliferate indefinitely [9-11, 18]. Telomerase is a ribonucleoprotein [27-29] that synthesizes telomeric DNA in normal germline tissues (such as testes and ovaries) and most immortal/tumor cells [9-11, 30, 31]. In tumor tissues, using the conventional in vitro telomerase assay, ovarian carcinomas were shown to have telomerase activity and stable but short TRFs [11]. Using the same assay, telomerase activity has also been demonstrated in malignant lymphomas [32]. The conventional assay for telomerase activity requires large amounts of cells or tissues, thus limiting the number of primary human tumors that can be easily examined. A major limitation of the conventional, primer extension based assay of telomerase activity [27-29] is weak signal strength, generally necessitating long (7 days and more) autoradiographic exposure times. Methods to enhance the telomerase signal, and thus sensitivity, involve enriching of the telomerase fraction, which is time consuming [33]. Therefore, a highly sensitive, PCR-based assay for measuring telomerase activity was developed which includes an improved detergent lysis method to allow more uniform extraction of telomerase from a small number of cells [31]. This TRAP (telomeric repeat amplification protocol) assay uses a single tube reaction in which telomerase first synthesizes extension products which then serve as templates for PCR amplification. In experiments using the TRAP assay we have demonstrated that 98/101 immortal/tumor cell lines are positive for telomerase while a variety of cultured normal somatic cells all tested negative. In a survey of primary tumors from 12 tissue types including those of the breast, colon, prostate, lung, uterus adrenal, head and neck, we demonstrated that 90/101 were positive for telomerase activity while normal somatic tissues from autopsied patients and mitotically active benign growths such as uterine leiomyomas were negative [31]. More recently we found telomerase activity in 94/100 neuroblastomas [30], 109/136 non-small-cell lung carcinomas, 15/15 small-cell lung carcinomas [34], 41/55 renal cell carcinomas [35] and 21/25 prostate carcinomas [36]. These results indicate that activation of telomerase may be a critical and perhaps rate limiting step in the
progression of most cancers. In the present report a number of technical aspects of critical importance for the reproducibility and reliability of the TRAP assay using clinical material are addressed. In addition, modifications to perform telomerase activity assays without the use of radioisotopes are described. 2. Materals
A. Reagents 1. AEBSF (4-(2-aminoethyl)-benzenesulfonyl fluoride hydrochlorine), No. 1935031 2. Aerosol resistant tips, Nos. 1010-8810, 1010-1810, 1012-2810, 1022-08102 3. Alkaline phosphatase activity assay kit, No. 104-LL 3 4. Ampliwax TM, No. N808-01004 5 BCA (bicinchoninic acid) protein assay kit, No. 232255 6. CHAPS (3-[(3-cholamidopropyl)-dimethylammonio]-l-propanesulfonate), No. 283005 7. DEPC (diethyl pyrocarbonate), No. D-57583 8. Dowex l-X8 resin, No. 745-14216 9. DPBS without calcium chloride, No. D57733 10. EGTA (ethylene glycol-bis([3-aminoethyl ether)-N,N,N',N'-tetraacetic acid), No. E43783 11. PCR nucleotide mix, No. 15812957 or No. 27-2035-018 12. PDA (piperazine diacrylamide), No. 16102026 13. Primers (TS and CX), custom made and anion-exchange HPLC purified 9 14. Redivue TM [Ct-32p]dCTP and [cc-32p]TTP (3000 Ci/mmol); Nos. AA0005 and AA00071° or Nos. NEG-013H and NEG005H" 15. RNase Plus TM, No. 5305-101154 ~2or RNase, No. 1119 9157 16. SYBR TM Green I, No. S-756713 17. Taq DNA Polymerase, No. 18038-042 TM or No. 1146 1657 18. T4g32 protein (T4 gene 32 protein), No. 70029 ~5 or No. 972 9837 19. Tween 20, No. 13324657 20. All other chemicals were reagent grade and came from Sigma Chemical Company 3 and United States Biochemical 15 B. Equipment 1. Eppendorf refrigerated microcentrifuge 5402, No. 5402-000.13016 2. FluorImager FSI, No. FSI12017 3. HotStart 50 TM PCR tubes, No. 10331-01514 4. Kontes homogenization tubes with matching pestles, No. 749520-000017 5. Phosphorlmager 425E, No. 425E TM 6. Rechargable drill Black & Decker CD1000, No. 904519
7. Thermocycling block with heated lid, No. PTC-100-60 and HB-602° 8. UV chamber for PCR, No. 16082521
3. Procedures
General precautions. Since the telomerase activity assay described here incorporates both the in vitro activity of a ribonucleoprotein (telomerase) and PCR amplification, there is a need for extreme caution to prevent RNase and PCR product contaminations. The following basic rules must be followed in all steps of the assay protocols including preparation of telomerase extracts. 1. Always wear gloves. During extractions and setting up the assay reactions, a surgical mask is highly recommended. 2. Use DEPC treated water for all solutions, and aliquot the solutions in small amounts before use. 3. Keep the assay solutions (CHAPS lysis buffer, TRAP reaction buffer, dNTPs, Taq DNA Polymerase, etc.) separate from other reagents in the laboratory. 4. Always use a separate set of pipets specifically assigned for each of the steps: (a) preparation of extracts, (b) setting up the telomerase assay reactions, and (c) for analysis of amplification products. Use only aerosol resistant pipet tips. 5. To minimize the carry-over contaminations, perform the three essential steps [extractions, setup of the telomerase reactions, and the analysis of amplification products (manipulations related to gel electrophoresis)] in different, physically separated areas, preferentially different rooms. However, if this is not feasible due to space limitations, at least clear divisions should be implemented between the areas of preparation of extracts, TRAP setup station, and the PCR amplification/analysis. We strongly recommend specifically designed and commercially available PCR stations (see: Materials, UV chamber for PCR). Preparation of telomerase extracts from cells grown in culture. Harvested cells are counted and an aliquot containing 100,000 cells is pelleted (3,000 x g in a 1.5 ml Eppendorf tube for 6 rain) in culture medium. The supernatant is carefully removed, and the pellet stored at -80 °C. Washing the pellet with DPBS is optional. For preparation of telomerase extracts, the cells are removed from the -80 °C freezer, then resuspended in 200 gl of ice cold lysis buffer [0.5% CHAPS, 10 mM Tris-HC1 (pH 7.5) 1 mM MgC12, 1 mM EGTA, 5 mM [3-mercaptoethanol, 0.1 mM AEBSF, 10% glycerol] by retropipeting at least three times (using 200 gl pipetman), and kept on ice for 30 min. The lysate is centrifuged at 16,000 x g for 20 rain at 4 °C, and 160 gl of the supernatant is
collected, making sure not to withdraw traces of cell debris from the pellet. The resulting extract is flash frozen in liquid nitrogen and stored at -80 °C. Up to 12 samples can be processed simultaneously without running into risk that pelleted material will start to diffuse before the supernatant fraction is withdrawn. Extracts can be stored at -80 °C for at least 1 year without loss of telomerase activity.
Collection of clinical material and preparation of extracts. Before performing telomerase assays, it is very important to be careful in the acquisition and storage of clinical materials. It is necessary to work closely with the surgical pathologist or surgeon providing clinical materials since cross contamination with tumor tissue cells (containing telomerase activity) can result in 'normal' or adjacent tissues having some activity (e.g. 'false positive'). If possible, different surgical dissecting tools should be used for removing the tumor from the adjacent tissue. We generally try to obtain 'normal' material first and then the tumor sample. The samples should be immediately distributed into small tubes and placed in a -80 °C freezer as soon as possible. In some instances we have detected strong telomerase activity from clinical material maintained a t - 8 0 °C for 10 years while storage at -20 °C for less than 2 months can result in complete loss of activity. If there is concern that the tissue was not obtained according to the precautions described earlier or it contains a large fraction of blood, the sample of 50 to 100 mg of frozen (-80 °C) tissue should first be briefly (15-20 sec) washed in ice-cold lysis buffer (with detergent to make sure that the outer layer of cells is lysed) which is removed by aspiration and the tissue frozen again in liquid nitrogen. This treatment can help to remove possible contaminants and blood from the surface of the sample. Next, each tissue sample, when partially thawed, is sliced on sterile disposable petri dishes with surgical disposable knife blades to obtain thin flakes of tissue which are immediately transferred to Kontes homogenization tubes containing 200 gl of aliquoted ice-cold lysis buffer. Using matching disposable pestles rotated at 450 rpm by a drill the samples are homogenized until the tissue is dispersed and placed on ice for 25 rain. The lysate is then centrifuged at 16,000 × g for 20 rain at 4 °C in an Eppendorf refrigerated microcentrifuge. The supernatant aliquots are collected as previously described, flash-frozen in liquid nitrogen, and stored a t - 8 0 °C. The protein concentration of extracts is measured with the BCA protein assay kit, and aliquots are diluted to 3 gg protein/gl. Telomerase assays. The one tube PCR-based telomerase assay [31] is schematically shown in Figure 1. The assay is performed in two steps: (1) telomerasemediated extension of an oligonucleotide trimer (TS) which serves as a substrate for telomerase, and (2)
4
Telomerase Substrate __ ,~.y..}.~.:.:. (TS = forward primer) .::~,.-.-." 5 " ]~.TCCGTCGAGCAGAGTT
3"
".".","
CX = reverse primer - 3" A A T C C C A T T C C C A T T C C C A T T C C C
Cell/tissue
extract Wax barrier (mp 70°C)
5"
Reagents: a) Cell or tissue extract prepared by CHAPS detergent extraction using RNase-free precautions b) Telomerase substrate TS (TS is also the forward primer for PCR amplification step) c) Oligonucleotide reverse primer CX in assay tube, sealed below barrier of wax with melting point 70°C STEP 1:
Telomerase activity in cell/tissue extract elongates TS substrate during 30 minute incubation at 20°C 5" I A A T C C G T C G A G C A G A G T T 13"
5"[AATCCGTCGAGCAGAGTTIAGG G T T A G G G T T A G
(GGTTAG)n 3"
STEP 2:
Incubation for 90 seconds at 90°C - to inactivate telomerase - to melt wax barrier and release CX oligonucleotide - to initiate "hot start" PCR amplification ii) PCR amplification of telomerase-elongated TS substrate, using TS and CX oligonucleotide primers and repeated cycles of 50°C for 30 sec / 72°C for 45 sec / 94°C for 30 sec 5" ~kATCCGTCGAGCAGAGT~-~-kGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAG --~ 3" [~TccCATTCCCATTCCCATTCCcl5"
3"
Fig,re 1. Flow chart of the PCR-based telomerase assay. Telomerase synthesizes telomeric repeats [(TTAGGG)n] onto the telomerase substrate oligonucleotide (TS) (Step 1). Such telomerase activity products are specifically amplified by PCR using the downstream primer CX and the upstream primer TS (Step 2). The use of an oligonucleotide that works well as a telomerase substrate but which lacks TTAGGG repeats minimizes primer-dimer artifacts. The mismatches in the CX oligonucleotide resulted in a further decrease in primer-dimer artifacts without blocking amplification of authentic elongation products. As it is illustrated in this figure, a single-tube assay is accomplished by initially separating the CX primer beneath a wax barrier from the rest of the reaction mix. hot start PCR amplification of the resultant product (an incremental 6-nucleotide single stranded DNA ladder) with the oligonucleotide primer pair TS (forward) and CX (reverse). These oligonucleotides were designed to minimize primer-dimer artifacts. The TS sequence lacks T T A G G G repeats but nonetheless serves as a good telomerase substrate [37]. The reverse primer (CX) will thus anneal only
to the T T A G G G repeats added by telomerase. The mismatches in the CX oligonucleotide (CCCTTA rather than CCCTAA) were found to decrease occasional primer-dimer artifacts without interfering with the amplification of authentic telomerase products. Details of the procedure are as folllows: the oligonucleotides TS ( 5 ' - A A T C C G T C G A G C A G A G T T ) and CX [5'-(CCCTTA)3CCCTAA] are purified by
phate, 2 U of Taq DNA Polymerase, and 2 gCi each of 10 gCi/gl, [c~-32p]dCTP and [ot-3Zp]TTP 3000 Ci/mmol. After 30 min incubation at room temperature for the telomerase mediated extension of the TS primer, the reaction mixture is heated at 90 °C for 90 sec to inactivate telomerase and to liberate the CX primer sequestered under the wax. The sample is then subjected to 31 cycles of 94 °C for 30 sec, 50 °C for 30 sec, and 72 °C for 45 sec (Figure 1). Since telomerase contains an internal RNA template, sensitivity to RNase offers a convenient control of specificity. As a control, 5 gl of extract corresponding to 2500 cells equivalent or 15 ~tg of protein (if extract from tissue is used) is incubated with 1 gg in 1 gl of RNase Plus TM for 20 rain at 37 °C, and then a 2 gl aliquot of RNase treated extract is used for the telomerase assay. Incubation of a positive extract at 37 °C for 20 min without RNase does not result in loss of the telomerase processive ladder.
HPLC and dissolved at 50 ng/gl in 10 mM Tris-HC (pH 8.3). To minimize chances of contaminations, the TRAP assay tubes are prepared in advance by pipetting 2 gl aliquots of CX oligonucleotide (100 ng) to the bottom of the HotStart 50 TM 0.5 ml tubes containing wax gems attached to the side walls. The tubes are placed in a PCR block with a heated lid and incubated for 4 rain at 75 °C, 1 min at 80 °C to melt the wax and next slowly (5 s/1 °C) cooled to 20 °C to seal the CX primer under the wax barrier. The assay tubes prepared this way are stored at 4 °C and can be used for at least four weeks without any effect on assay performance. An appropriate amount of extract (max. volume should not exceed 4 gl) is assayed in these tubes in 50 gl reaction mixtures containing reaction buffer [20 mM Tris-HC1 (pH 8.3), 68 mM KC1, 1.5 mM MgC12, 1 mM EGTA, 0.05% Tween 20], 0.1 /.tg of TS primer, 0.5 gM T4 gene 32 protein, 50 gM of each deoxynucleoside triphos-
A
(GTTAGG)3 (TTAGGG)3 RNase
I--1 i -,.-
+
TS I I ~ ..-
-I'1
2
3
4
5 6
TS TS CX U2 pB + + + CX CX CX
18 mer--4~
1
2
3
4
7
8
TS TS U2 U+2 + + pB pB
9 10 11 12 13 14 15 16
dA dG dT
dO
dA dG dT
dA dT
rA TS TS TS TS rG + + + + rT CX CTR4CX CTR4
rCI
50oC
IL J 60oC
5
Figure 2. Detergent extraction and the validation of TRAP assay for telomerase activity. (A) Conventional telomerase assays [9] of CHAPS extracts from immortal 293 human kidney cell line using oligonucleotide substrates (GTTAGG)3 (lane 1), (TTAGGG)3 (lanes 2 and 3), and TS (5'-AATCCGTCGAGCAGAGTT) (lanes 4 and 5). The extracts used in lanes 3 and 5 were pretreated with RNase which degrades the RNA component of telomerase and abolishes activity. Telomerase pauses after adding the first G of the GGG triplet, so the number of nucleotides added before the first pause (and thus the phasing of the ladder) is five for (GTTAGG)3 (lane 1), four for (TTAGGG)3 (lane 2), and two for the TS oligonucleotide (lane 4, see Figure 1 for a diagram of the TS extension products). (B) Validations of detection of telomerase activity by the TRAP assay. All reactions shown are performed with 293 kidney immortal cell CHAPS extracts. Primers used for the TRAP reactions are shown at the bottom. Reactions in the lanes 9-12 were performed with indicated dNTPs (lanes 9-11) and rNTPs (lanes 12) in the initial telomerase reaction steps, and then amplified with TS and CX primers with supplemented dNTPs. Lanes 13-16 show TRAP assay performed at 50 °C annealing temperature (lanes 13-14) and 60 °C (lanes 15, 16).
6
Polyacrylamide gel electrophoresis of TRAP products. PCR mixtures aliquots (40 gl) are analyzed on 10% non-denaturing, 1.5 mm thick acrylamide gels (17 x 13.5 cm) and run in 50 mM Tris-borate (pH 8.3), 1 mM EDTA at 175 V for 45 rain, followed by 280 V until xylene cyanol is 5 cm from the bottom of the gel (approximately 105 min). The radioactive buffer from the anode tank of the gel apparatus is processed on Dowex X-8 anion exchange column and disposed as described [38]. The gels are fixed in 0.5 M NaC1, 50% ethanol, 40 mM sodium acetate (pH 4.2) for 25 rain and next exposed directly without drying to storage phosphor screens without drying. This fixation prevents DNA diffusion, shrinks the gels and results in slightly sharper bands. Alternatively, the gel may be dried without fixation. The PCR products are visualized on a Phosphorlmager using the ImageQuant software provided by the supplier. Non radioactive variations of this procedure (see Results) utilize direct staining of the PCR products with silver or SYBR T M Green I. Silverstaining is done exactly as previously described [39]. For 1.5 mm thick polyacrylamide gels (which are prepared with PDA instead of bis-acrylamide) the following incubation times are used: 30 rain fixation
in 10% acetic acid; three 2 min rinses with water; 45 min impregnation with AgNO 3 solution, followed by a brief 20 sec rinse with water before developing for 10-15 min. Staining of DNA by SYBR T M Green I is done for 45 min in 50 mM Tris-HC1 (pH 8.0) with 10,000x diluted stock provided by supplier. The gels are photographed with a Polaroid or a CCD camera on a UV midrange (300 nm) transilluminator.
Alkaline phosphatase assays for internal control. Assays of alkaline phosphatase activity (an internal control for the quality of the extract) on a p-nitrophenyl phosphate substrate are performed using a commercially available kit (Sigma). Briefly, 10 gl aliquots of CHAPS cellular extracts containing 30 gg of protein (or 10 gl of CHAPS lysis buffer, e.g., reference sample) are added to 200 gl of 1:1 (v/v) mixtures of reaction buffer and substrate solution and incubated for 15 min at 37 °C. Reactions are stopped by adding 2 ml 0.05N NaOH and the absorbance measured at 405 rim. The samples are treated with 40 gl of concentrated HC1 to remove color due to p-nitrophenol and the residual absorbance (from endogenous chromogenes) at 405 nm is subtracted to obtain the corrected alkaline phosphatase activity. B
/
A
.=~ ,~'. ~ No RNase
//
~,,~
~" .0- .~'~.o'.~~ ,,~'~.~ ^÷" ~>~-^~
RNase
Time at RT (hrs) '0 0 4 4 2 4 2 4 4 0 4 0 " 4 4 4 0 4 0 ~ Source of extract - + " +++--I-+ (TRAP -/+)
1
2
3
4
5
6
7
8
9 10 11 12 13 14 15 16
1
2
3
4
5
6
7
8
9
10 11 12 13 14 15
Figure 3. Expression and stability of telomerase in human cells and tissues. (A) Stability of telomerase at room temperature in human mammary epithelial cells. Pellets from 105 cells grown in culture were incubated for indicated amount of time at room temperature prior to telomerase extraction. Assays were performed with extracts corresponding to 10 3 cells. Lanes with odd numbers (1-11), HME31 cells not expressing telomerase; lanes with even numbers (2-12), HME31 (E6/E7)-I 2 immortalized cells expressing telomerase. (B) Telomerase activity in normal and primary tumor tissues (lanes 1-11) and activity of telomerase in extract from a breast tumor after multiple freeze/thaw cycles (lanes 12-15). Telomerase is expressed in germline tissues, as well as primary tumors and cells lines but is not expressed in normal tissues. This figure indicates that telomerase activity is generally stable.
7
PCR amplification of p53 sequences. To check for the presence of genomic DNA in the cellular and tissue CHAPS extracts, 2 gl aliquots of extracts are subjected to PCR with primers 5'CTTGCCACAGGTCTCCCCAA (forward), and 5'AGGGGTCAGCGGCAAGCAGA (reverse) [40] allowing amplification of a 237 bp fragment of exon 7 of the p53 gene. The reaction mixtures of 50 gl contain 10 mM Tris-HC1 (pH 8.3), 50 mM KC1, 2.5 mM MgC12, 1 gM primers, 0.2 mM dNTPs (each) and 1.25 U Tag DNA Polymerase. The reaction mixtures are placed in a PCR block set at 94 °C for 4 min, followed by 40 cycles of 94 °C for 45 sec, 60 *C for 45 sec and 72 °C for 75 sec. The PCR products are analyzed by electrophoresis of 10 gl aliquots of reaction mixtures on 2% agarose gel and staining with ethidium bromide or SYBR TM Green I. Under the described PCR conditions it is possible to detect PCR products from 50 ng of genomic DNA.
physical disruption of cells required at least 107-108 cells, and the extraction efficiency varied between cell types [9, 29]. A gentle, detergent based lysis method was developed to give more uniform extraction of telomerase activity even at low celt numbers, with a practical lower limit of 104 cells per extraction [31]. The conventional assay was used to demonstrate authentic telomerase activity in detergent extracts (Figure 2A) as evidenced by (1) a six nucleotide ladder of extension products (lanes 1, 2, and 4); (2) a shift in product phase dependent upon the 3' sequence of the oligonucleotide substrate (compare lanes 1, 2 and 4); (3) the ability to extend a non-telomeric oligonucleotide previously shown to be a telomerase substrate (lanes 4 and 5) with TTAGGG repeats [37]; and (4) by the RNase sensitivity of the activity (lanes 3 and 5). In addition to the confirmatory data presented by us earlier [31] several other data confirm that a positive TRAP assay is due to authentic telomerase activity. First, oligonucleotides that are not efficient substrates for telomerase (as determined by the conventional assay) show a correspondingly reduced signal in the TRAP assay. Two such primers with similar G+C content and melting point temperatures
4. Results and discussion
Using previously described methods, reliable extraction of telomerase activity by hypotonic swelling and
Template length
52 bp
94 bp
82 bp
112 bp
$,
or _o _o--
cycle#115 20 25 301115 20 25 30 Ij
1
2
3
4
5
6
7
8
9 10 11 12 13 14 15 16 17 18
Figure 4. Reamplification of TRAP products of discrete size by a PCR step of the TRAP assay. Single bands of the TRAP ladder were recovered from a gel and amplified by PCR in a subsequent TRAP assay. Aliquots of PCR reaction mixtures analyzed on gel were respectively: 20 gl after 15 cycles, 10 ~1 after 20 cycles, and 5 M1after 25 and 30 cycles. Arrows indicate size of DNA fragments used for reamplification. This indicates that the size distribution of the PCR products closely reflects the actual original size distribution of telomerase activity products generated in Step 1 of the TRAP assay.
as the TS primer, U2 (5'-ATCGCTTCTCGGCCTTTT) and pB ( 5 ' - T A T C G A C T A C G C G A T C A T ) , were compared to TS in TRAP assays using the CX primer and extracts from an immortal cell line (human 293 kidney cells) (Figure 2B, lanes 1, 4, 5). The significant reduction in the efficiency of U2 and pB primer is in complete agreement between the assays. Three variants of the TS sequence that have been tested have primer efficiencies similar to TS in both assays (data not shown). Due to the sensitivity of TRAP assay and the in vitro ability of telomerase to recognize a wide range of sequences as substrates, it is difficult to identify primers (with similar G+C contents as TTAGGG repeats) which give no TRAP products. However, the CX oligonucleotide does not serve as a substrate in either assay (Figure 2B, lane 3). Several additional points also validate that the TRAP assay is specific for TS oligonucleotide substrates extended with TTAGGG repeats. The TS primer must be extended by at least three TTAGGG repeats before it can be amplified by the CX primer [31]. This was established experimentally using synthetic oligonucleotides as PCR templates. TS plus two TTAGGG repeats was not sufficient for amplification under these conditions (unpublished observations), illustrating the need for an extended complementary sequence before the CX primer efficiently anneals. Positive extracts in the TRAP assay always yield a six nucleotide ladder of products. If the CX oligonucleotide was priming TS plus random sequences, the expected result would be a smear of PCR products or discrete number of random bands, not a regular pattern of 6 nt periodicity. Increasing the annealing temperature to 60 °C prevents efficient priming of CX (which has one mismatch in 3 of 4 CCCTAA repeats, see Figure 1), but still allows priming by CTR4 [perfect teromeric complement 5'-(CCCTAA)4, Figure 2B, lanes 13-16]. The generation of a positive TRAP assay requires deoxynucleotide precursors as expected for telomerase. The 293 kidney cell extracts were incubated during the telomerase extension step (10 rain at 25 °C) in the presence of 4, 3, or 2 dNTPs (Figure 2B, lanes 9, 10, 11), or 4 rNTPs (lane 12). The samples were then heat-treated at 94 °C for 5 rain to inactivate telomerase, and PCR amplified after supplementing with the 4 dNTPs and Taq polymerase. The absence of products in the reaction mixtures with dATP+dTTP or with 4 rNTPs and the product formation in the presence of 3 dNTPs (dATP, dTTP, and dGTP) shows that the factor responsible for a positive TRAP assay is a DNA polymerase that requires only 3 dNTPs with a specific need for dGTP but not dCTP. Even though clinical samples should be frozen immediately, telomerase appears to be a reasonably stable enzyme, allowing detection of activity in most cells and tissues stored up to 24 hours at room
temperature (Figures 3A, B, lanes 1-3). This indicates that clinically obtained samples and samples from autopsy are generally acceptable for telomerase assays if obtained and preserved within 24 hours. For autopsied material, it is recommended to obtain germline tissues (e.g. testis, ovary) as a positive source of telomerase activity to help validate the reliability of negative results of other tissues. The quality of extracts yielding negative results for telomerase activity should be verified by an assay of another enzymatic activity serving as an internal control. Alkaline phosphatase, an enzyme abundant in tissues involved in the transport of nutrients, is present in secretory organs, developing tissues and blood serum but is much less abundant in muscle,
1
2
3
4
5
6
7
Figure 5. Potential TRAP assay inhibitors and contaminants. Telomerase activity in a serially diluted extract obtained from a small-cell lung carcinoma tumor (lanes 1-3). Effect of exogenously added genomic DNA (from HeLa cells) on telomerase activity in an extract from a telomerase positive human mammary epithelial cell line (lanes 4-7). To 2 txl aliquots of extract from 1000 cells, 2 ~tl aliquots of DNA in lysis buffer or lysis buffer only (lane 7) were added and assayed for telomerase activity. This indicates tissue inhibitors are affecting the performance of the TRAP assay but genomic DNA is not the source of the inhibitor.
mature connective tissue, nonossifying cartilage, and red blood cells [41]. The order of activities for alkaline phosphatase in different tissues is well established with intestinal mucosa = placenta > kidney = bone > liver = lung = spleen. The stability of alkaline phosphatase activity in clinical material appears to be similar to the stability of telomerase [42]. Alkaline phosphatase is thus a useful independent marker to determine the quality of telomerase extracts. It is important to preserve tumor samples at a minimum - 8 0 °C. One neuroblastoma tumor sample stored up to 10 years at - 8 0 *C retained telomerase activity while most lung tumors stored for only 2 months at - 2 0 °C lost the enzyme activity. In one study 71/98 (78%) of non-small-cell lung carcinomas stored a t - 8 0 °C had telomerase activity while only
one of 10 (10%) non-small-cell carcinomas stored at - 2 0 °C for 2-3 months showed telomerase activity. Not only is telomerase activity stable if tissue samples are stored properly for long periods of time, but the activity in extracts from primary tumors is resistant to multiple freeze-thaw cycles (Figure 3B, lanes 12-15). The size of the amplification products (e.g. number of 6 base pair repeats) observed after the TRAP assay might either reflect the original, telomerase mediated extensions of the TS oligonucleotide substrate, or might be produced by staggered annealing of the CX primer during the PCR amplification step. To address this question we have recovered DNA fragments of different sizes from a gel after a TRAP assay of a telomerase positive
B
A
1 2 3 4 5 6 7 8 9
Tissue extracts added: before TRAP step 1 after TRAP step 1
1 ÷
2 +
3 +
4 +
5 +
6 ÷
7 ÷
8 ÷
910 + +
Figure 6. Effect of CHAPS extracts from normal human tissues mixed with TRAP positive extracts. (A) Equal atiquots of the lysis buffer (lane 1) or tissue extracts containing 6 ~tg of protein were added to extracts from 100 HME31 (E6/E7)12 cells prior to the TRAP assay (lanes 2-9). (B) Tissues extracts were added to the TRAP reaction mixtures containing extracts from 100 HME31 (E6/E7)-12 cell equivalents and were preincubated for 30 rain at room temperature (see Step 1 in Figure 1) prior to the PCR amplification step (lanes with odd numbers) or the tissue extracts were added to the TRAP reaction mixtures containing extract from 100 HME31 (E6/E7)-12 cells after Step 1 (after inactivation of telomerase at 90 °C), and then subjected to PCR amplification (Step 2) (lanes with even numbers). The results indicate that the inhibition occurs during Step 2 of the TRAP assay; Taq polymerase is the likely target of the inhibitory factor.
10 extract. These DNA fragments were then reamplified by PCR with primers TS and CX. The full length copies of the input templates represented the major product in all cases (Figure 4). Some shorter products probably resulted from staggered annealing of the CX primer downstream of the 3' end of the template. The products longer than the template were present only in 1-3 discrete bands. Thus, the size distribution of the six nucleotide proeessive ladder obtained in the TRAP assay roughly reflects the size distribution of the actual telomerase activity products and can provide some information about the processivity of telomerase in the extracts. Since in many cases tumor material may contain a large amount of non-cancerous stromal cellular components that do not express telomerase activity, quantitation of the TRAP assay using tumor tissue extract should be approached with caution. Since the diagnosis of clinical cancer is confirmed by pathological examination, not by replicative capacity, human cancer cells could proliferate and even undergo metastasis [30, 34] and still not be immortal. Thus, in some instances tumors may be mixtures of immortal (telomerase positive cells) with 'transformed' but not yet immortal cells. Nonetheless, a ng CX n5 RNase
-
dilution series of a known cell line with telomerase activity can be useful for obtaining a semiquantitative indication of relative telomerase activity. Examination of the TRAP signal of various cell equivalents of a telomerase positive breast tumor cell line indicates that the signal is dose dependent (Figure 3A, lanes 14-16; see also Figure 8), and can thus provide some semiquantitative assessments of telomerase activity levels). In a small number of tumor samples telomerase extracts were negative under the standard assay conditions (6 ~tg of protein per assay). A negative TRAP assay could be due to poor preservation or extraction of the sample, RNase contamination, the presence of an inhibitor affecting the telomerase extension reaction of PCR amplification steps, or the sample may actually be a telomerase negative tumor. The reasons for negative results are always difficult to explain but we have established a particular set of experiments to help resolve some of the common reasons for false negative results. Some initially negative extracts, diluted 10 to 100 fold (Figure 5, lanes 1-3) occasionally result in a positive telomerase signal. This suggested that some extracts might contain inhibitor of either telomerase ng DNA
A'%" ._
5 50 50 50 50"0.1 0.1 1
1 10 10 10 1 0 . w ~ w
-I- "
+.
1 2
3
-I- -
-I- -
4
6
5
7
-I- -
8
+.
+.
o_
,,.%,wj
.~ o_~_v.~
+
9 10 11 12 13 14 15 16 17 18 19 20
Figure 7. Effects of exogenously added oligonucleotide CX and genomic DNA on TRAP assay results. Increasing amounts of CX oligonucleotide (lanes 1-6) or human genomic DNA from HeLa cells (lanes 7-16) were added to a telomerase negative extract from normal breast epithelial cell strain (HME31). This indicates that primer-dimer formation rarely occurs during the TRAP assay and that products resulting from contaminating human genomic DNA can be distinguished from authentic telomeric activity by lack of sensitivity to RNase.
11 or Taq polymerase. DNA contaminants in the extracts might compete for telomerase, primers or Taq polymerase. The presence of contaminating genomic DNA was addressed by performing PCR amplification with a set of primers specific for exon 7 of p53 gene. We observed that the extracts obtained from cells grown in culture had undetectable amounts of DNA while the extracts from tissues occasionally had detectable levels under PCR conditions which produced signals from 10 ng of DNA/gl of extract. This level of contamination was not sufficient to inhibit the TRAP assay. Quenching of the TRAP signal was not observed when telomerase positive extracts from HPV16 E6/E7 immortalized human mammary epithelial cells [HME31 (E6/E7)] were mixed with increasing amounts of genomic DNA (Figure 5, lanes 4-7). Inhibitory effects were seen when extracts from telomerase negative, normal human tissues were mixed with telomerase positive extracts from the HME31 (E6/E7) cell lineprior to the TRAP assay (Figure 6A). These results were caused by an inhibition of the PCR-amplification step of the TRAP assay. This was established by adding telomerase negative extracts from tissues prior to the TRAP assay (prior to Step 1; Figure 6B, odd
numbered lanes) or after telomerase mediated extension of the TS primer was completed (after Step 1 but prior to PCR in Step 2; Figure 6B, even numbered lanes). Comparison of the ladders from such pairs of samples showed that the inhibitory effect was not alleviated by adding the extract after telomerase had extended the template. This suggested that the inhibitory effect is manifested mostly during the amplification step, probably by affecting performance of Taq polymerase or/and making one or both primers less available for initiation of individual rounds of amplification. One of the likely sources of inhibitory factors can be traces of blood found in some tissue samples. It has been recently demonstrated that a heme compound is a major inhibitor of PCR [43]. An important factor affecting the reliability of any PCR based assay are potential contaminants which can interact with the set of primers and serve as artifactual amplicons [44]. We have examined if two possible sources of contamination in the reaction mixtures could give rise to false positive TRAP signals: sheared genomic DNA which could be present in telomerase extracts, and the CX primer which could leak into the reaction buffer from a
26yd 27y0' 34yQ 36yQ 34yQ cell # x10-3
1 ~ ~ 1 3
1
3
5
10 30113 10 3 0 1 ~
7
9
11
13
~4~ "~ ~9"~"
15
17
19
Figure 8. Telomerase activity tn peripheral blood mononuclear cells, Purified mononuclear cells obtained from peripheral blood of healthy adult donors analyzed at the standard conditions of the TRAP assay (1000 cell equivalents, data not shown) or 3x the standard conditions (3000 cell equivalents) do not display telomerase activity. However, a weak TRAP signal can be detected when 10x the standard assay amount (10,000 cell equivalents) are assayed. This indicates that a rare peripheral blood mononuclear cell type(s) express telomerase activity that is unlikely to be detected in tissue samples under normal assay conditions.
12 poorly sealed wax barrier in the TRAP assay tubes. Extracts from either telomerase negative cell strains or normal tissues were intentionally 'spiked' with various amounts of the CX primer and subjected to the TRAP assay. We observed spurious bands that were faint (Figure 7, lanes 1-6) and which were easily distinguishable from TRAP signals of telomerase positive samples. Contamination of extracts with total genomic DNA (1-200 ng/2 gl of assayed extract) led to more frequent artifactual bands than seen during contaminations with CX primer. These bands were distributed in a fashion resembling a poorly defined TRAP signal, their frequency of appearance and intensity was dose dependent, and in extreme cases (200 ng of added DNA) resembled in intensity a signal from 10 cell equivalents (Figure 7, lanes 7-16). However this type of signal can be easily distinguished from bona fide telomerase TRAP signals because pretreatment of the extracts with RNase prior to the assay does not abolish the formation of the PCR products produced by DNA contamination (Figure 7, lanes 10, 16), while it does abolish ladders produced by the ribonucleoprotein telomerase. Telomerase activity has only been found in cells
with unlimited replicative potential such as testicular and ovarian cells, immortal lines and cancer tissue, but not in normal somatic cells at any stage of the cell cycle. Using the TRAP assay it has recently been observed that a rare hematopoietic potentially selfrenewing stem cell from adult bone marrow had a low but detectable telomerase activity [45]. Since peripheral blood cells are a contaminant of tissues obtained at surgical biopsy, we examined if a rare telomerase positive peripheral blood cell could potentially be detected. We obtained peripheral blood from 5 healthy adult donors ages 26-36 and isolated mononuclear cell fraction (containing lymphocytes and monocytes). When examined under the normal assay conditions (1000 cell equivalents) we did not observe any telomerase activity. However, if we analyzed more cell equivalents per assay, we occasionally detected a weak TRAP signal in 10,000 and in 30,000 cells equivalents (Figure 8). This indicates that rare telomerase positive cells exist in peripheral blood mononuclear cells but are of such low abundance that they are unlikely to be detected as contaminants in a tumor tissue sample assayed under our standard conditions. While the exact nature of the peripheral blood mononuclear cell subpopulation that
B
#
100 bases
40 bases
I 1 I
8 9 10 2 3 4 5 6 7 II I II 31 cycles 34 cycles 37 cycles
2
3 4 5 6 7 8 910111213 II II I 25 cycles 28 cycles 31 cycles
Figure 9. Nonradioactive detection of telomerase activity after the TRAP assay. Serial dilutions of a telomerase positive extract from an immortal human breast epithelial cell line [HME31 (E6/E7)-12] were analyzed by the TRAP assay with different number of PCR cycles (Step 2) and after gel electrophoresis the products were (A) silver-stained or (B) stained with SYBRTM Green I.
13 is TRAP positive is still unknown, one possibility is that these are long-lived mononuclear cells that transiently reexpress telomerase when stimulated to divide. Since almost all non-cancerous tissues were telomerase negative by the TRAP assay (which would also be expected to have similar blood cells present), the telomerase signal in tumor samples can most likely be considered to reflect the telomerase activity of the tumor cells. However, since expression of telomerase activity could be detected in apparently normal peripheral blood cells, one can only speculate that perhaps in other non cancerous situations (such as viral infections and chronic inflammatory diseases) telomerase activity may also be found. To minimize potential health hazards and to decrease the amount of radioactive waste materials, we have employed two alternative methods for the detection of TRAP products; one which involves staining DNA with silver nitrate (Figure 9A) and the other SYBR TM Green I (Figure 9B). With the silver staining procedure, Taq polymerase and T4g32 proteins present in the TRAP assay mixture migrate into the gel and are visualized along with the TRAP latter when stained (Figure 9A). This can potentially affect the ability to disclose the TRAP signal from
.,.
A
2 3
4
5
6
7
Tissue samples
5. Conclusions Cancer is generally an age-related, multistep process involving numerous genes. Cellular immortalization
ooO,
F
1
low telomerase activity samples. Thus, we favor the SYBR TM Green I method since it is more sensitive, faster and simpler than silver staining. However, both procedures are presented. Telomerase activity in 10 cell equivalents can be detected after 37 PCR cycles using silver staining (Figure 9A), while staining of the gel with SYBR TM Green I allows detection of the TRAP signal in extract from 10 cell equivalents after 31 cycles (Figure 9B). To better assess the sensitivity of detection of telomerase activity by non-radioactive means, we compared side by side the intensity of TRAP signals disclosed after phosphorimage analysis of a radioactive gel (Figure 10A) with those obtained after fluoroimage analysis of a stained gel (Figure 10B). The result indicates that SYBR ®Green I staining and subsequent detection using a commercially available instrument offers sufficient sensitivity of detection to be considered for routine screening of telomerase activity in extracts from clinical materials.
#
8 19 10 11 12 m
Cell lines
I
1
2 3
4
5
6
7
Tissue samples
8 9 10 11 12j /I
Cell lines
Figure 10. Comparison of the sensitivity of detection of telomerase by radioactive and non-radioactive TRAP assays using extracts from primary tumors, adjacent tissues and tumor-derived cell lines. A variety of samples were subjected to the TRAP assay using radioisotopes with the products being detected on a Molecular Dynamics Phosphorlmager (Figure 10A). The same series of samples were subjected to the TRAP assay without using radioisotopes in which the amplified DNA was detected by fluorescence (on a Molecular Dynamics Fluorlmager) after staining the gel with SYBRTM Green I (Figure 10B). In both versions of the TRAP assay, the PCR amplification was for 31 cycles. The fluorescencebased detection of TRAP signals is comparable to that achieved when radioisotopes are used in the TRAP assay.
14 is thought to be a critical or perhaps rate-limiting step in this process. We have discovered telomerase activity present in nearly 90 percent of h u m a n cancers using a new and sensitive PCR-based assay (TRAP) to measure telomerase activity (30-31). This is a significant ' m a r k e r ' that in the future may be useful for diagnostic and prognostic purposes. In addition, since telomerase appears to be essential to the continued proliferation of cancer cells, development of anti-cancer agents based on telomerase inhibition may be highly effective. The present report describes many of the technical aspects of the T R A P procedure for analysis of cells and tissues which should assist in its rapid laboratory adaptation.
Acknowledgements Supported by research grants AGO7992, CA50195 from the National Institutes of Health, US Army Medical Research grant DAMD-94-J4077, and by the Geron Corporation, Menlo Park, California, USA.
Notes on suppliers 1. ICN Biomedicals Inc., 3300 Hyland Ave., Costa Mesa, CA 92626, USA 2. USA/Scientific Plastics, P.O. Box 3565, Ocala, FL 34478, USA 3. Sigma Chemical Company, P.O. Box 14508, St. Louis, MO 63178, USA 4. The Perkin-Elmer Corp., 761 Main Ave., Norwalk, CT 06859, USA 5. Pierce Chemical Co., 3747 North Meridian Rd., P.O. Box 117, Rockford, IL 61105, USA 6. Bio-Rad Laboratories, 2000 Alfred Nobel Dr., Hercules, CA 94547, USA 7. Boehringer Mannheim, P.O. Box 50414, Indianapolis, IN 46250, USA 8. Pharmacia Biotech, Tech. Inc., 800 Centennial Ave., Piscataway, NJ 08854, USA 9. The Midland Certified Reagent Company, 3112-A W. Cuthbert Ave., Midland, TX 79701, USA 10. Amersham Corp., 2636 Clearbrook Dr., Arlington Heights, IL 60005, USA 11. DuPont NEN Research Products, Customers Service, 549 Albany Street, Boston, MA 02218, USA 12. 5Prime-->3Prime, 5603 Arapahoe Rd., Boulder, CO 80303, USA 13. Molecular Probes, P.O. Box 22010, Eugene, OR 97402, USA t 4. Gibco/BRL, P.O. Box 6009, Gaithersburg, MD 20884, USA 15. United States Biochemical, P.O. Box 22400, Cleveland, OH 44122, USA 16. Brinkmann Instruments Inc., Cantiague Rd., Westbury, NY 11590, USA 17. Molecular Dynamics, 928 East Arques Ave., Sunnyvale, CA 94086, USA 18. VWR Scientific, P.O. Box 5025, Sugar Land, TX 77487, USA
19. Black & Decker, Towson, MD 21286, USA 20. MJ Research Inc., 149 Grove Street, Watertown, MA 02172, USA 21. Research Products International Corp., 410 N. Business Center Dr., Mount Prospect, IL 60056, USA
References 1. Hara E, Tsuruni H, Shinozaki A, Nakada S, Oda K (1991). Cooperative effect of antisense-Rb and antisense-p53 oligomers on the extension of life span in human diploid fibroblasts, TIG-1. Biochim Biophys Res Commun 179: 528-534. 2. Huschtscha LL, Holliday R (1983). Limited and unlimited growth of SV40-transformed cells from human diploid MRC-5 fibroblasts. J Cell Sci 63: 77-99. 3. Linder S, Marshall H (1990). Immortalization of primary cells by DNA tumor viruses. Exp Cell Res 191: 1-7. 4. Shay JW, Tomlinson G, Piatyszek MA, Gollahon LS (1995). Spontaneous in vitro immortalization of breast epithelial cells from a patient with Li-Fraumeni syndrome. Mol Cell Biol 15: 425-432. 5. Wright WE, Pereira-Smith OM, Shay JW (1989). Reversible cellular senescence: Implications for a twostage model for the immortalization of normal human diploid fibroblasts. Mol Cell Biol 9: 3088-3092. 6. Harris CC (1987). Human tissues and cells in carcinogenesis research. Cancer Res 47: 1-10. 7. Shay JW, Wright WE, Werbin H (1991). Defining the molecular mechanisms of human cell immortalization. Biochem Biophys Acta 1072: 1-7. 8. Allsopp RC, Vaziri H, Patterson C, Goldstein S, Younglai EV, Futcher AB, Greider CW, Harley CB (1992). Telomere length predicts replicative capacity of human fibroblasts. Proc Natl Acad Sci (USA) 89: 10114-10118. 9. Counter CM, Avillon AA, LeFeuvre CE, et al. (1992). Telomere shortening associated with chromosome instability is arrested in immortal cells which express telomerase activity. EMBO J 11 : 1921-1929. 10. Counter CM, Botelho FM, Wang P, Harley CB, Bacchetti S (1994). Stabilization of short telomeres and telomerase activity accompany immortalization of Epstein-Barr virus-transformed human B lymphocytes. J Virol 68: 3410-3414. 11. Counter CM, Hirte HW, Bacchetti S, Harley CB (1994). Telomerase activity in human ovarian carcinoma. Proc Natl Acad Sci (USA) 91: 2900-2904. 12. Hastie ND, Dempster M, Dunlop MG, Thompson AM, Green DK, Allshire RC (1990). Telomere reduction in human colorectal carcinoma and with ageing. Nature 346: 866-868. 13. Vaziri H. Sch~ichter F, Uchida I, Wei L, Zhu X, Effros R, Cohen D, Harley CB (1993). Loss of telomeric DNA during aging of normal and trisomy 21 human lymphocytes. Am J Hum Genet 52: 661-667. 14. Wright WE, Shay JW (1992). Telomere positional effects and the regulation of cellular senescence. Trends Genet 8: 193-197. 15. Blackburn EH (1994). Telomeres: No end in sight. Cell 77: 621-623.
15 16. Olovnikov AM (1973). A theory of marginotomy. J Theor Biol 41: 81-190. 17. Watson JD (1972). Origin of concatameric T4 DNA. Nature 239: 197-201. 18. Shay JW, Werbin H, Wright WE (1994). Telomere shortening may contribute to aging and cancer: A perspective. Mol Cell Dif 2: 1-21. 19. Shay JW, Wright WE, Werbin H (1993). Loss of telomeric DNA during aging may predispose cells to cancer. Int J Oncology 3: 559-563. 20. Shay JW, Pereira-Smith OM, Wright WE (1991). A role for both Rb and p53 in the regulation of human cellular senescence. Exp Cell Res 196: 33-39. 21. Adamson DJ, King DJ, Haites NE (1992). Significant telomere shortening in childhood leukemia. Cancer Genet Cytogenet 61 : 204-206. 22. Hiyama E, Yokoyama T, Hiyama K, Yamakido M, Santo T, Kodama T, Ichikawa T, Matsuura Y (1995). Alteration of telomeric repeat length in adult and childhood solid neoplasias. Int J Oncology 6: 13-16. 23. Mehle C, Ljungberg B, Roos G (1994). Telomere shortening in renal cell carcinoma. Cancer Res 54: 236-241. 24. Odagiri E, Kanda N, Jibiki K, Demura R, Aikawa E, Demura H (1994). Reduction of telomeric length and c-erbB-2 gene amplification in human breast cancer, fibroadenoma, and gynecomastia. Relationship to histologic grade and clinicai parameters. Cancer 73: 2978-2984. 25. Smith JK, Yeh G (1992). Telomere reduction in endometrial adenocarcinoma. Am J Obstet Gynecol I67: 1883-1887. 26. deLange T, Shiue L, Myers RM, Cox DR, Naylor SL, Killery AM, Varmus HE (1990). Structure and variability of human chromosome ends. Mol Ce!l Biol 10: 518-527. 27. Greider CW, Blackburn EH (1985). Identification of a specific tetomere terminal transferase activity in Tetrahymena extracts. Cell 43: 405-413. 28. Greider CW, Blackburn EH (1989). A telomeric sequence in the RNA of Tetrahymena telomerase required for telomere repeat synthesis. Nature 337: 331-337. 29. Morin GB (1989). The human telomere terminal transferase enzyme is a ribonucleoprotein that synthesizes TTAGGG repeats. Cell 59: 521-529. 30. Hiyama E, Hiyama K, Yokoyama T, Matsuura Y, Piatyszek MA, Shay JW (1995). Correlating telomerase activity levels with human neuroblastoma outcomes. Nature Medicine 1: 249-255. 31. Kim NW, Piatyszek MA, Prowse KR, HarLey CB, West MD, Ho PLC, Coviello GM, Wright WE,Weinrich SL, Shay JW (1994). Specific association of human telomerase activity with immortal cells and cancer. Science 266:2011-2015. 32. Nitsson P, Mehle C, Remes K, Ross G (1994). Telomerase activity in vivo in human malignant hematopoietic cells. Oncogene 9: 3043-3048. 33. Shay JW, Brasiskyt6 D, Ouellette M, Piatyszek MA, Werbin H, Ying Y, Wright WE (1994). Analysis of telomerase and telomeres. In: Adolph KW (ed), Gene
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
and chromosome analysis. San Diego: Academic Press, 5 part C: 263-280. Hiyama K, Hiyama E, Ishioka S, Yamakido M, Inai K, Gazdar AF, Piatyszek MA, Shay JW (1995). Telomerase activity in human lung cance: Do all lung cancers consist of immortal cells? AACR abstracts 1995, No. 3299. Mehle C, Piatyszek MA, Ljungberg B, Shay JW, Roos G (1995). Telomerase activity and clinical correlations in human renal cell carcinoma. AACR abstracts 1995, No. 3309. Sommerfeld HJ, Meeker AK, Piatyszek MA, Shay JW, Coffey DS (1995). Telomere shortening and telomerase activity in human prostate tissue. AACR abstracts 1995, No. 3311. Morin GB (1991). Recognition of chromosome truncation site associated with ct-thalassaemia by human telomerase. Nature 353: 454-456. Kaczorowski T, Furmanek B, Sektas MA (1994). Method for removal of radioactive nucleotides from electrophoretic buffers. BioTechniques 16: 10301031. Bassam BJ, Caetano-Anoll6s G, GresshoffPM (1991). Fast and sensitive silver staining of DNA in polyacrytamide gels. Anal Biochem 196: 80-83. Hsu IC, Metcalf RA, Sun T, Welsh JA, Wang NJ, Harris CC (1991). Mutational hotspot in the p53 gene in human hepatocellular carcinomas. Nature 350: 427-428. Fernley HN (1971). Mammalian alkaline phosphatases. In: Boyer PD (ed), The enzymes. New York/London: Academic Press, vol 4, pp 417-447. Posen S, Neale FC, Clubb JS (1995). Heat inactivation in the study of human alkaline phosphatases. Ann Int Med 62: 1234-1243. Akane A, Matsubara K, Nakamura H, Takahashi S, Kimura K (1994). Identification of the heine compound copurified with deoxyribonucleic acid (DNA) from bloodstains: A major inhibitor of polymerase chain reaction (PCR) amplification. J Forensic Sci 39: 362-372. Niederhauser C, H6fetein C, Wegmfiller B, Ltithy J, Candrian U (1994). Reliability of PCR decontamination systems. PCR Meth Appl 4:117-123. Chiu C-P, Dragowski V, Kim NW, Thomas TE, Harley CB, Lansdorp PM (1995). Telomerase activity in hematopoietic progenitor cell extracts from adult bone marrow. AACR abstracts 1995, No. 3306. Shay JW, Wright WE, Brasiskyt6 D, Van der Haegen BA (1993). E6 of human papilloma virus 16 can overcome the M1 stage of immortalization in human mammary epithelial cells but not in human fibroblasts. Oncogene 8: 1407-1413.
Address for correspondence: Jerry W. Shay, PhD, Department of Cell Biology and Neurosciences, University of Texas Southwestern Medical Center at Dallas, 5323 Harry Hines Boulevard, Dallas, TX 75235-9039, USA Phone: (214) 648 3282; Fax: (214) 648 8694 E-mail:
[email protected] 