Apoptosis (2015) 20:63–74 DOI 10.1007/s10495-014-1046-4
ORIGINAL PAPER
Dichloroacetate affects proliferation but not survival of human colorectal cancer cells L. M. Delaney • N. Ho • J. Morrison • N. R. Farias • D. D. Mosser • B. L. Coomber
Published online: 26 October 2014 Ó Springer Science+Business Media New York 2014
Abstract Dichloroacetate (DCA) is a metabolic reprogramming agent that reverses the Warburg effect, causing cancer cells to couple glycolysis to oxidative phosphorylation. This has been shown to induce apoptosis and reduce the growth of various types of cancer but not normal cells. Colorectal cancer cells HCT116, HCT116 p53-/-, and HCT116 Bax-/-, were treated with DCA in vitro. Response to treatment was determined by measuring PDH phosphorylation, apoptosis, proliferation, and cell cycle. Molecular changes associated with these responses were determined using western immunoblotting and quantitative PCR. Treatment with 20 mM DCA did not increase apoptosis, despite decreasing levels of anti-apoptotic protein Mcl-1 after 6 h, in any of the cell lines observed. Mcl1 expression was stabilized with MG-132, an inhibitor of proteasomal degradation. A decrease in Mcl-1 correlated with a decrease in proliferation, both of which showed dose-dependence in DCA treated cells. Cells showed nuclear localization of Mcl-1, however cell cycle was unaffected by DCA treatment. These data suggest that a reduction in the prosurvival Bcl-2 family member Mcl-1 due to increased proteasomal degradation is correlated with the ability of DCA to reduce proliferation of HCT116 human colorectal cancer cells without causing apoptosis.
L. M. Delaney N. Ho J. Morrison N. R. Farias B. L. Coomber (&) Department of Biomedical Sciences, University of Guelph, Guelph, ON N1G 2W1, Canada e-mail:
[email protected] D. D. Mosser Department of Molecular and Cellular Biology, University of Guelph, Guelph, ON N1G 2W1, Canada
Keywords p53 Bax
Mcl-1 Dichloroacetate Colorectal cancer
Introduction The preferential ability of cancer cells to metabolize glucose via aerobic glycolysis as opposed to oxidative phosphorylation, referred to as the Warburg effect, provides a unique opportunity to specifically target cancer cells while leaving normal cells intact [1]. Development of a specific cancer therapy has the potential to not only inhibit the progression of tumours, but also to overcome resistance of cancer to current therapeutic interventions [2–6]. One proposed mechanism by which cancer therapy can target the Warburg effect is through reversing the altered metabolism of cancer cells back to that of normal cells, thereby inhibiting the advantages sustained by this phenotype. The Warburg effect allows cells to increase generation of biomolecules required for proliferation through the accumulation of metabolic intermediates [7]. It also contributes to apoptosis resistance by creating hyperpolarized mitochondria and generating reducing power, allowing control over reactive oxygen species (ROS) generation, which, if uncontrolled, leads to oxidative stress and apoptosis [8]. One mechanism by which cancer cells maintain their metabolic phenotype is through the overproduction of pyruvate dehydrogenase kinase (PDK), which inhibits pyruvate dehydrogenase (PDH) [9]. This inhibition prevents pyruvate, the end product of glycolysis, from entering mitochondria and undergoing TCA cycle and oxidative phosphorylation [9]. Instead, pyruvate is converted into lactate and shuttled out of the cell, leading to an acidic microenvironment that also contributes to malignancy [10]. Inhibition of PDK, therefore, could reverse the Warburg
123
64
effect and decrease cancer malignancy by slowing cell proliferation and increasing apoptosis. Dichloroacetate (DCA) is a PDK inhibitor that has shown promise as a cancer treatment as it does not harm somatic cells that are normally affected by cytotoxic chemotherapy [1, 11, 12]. Currently, it has been experimentally shown to induce apoptosis in certain types of cancer, and abolish therapeutic resistance to other anti-cancer compounds in combination treatments [2–6]. In colorectal cancer, however, the effects of DCA are variable, and many reports indicate that DCA is ineffective at apoptosis induction, or effective only at doses well above pharmacological relevance [13–15]. The molecular mechanisms by which colorectal cancer cells respond to DCA treatment are poorly understood. The Bcl-2 family is comprised of pro- and anti-apoptotic proteins whose interactions will determine whether or not mitochondrial outer membrane permeabilization will occur, leading to cytochrome c release, caspase activation, and apoptosis [16]. Bcl-2 proteins are commonly dysregulated in cancer, and can play roles in the cell independent of their ability to initiate an apoptotic response. Mcl-1 is an antiapoptotic protein that is commonly dysregulated in cancer, conferring resistance to several cancer therapies [17, 18]; DCA has been shown to overcome therapeutic resistance to such cancer therapies [3, 5, 6]. Mcl-1 expression has also been related to cell cycle progression and proliferation; its nuclear localization corresponds with cell cycle regulation and DNA damage checkpoints, and its reduction has been correlated with a decrease in cellular proliferation [19–23]. The role of Mcl-1 in response to DCA has not been evaluated, and may provide critical insight into mechanisms by which cancer cells respond to DCA treatment. As colorectal cancer is the second leading cause of cancer-related deaths in North America, and its high mortality rate at late stages is due to a high incidence of acquired resistance to cytotoxic chemotherapy, it is of interest to determine the molecular mechanisms by which these cells are resisting DCA-induced apoptosis [24]. In this study, we exposed colorectal cancer cell lines with intact and disrupted p53 and Bax to DCA and evaluated their proliferation and apoptosis. We then correlated these physiological changes with the protein expression of Mcl-1, as well as its cellular localization. Our findings provide a potential link between cellular response to DCA and Mcl-1 expression and suggest that the involvement of Mcl-1in apoptosis may influence cellular response to DCA.
Materials and methods Cell culture Human colorectal cancer cell lines HCT116 (purchased from the American Type Culture Collection, Manassas,
123
Apoptosis (2015) 20:63–74
VA, USA), HCT116 p53-/-, and HCT116 Bax-/-(kindly provided by Dr. Bert Vogelstein) [25, 26] were cultured in Dulbecco’s modified Eagle medium (DMEM; SigmaAldrich, Oakville, ON, Canada) containing 10 % fetal bovine serum (FBS; Life Technologies, Burlington, ON, Canada), 1 mM sodium pyruvate (Sigma-Aldrich), and 50 lg ml-1 gentamicin (Sigma-Aldrich) in a 37 °C incubator with 5 % CO2. Cell lines were serum starved in DMEM containing 0.1 % FBS, sodium pyruvate, and gentamicin for 24 h prior to treatment with 0.5–50 mM DCA (Sigma-Aldrich), 385 nM 5-fluorouracil (5-FU; Hospira, Montreal, QC, Canada), 150 lM etoposide (SigmaAldrich), and/or 5 lM proteasomal inhibitor MG132 (Sigma-Aldrich). Measurement of proliferation, viability and apoptosis Cell number and viability was measured after 4 days of treatment with DCA via counting and dye exclusion with Trypan blue (Sigma-Aldrich). The formation of apoptotic bodies was used to qualitatively observe apoptosis in cells cultured with or without 20 mM DCA or etoposide for 24 h. Floating and adhered cells were transferred to a microscope slide using a Cytospin 3 Centrifuge (Shandon, Ramsey, MN, USA) and stained with 40 ,6-Diamidino-2Phenylindole, Dihydrochloride (DAPI, Life Technologies) to observe apoptotic body formation with a fluorescence microscope (Leica Opti-tech, Scarborough, ON, Canada). Images were captured using a QImaging QICAM Fast 1394 camera (QImaging, Redwood City, CA, USA). The generation of cleaved caspase 3 was observed after 48 h in cells untreated or treated with 20 mM DCA or 5-FU using western blotting as described below. Protein lysis and western immunoblotting Colorectal cancer cells were grown with or without the addition of DCA, 5-FU, or etoposide. After culture, cells were washed once with PBS and lysed with 100 ll cell lysis buffer (Cell Signaling Technology, Danvers, MA, USA) containing protease inhibitors (Sigma-Aldrich). Cells were centrifuged at 12,0009g for 15 min at 4 °C, and supernatant was stored at -80 °C for future use. Separation of nuclear from cytosolic protein was performed using the Nuclear/Cytosolic Fractionation Kit (BioVision, Milpitas, CA, USA). Nuclear and cytosolic fractions were stored separately -80 °C. Protein was quantified using the BioRad DC Protein Assay Kit (BioRad, Mississauga, ON, Canada). 50 lg of protein was added to a polyacrylamide gel and subjected to SDS-PAGE for 80 min at 125 V in Tris-SDS running buffer. Protein was transferred to a polyvinylidene fluoride membranes, blocked in 5 % skim milk then incubated overnight at 4 °C with primary
Apoptosis (2015) 20:63–74
antibodies. After washing, membranes were incubated for 1 h at room temperature with secondary antibody, washed, and subjected to chemiluminescent substrate (Luminata Forte, Millipore). Membranes were imaged with the ChemiDoc XRS ? system (BioRad, Mississauga, ON, Canada) and densitometry was performed using Image Lab software (BioRad). Primary antibodies included rabbit monoclonal anti-Mcl-1 (1:1,000), anti-Bcl-2 (1:5,000), anti-Bcl-x (1:5,000), anti-Bag-1 (1:1,000), anti-Bax (1:2,000), anti-Bad (1:1,000), anti-Bid (1:1,000) (all from Epitomics, Burlingame, CA, USA), anti-caspase-3 (1:1,000), anti-Lamin A/C, anti-b-actin (1:1,000) (from Cell Signaling Technology), anti-pPDH Ser293 (1:1000; Novus Biologicals, CO, USA) and Ser300 (1:1000; EMD Millipore, MA, USA), mouse anti-PDH (1:1000; Abcam plc, Cambridge, UK), rabbit anti-MULE1 (1:1,000; Bethyl Laboratories Inc., Montgomery, TX, USA), anti-a-tubulin (1:200000; Cell Signaling), and secondary antibodies HRPlabeled anti-mouse and anti-rabbit (both 1:20,000; SigmaAldrich).
mRNA extraction and PCR HCT116 cells were cultured with or without 20 mM DCA for 6 h, and collected into TRIzol (Life Technologies), and total RNA collected via chloroform extraction and alcohol precipitation according to the manufacturer’s protocols. The resultant RNA pellet was solubilized in DEPC-treated water (BioRad) and quantified at A260 using a Nanodrop ND-1000 (Thermo Scientific; Waltham, MA, USA). cDNA was then synthesized with the Superscript First-Strand Synthesis System for RT-PCR (Life Technologies) in a Mastercycler (Eppendorf, Mississauga, ON, Canada). To determine the presence of MCL-1 isoforms, primers were designed to amplify both the full-length isoform and the splicing product resulting from the removal of exon 2 (F: 50 TAATCGGACTCAACCTCTACTGTG, R: 50 TAGATATGCCAAACCAGCTCCT, amplification products for full-length and spliced products 1080 bp and 810 bp, respectively). 0.5 ll cDNA was combined with 1 ll primer mix, 0.5 ll dNTPs (10 mM), 2.5 ll 10X buffer and 0.2 ll Taq DNA transcriptase from Invitrogen, and RNase free water to a final volume of 25 ll. Products were amplified using a Mastercycler (Eppendorf)under the following conditions: 95 °C for 5 min followed by 36 cycles of 95 °C for 30 s, 56 °C for 20 s, and 72 °C for 60 s, followed by 72 °C for 5 min. Following amplification, PCR products were run on an agarose gel and visualized using the ChemiDoc XRS ? System (BioRad). PCR products were run alongside a 1 Kb DNA Ladder (Froggabio, Toronto, ON, Canada) in order to determine relative size in base pairs.
65
For real-time quantitative PCR, reaction conditions were optimized according to the MIQE guidelines [27] to achieve an assay performance efficiency of 90–110 %. Primers were designed to amplify B-ACTIN [28] as a reference gene and MCL-1 [29] as a target gene. Each reaction was performed in triplicate and contained 4 ll cDNA (diluted 1:16 in nuclease-free water), 1 ll forward and reverse primer mix (10 lM), and 5 ll Sso Fast Eva Green Supermix (BioRad) and amplified in a CFX-96 Real-Time System (BioRad) under the following conditions: 95 °C for 30 s followed by 39 cycles of 95 °C for 10 s and 59 °C for 10 s. A melt curve was performed immediately following PCR to ensure that only the desired product was amplified. Data analysis for RT-qPCR products was performed using CFX Manager software (BioRad). Immunofluorescence To detect cellular localization of Mcl-1, cells were cultured on sterile Superfrost Plus slides (Fisherbrand) with or without 20 mM DCA for 6 h. Slides were washed with PBS, fixed for 15 min in 4 % paraformaldehyde (USB Corporation, Cleveland, OH, USA), and washed again in PBS before drying at RT. Slides were blocked in PBS buffer containing 5 % normal goat serum (Sigma-Aldrich) and 0.1 %Triton X-100 (BioRad) for 1 h at room temperature, and incubated overnight at 4 °C with rabbit monoclonal anti-Mcl-1 diluted 1:100 in antibody dilution buffer containing PBS, 0.1 %Triton X-100, and 0.1 % BSA (Fisher Scientific). Slides were washed with PBS prior to incubation for 1 h at room temperature with Cy3-conjugated goat-anti-rabbit secondary antibody (Cedarlane, Burlington, ON, Canada) diluted 1:300 in antibody dilution buffer. Slides were then washed with PBS and incubated at room temperature for 7 min with 30 lM DAPI diluted 1:100 in PBS containing 0.1 % Triton X-100. Cells were then washed in PBS and coverslips were applied using fluorescent mounting medium (Dako, Carpinteria, CA, USA), and imaged as described previously. Flow cytometry Cells were cultured with or without 20 mM DCA for 24 h. 5 9 106 cells were added dropwise to 9 ml of 70 % ethanol through a 22-gauge needle and incubated overnight at -20 °C. Cells were centrifuged at 2009g for 10 min, resuspended in 500 ll of a staining solution containing 4 mg ml-1 DNase-free RNase A (Life Technologies) and 400 lg ml-1 of propidium iodide (PI; BioVision) in PBS with 0.1 % Triton X-100, and incubated for 15 min at 37 °C, protected from light. Cell cycle analysis was performed using the FACScan system and CellQuest Pro software (BD Biosciences, Mississauga, ON, Canada). Cell
123
66
scatter plots were used to select relevant cells for analysis based on forward and side scatter to determine cell size and content, and intensity of PI staining was measured through the FL-2 channel. DNA content was determined by intensity of PI staining; cells with 2 N DNA content were assumed to be in G1, cells with 4 N DNA content were assumed to be in G2/M, and all cells in between were assumed to be in various stages of the S phase. Cyflogic software (CyFlo Ltd., Turku, Finland) was used to determine percentage of cells in each phase of the cell cycle. Annexin V/PI staining was conducted using a commercially available kit (Life Technologies). Briefly, 5 9 105 cells were seeded onto 6-well plates and incubated overnight. Following 24 h treatment, cells were trypsinized, washed, resuspended in annexin-binding buffer containing annexin V and PI dyes and left to incubate for 15 min at room temperature, protected from light. Cells were gently mixed using additional annexin-binding buffer and subsequently analyzed using a FACScan flow cytometer. In total, 1 9 104 events were counted per sample. Fluorescence scatter plots were gated and analyzed using the Cyflogic software to determine the percentage of viable and dead cells. Statistical analysis GraphPad Prism software (GraphPad Software Inc., La Jolla, CA, USA) was used to perform Wilcoxon paired t-tests for PCR and western immunoblotting analysis, and regression analysis was performed for dose response experiments. Correlation between variables measured following DCA dose responses was determined using the Spearman r coefficient. Nonlinear regression was used to interpolate IC50 values. At least three biological replicates were used for each analysis, and treatments were considered significantly different if a p value \ 0.05 was achieved.
Results DCA does not induce apoptosis but inhibits proliferation of HCT116 cells independently of cell cycle As expected, treatment with 20 mM DCA for 24 h decreased phosphorylation of PDH at both Ser300 and Ser293 sites (Fig. 1a). Since these data indicate DCA’s activity within the cell, we determined whether or not DCA treatment led to an increase in cell death. Apoptosis in HCT116 WT cells was detected by visualizing caspase 3 cleavage following treatments (Fig. 1b). DCA failed to induce caspase 3 activation following 24 and 48 h at 20 or 50 mM, as indicated by a lack of caspase 3 cleavage. A cleavage product was seen following
123
Apoptosis (2015) 20:63–74
treatment with a positive control for apoptosis, 5-FU. Visualization of nuclei with DAPI was used to observe the presence of apoptotic bodies following treatment with 20 mM DCA for 24 h. Treatment with 20 mM DCA failed to result in the appearance of apoptotic bodies, which were seen after treatment with 150 lM etoposide for 24 h (Fig. 1c). Treatment with 20 mM DCA for 24 h also failed to increase necrosis and apoptosis detected through annexin V and PI staining, measured by flow cytometry (Fig. 1d). These data suggest that HCT116 cells are resistant to DCA-induced apoptosis. Since many assays (such as MTT) rely on metabolic activity as a measure for cellular proliferation, cell counts were performed to avoid any confounding effects of DCA on assay parameters. HCT116 WT cells showed slower growth rates when treated with 20 mM DCA compared to control treatment. Control cell number was greater than DCA-treated cells by a factor of 1.37 at 2 days, 1.58 after 3 days, and 2.25 after 4 days (Fig. 1e). Although a decrease in cell number was observed, the percentage of viable cells remained above 90 %, as observed using Trypan blue dye exclusion. In order to determine whether reduced proliferation was a result of cell cycle arrest, we evaluated DCA effects on cell cycle kinetics of HCT116 WT cells. After 24 h, HCT116 WT cells showed similar cell cycle distribution in the presence or absence of 20 mM DCA (Fig. 1). DCA treatment results in a decrease of Mcl-1 protein level In order to determine the mechanism by which HCT116 cells evade DCA-induced apoptosis, pro- and anti-apoptotic Bcl-2 protein expression was determined using western immunoblotting. Anti-apoptotic proteins Bcl-x, Bag-1, and Bcl-2 and pro-apoptotic proteins Bax, Bad, and Bid showed no change in their levels when cells were treated with 20 mM DCAfor 7 or 24 h (Fig. 2a). However, the antiapoptotic protein Mcl-1 showed significantly lower levels following 7 h of DCA treatment that was not sustained for 24 h (p = 0.0078) (Fig. 2b, c). Decrease in Mcl-1 is due to proteasomal degradation In order to determine the cause of Mcl-1 downregulation, we measured its regulation transcriptionally and posttranslationally. PCR to detect the splice variant of MCL-1 showed only the full-length isoform of MCL-1 in HCT116 WT cells after 6 h of treatment with 20 mM DCA (Fig. 3a). Following treatment of HCT116 WT cells with 20 mM DCA for 6 h, MCL-1 mRNA levels did not significantly differ when compared with control cells (Fig. 3b; p = 0.75). There was also no alteration in the levels of Mcl-1 binding partners Noxa and Puma (Fig. 3c). Cotreatment of HCT116 WT cells with MG132 (a proteasome
Apoptosis (2015) 20:63–74
67
Fig. 1 a Western blot of PDH phosphorylation in HCT116 cells. Following 20 mM DCA treatment, PDH phosphorylation was reduced in both serine residues 300 and 293. DCA treatment did not have an affect on native PDH levels. a-tubulin was used as a loading control. b Western immunoblotting showing that DCA did not induce apoptosis at 20 or 50 mM in HCT116 WT cells. Cells treated with 385 nM 5-FU for 24 and 48 h show cleaved caspase 3. c Although apoptotic bodies were seen in HCT116 WT cells treated with 150 lM etoposide for 24 h (top panel), they were not detected in control HCT116 cells or those treated with 20 mM DCA for 24 h (bottom left and right panel, respectively). Scale bar = 10 lm. d Cell death analysis through annexin V and PI staining. Viable, early
apoptotic, and late apoptotic/necrotic cells are shown in the lower left, lower right, and upper quadrants, respectively. Exposure to 20 mM DCA did not lead to significant cell death in HCT116 WT cells after 24 h of treatment. e DCA slowed the proliferative rate of HCT116 WT cells. Data are expressed as a mean fold increase in cell number relative to the original number of cells plated, with error bars representing SD. f FACS analysis with propidium iodide staining was used to determine cell cycle distribution in DCA treated HCT116 WT cells. The percentage of cells in G2/M phase was consistent between control and DCA-treated cells, indicating no change in cell cycle distribution after 24 h. The mean percentages of cells in G2/M phase are plotted with error bars representing standard error
inhibitor) prevented DCA induced reductions in Mcl-1 when compared to MG132 treatment alone, suggesting Mcl-1 regulation following DCA treatment is due to increased degradation by the proteasome (Fig. 3d). The levels of the Mcl-1 E3Ub ligase MULE-1 are not affected by DCA treatment (Fig. 3e), consistent with our findings that Mcl-1 levels are reduced by efficient proteosome activity in DCA treated cells.
HCT116 p53-/- and Bax-/-. Mcl-1 expression decreased in a dose-dependent fashion in all 3 cell lines (Fig. 4a–c). This reduction in Mcl-1 was significantly different from control (untreated) cells at 20, 35 and 50 mM (WT cells; p = 0.0023), 35 and 50 mM (p53-/- cells; p = 0.0026) and 35 and 50 mM (Bax-/- cells; p = 0.0028). Cell proliferation also decreased with increasing DCA concentration (Fig. 5a). Following 4 days of treatment with 20 mM DCA, there was a 94, 82, and 87 % decrease in cell number in WT, p53-/-, and Bax-/- cell lines, respectively. Using linear regression analysis, the inverse relationship between DCA dose and cellular proliferation was significant in all cell lines (WT: p = 0.0003, p53-/-: p \ 0.0001, Bax-/-: p = 0.0001). The IC50 values calculated were 3.87, 9.98, and 3.14 mM for WT, p53-/-, and Bax-/- cell lines, respectively. This indicates that WT and Bax-/- HCT116
DCA inhibits cellular proliferation and decreases Mcl-1 levels in a dose-dependent manner independently of p53 and Bax status In order to determine the effect of p53 or Bax on DCAinduced Mcl-1 depletion and DCA-induced cellular proliferation decrease, we tested HCT116 WT cells along with
123
68
Apoptosis (2015) 20:63–74
Fig. 3 a PCR amplification showing that only full-length MCL-1 gene is present in HCT116 WT cells with or without 20 mM DCA treatment for 6 h. Primers were designed to amplify both full-length (1080 bp) and alternative splicing variant (810 bp) isoforms of MCL1 mRNA. b qRT-PCR analysis revealed that transcription levels of MCL-1 were not significantly different (p [ 0.05) between control and 20 mM DCA-treated HCT116 WT cells following 6 h of treatment. Data is presented as relative MCL-1 expression normalized to a housekeeping gene, b-ACTIN; bars represent standard error. c Western immunoblotting shows levels of Mcl-1 binding partners Noxa and Puma were similar between control and 20 mM DCAtreated HCT116 WT cells following 7 h of treatment. d Inhibition of the proteasome using 5 lM MG132 resulted in stable Mcl-1 protein levels in control and 20 mM DCA-treated HCT116 WT cells, compared to decreased Mcl-1 in DCA-treated cells without the addition of MG132. e Western immunoblotting shows levels of the Mcl-1 E3Ub ligase MULE-1 in HCT116 WT cells. Levels were similar between control cells and cells treated for 24 h with 20 mM DCA Fig. 2 a Representative western immunoblots showing no change in protein levels of various pro- and anti-apoptotic proteins in HCT116 WT cells after incubation with 20 mM DCA for 1, 7, and 24 h. b Representative western immunoblot shows 20 mM DCA reduced Mcl-1 protein in the cell after 7 h c Densitometry shows mean Mcl-1 protein expression is significantly reduced in DCA treated cells (p = 0.0078, N = 8). Values are plotted with error bars representing standard error
cells are more susceptible to DCA-induced growth inhibition than p53-/- cells. Cellular viability was also calculated using a dye exclusion method (Fig. 5b), and was similar at all doses in each cell line, further supporting the evidence that reduction in cell number is due to decreased proliferation and not apoptosis induced by DCA treatment. Finally, using Spearman’s r coefficient, it was determined that there was a significant correlation (p = 0.0195) between reduction in Mcl-1 levels and cell number with increasing doses of DCA. Collectively, these data suggest
123
that Mcl-1 may be involved in the decreased proliferation exhibited by HCT116 cells following DCA treatment. Mcl-1 localization within HCT116 cells is both cytoplasmic and nuclear Using immunofluorescence microscopy, we visualized the intracellular location of Mcl-1 in HCT116 WT, p53-/-, and Bax-/- cells (Fig. 6a). Surprisingly, nuclear Mcl-1 was seen along with cytoplasmic Mcl-1 in all HCT116 cell lines. The distribution of Mcl-1 in the nucleus of all cells is not uniform, but rather appears as clusters around specific sections of chromatin. During mitosis, Mcl-1 localization to the chromatin is lost but it is still present in the cytoplasm. Subcellular fractionation after 24 h of treatment with 20 mM DCA showed Mcl-1 in the nuclear cell fraction. Mcl-1 levels decreased in both the nuclear and the cytosolic fraction following DCA treatment (Fig. 6b).
Apoptosis (2015) 20:63–74
69
Fig. 5 a A significant inverse relationship was also seen between cellular proliferation levels and DCA dose in HCT116 WT (p = 0.0003, N = 3), p53-/- (p \ 0.0001, N = 3), and Bax-/(p = 0.0001, N = 3) cells following DCA treatment after 4 days. Mean cell numbers were plotted and error bars were used to represent SD b Trypan blue dye exclusion analysis indicated that cell viability did not vary significantly between DCA doses following DCA treatment for 4 days. Mean viability of HCT116 WT, p53-/- and Bax-/- cells was plotted; error bars represent SD
Fig. 4 Representative western blots and densitometry showing the inverse relationship between DCA dose and Mcl-1 expression in HCT116 WT (a), p53-/-(b) and Bax-/-(c) cells after 24 h exposure. Densitometry shows mean Mcl-1 levels normalized to b-actin; error bars represent standard error of the mean; N = 4. *significantly different from Control (0 DCA) but not from each other; p \ 0.05
Discussion This study demonstrates that although DCA was unable to induce apoptosis in HCT116 colorectal cancer cell lines regardless of p53 and Bax status, it is able to reduce
cellular proliferation, an effect that is significantly correlated with the proteasomal degradation of the anti-apoptotic protein Mcl-1. The uptake and activity of DCA in HCT116 cells was verified by the reduction in PDH phosphorylation at Ser300 and Ser293, indicative of an interference with PDK, a known DCA target [1]. Studies have shown that the Warburg effect, preferential utilization of aerobic glycolysis over oxidative phosphorylation in cancer cells, is a prominent phenotype in cells isolated from human colorectal tumours [30]. Although DCA has previously been shown to induce apoptosis and reduce cellular proliferation in cancer cells by reversing the Warburg effect [1], our data suggests that in HCT116 human colorectal cancer cells, DCA is only able to alter cellular proliferation, and does not induce apoptosis. The
123
70
Apoptosis (2015) 20:63–74
Fig. 6 a Immunofluorescence of HCT116 WT, p53-/-, and Bax-/cells treated with 20 mM DCA for 6 h. Mcl-1 is located not only in the cytosol, as expected, but also present in the nucleus. Arrows indicate that chromatin-associated Mcl-1 is lost during mitosis. Cells are stained for Mcl-1 (red) with DAPI nuclear counterstain (blue); scale bar = 20 lM. b Mcl-1 is present in both the nuclear and
cytosolic fractions of HCT116 WT cells, and decreases in both fractions following 24 h of treatment with 20 mM DCA. Lamin A/C was used to detect nuclear contamination in the cytosolic fraction, and a-tubulin was used to detect cytosolic contamination in the nuclear fraction
inability of DCA to induce apoptosis in these cells may be due to a lack of the DCA transport molecule SLC5A8, whose expression has been correlated to an increase in cancer sensitivity to DCA [31]. The concentration of DCA (20 mM) used in this study, therefore, may not be necessary in cells whose SLC5A8 expression is intact. Furthermore, re-expression of the SLC5A8 gene in HCT116 cells may reduce the effective DCA concentration to a physiologically appropriate dose. Previous findings have also shown that HCT116 is resistant to DCA-induced apoptosis [15], and DCA has been shown to reduce proliferation independently of cell death at low doses in colorectal cancer cell lines SW480, HT29, and LoVo [14]. Our data indicates that the DCA-induced decrease in proliferation was not a result of cell-cycle arrest, which has been
reported to occur in colorectal cancer cells alongside apoptosis following DCA-independent and dependent interference with glucose metabolism [14, 32]. This strongly suggests a role for DCA in apoptosis- and cell cycle arrest-independent alterations in proliferation. HCT116 WT cells showed significantly lower Mcl-1 protein levels following DCA treatment. Although a splice variant of Mcl-1 exists with opposing function to its fulllength precursor, this is not expressed in HCT116 cells, regardless of DCA treatment. The decrease in Mcl-1 protein levels were not due to a reduction in Mcl-1 mRNA production or increased levels of turnover since mRNA levels were not altered in the DCA-treated cells. However, Mcl-1 protein levels were stabilized when cells were treated with DCA together with the proteasomal inhibitor
123
Apoptosis (2015) 20:63–74
MG132, suggesting that Mcl-1 protein turnover is accelerated in DCA-treated cells. The half-life of Mcl-1 is relatively short (\3 h) and its rapid turnover provides a mechanism for cells to rapidly respond to conditions that inhibit Mcl-1 expression [33]. Pro-apoptotic Bcl-2 family members Puma and Noxa have been suggested as potential regulators of Mcl-1 degradation [34–37], and both have shown activation in cancer cells treated with DCA [38–40]. However, neither of these proteins showed decreased expression following DCA treatment in HCT116 cells. Therefore, it is of interest to further pursue the mechanism responsible for the increased proteasomal degradation of Mcl-1 in response to DCA treatment. Post-translational control over Mcl-1, its ubiquitination, and its degradation is highly complex, and establishing phosphorylation patterns on Mcl-1 following DCA treatment may help elucidate the pathway involved [41]. Our data show a significant correlation between DCAinduced proliferation decrease and DCA-induced Mcl-1 decrease, and we investigated the relationship between this phenomenon in HCT116 WT, HCT116 p53-/-, and HCT116 Bax-/- cells. Both p53 and Bax play a role in mitochondrial respiration, glycolysis, and ATP production of HCT116 cells, and therefore it was of interest to see if DCA would have a more prominent effect where mitochondrial stability was potentially vulnerable [42, 43]. Previous reports have shown that HCT116 p53-/- cells were more susceptible to DCA-induced apoptosis than HCT116 WT cells [13], and we also observed a decreased resistance to DCA-induced growth inhibition in p53-/cells. This is likely due to defects in the electron transport chain of HCT116 p53-/- cells, specifically in complex IV, which limits the efficacy of DCA [13]. Although Bax activation has been reported following DCA treatment in other colorectal cancer cell lines [44], Bax status did not change the effect of DCA on HCT116 cell proliferation, indicating that this response is independent of Bax-mediated mitochondrial disruption. A significant inverse relationship between DCA dose and proliferation or Mcl-1 expression existed for all three HCT116 cell lines, as did a significant correlation between proliferation and Mcl-1 expression. This indicates a potential role for Mcl-1 in the DCA-induced decrease in proliferation that we observed. Previous studies with breast cancer cells show decreased proliferation and cell growth in vitro when Mcl-1 was knocked down [45], and translational inhibition of Mcl-1 is associated with reduced proliferation in chronic myelogenous leukemia cells [46]. Our study showed that Mcl-1 was localized in the nucleus and cytoplasm of HCT116 WT, p53-/-, and Bax-/- cells. Analysis of tissue samples from colorectal cancer patients by immunohistological staining indicated that Mcl-1 showed nuclear localization in all positively
71
stained cases, and this expression was strongly correlated with tumour grade, tumour stage, and the presence of metastases [47]. Based on its sequence, the role of Mcl-1 as a DNA-binding protein is unlikely [48]; however, its function in the nucleus is likely to be independent from its anti-apoptotic role at the mitochondria [22]. Our results show that both cytoplasmic and nuclear Mcl-1 is present in the cell and that, in both subcellular fractions, Mcl-1 decreases following 24 h of DCA treatment. Although roles of nuclear Mcl-1 have been described, its localization within the cell is seldom reported. Thus, it is difficult to determine the implications of its subcellular localization with respect to its function following DCA treatment. Inclusion of subcellular localization in studies involving Mcl-1 may be a valuable tool in deciphering its highly complex patterns of activity within the cell. The versatility of Mcl-1 activity within the cell is dependent on its unique N terminus, which regulates subcellular localization, anti-apoptotic, and anti-proliferative activities [49]. Several apoptosis-independent roles for Mcl-1 have been suggested, many involving its role in growth inhibition. Mcl-1 has been shown to play a crucial role in chemotherapy-induced senescence; in HCT116 cells, Mcl-1 knockdown abolishes the ability to resist senescence, both in p53?/? and p53-/- cell lines [50]. Another function for Mcl-1 independent of apoptosis may be its involvement in stem cell maintenance, including the ability to self-renew [51, 52]. Studies have suggested that DCA effectiveness in apoptosis induction may be correlated with the capacity of cells to self-renew, and HCT116 cells have a high capacity for self-renewal [1, 53]. Indeed, a decrease in Mcl-1 plays a key role in proliferation, senescence and stem cell-like properties in aggressive endometrial cancer cells [54]. Therefore, the decrease in Mcl-1 may correlate to reduction in proliferation either through induction of senescence or through a decrease in self-renewal potential following DCA treatment in HCT116 cells. Our findings suggest that either nuclear or cytosolic Mcl-1 may play a role in DCA-induced reduction in cellular proliferation. The role of nuclear Mcl-1 in the response of cancer cells to DCA has not previously been described. Mcl-1 confers resistance to a variety of current chemotherapies including sorafenib, 5-fluorouracil, and cisplatin [17, 18], which have been shown to respond positively in combination with DCA [3, 5, 6]. However, a mechanistic role of Mcl-1 in DCA-induced sensitization to chemotherapeutics has not been recognized or investigated. It is possible that in HCT116 cells, a reduction in Mcl-1 following DCA treatment may interfere with self-renewal and resistance to senescence. Although an initial clinical trial treating glioblastoma with DCA showed some success [11], the safety and efficacy of DCA has been questioned
123
72
by another trial, leading to its early termination [55]. As the role of Mcl-1 in DCA treatment has previously not been characterized, it may be of interest to investigate the effects of this Mcl-1 reduction on off-target tissues. Mcl-1 has been shown to be a critical factor in the maintenance of stem cell self-renewal in humans, which leads to concern about the cancer-specificity of DCA [52]. DCA has been proposed to specifically inhibit the progression of tumours while leaving normal cells unaffected due to its ability to reverse the metabolic phenotype of cancer cells back to that of normal cells [1]. However, the results we present here highlight the heterogeneity of this response and suggest cell autonomous effects in the response of cancer cells to this agent. Acknowledgments This work is supported by a Natural Science and Engineering Research Council of Canada (NSERC) Discovery Grant to BLC.
Apoptosis (2015) 20:63–74
8.
9.
10.
11.
12.
References 1. Bonnet S, Archer SL, Allalunis-Turner J, Haromy A, Beaulieu C, Thompson R, Lee CT, Lopaschuk GD, Puttagunta L, Bonnet S, Harry G, Hashimoto K, Porter CJ, Andrade MA, Thebaud B, Michelakis ED (2007) A mitochondria-K? channel axis is suppressed in cancer and its normalization promotes apoptosis and inhibits cancer growth. Cancer Cell 11(1):37–51. doi:10.1016/j. ccr.2006.10.020 2. Sanchez WY, McGee SL, Connor T, Mottram B, Wilkinson A, Whitehead JP, Vuckovic S, Catley L (2013) Dichloroacetate inhibits aerobic glycolysis in multiple myeloma cells and increases sensitivity to bortezomib. Br J Cancer 108(8):1624–1633. doi:10.1038/bjc.2013.120 3. Shen YC, Ou DL, Hsu C, Lin KL, Chang CY, Lin CY, Liu SH, Cheng AL (2013) Activating oxidative phosphorylation by a pyruvate dehydrogenase kinase inhibitor overcomes sorafenib resistance of hepatocellular carcinoma. Br J Cancer 108(1):72–81. doi:10.1038/bjc.2012.559 4. Kumar K, Wigfield S, Gee HE, Devlin CM, Singleton D, Li JL, Buffa F, Huffman M, Sinn AL, Silver J, Turley H, Leek R, Harris AL, Ivan M (2013) Dichloroacetate reverses the hypoxic adaptation to bevacizumab and enhances its antitumor effects in mouse xenografts. J Mol Med 91(6):749–758. doi:10.1007/ s00109-013-0996-2 5. Xie J, Wang BS, Yu DH, Lu Q, Ma J, Qi H, Fang C, Chen HZ (2011) Dichloroacetate shifts the metabolism from glycolysis to glucose oxidation and exhibits synergistic growth inhibition with cisplatin in HeLa cells. Int J Oncol 38(2):409–417. doi:10.3892/ ijo.2010.851 6. Hur H, Xuan Y, Kim YB, Lee G, Shim W, Yun J, Ham IH, Han SU (2013) Expression of pyruvate dehydrogenase kinase-1 in gastric cancer as a potential therapeutic target. Int J Oncol 42(1):44–54. doi:10.3892/ijo.2012.1687 7. Anastasiou D, Yu Y, Israelsen WJ, Jiang JK, Boxer MB, Hong BS, Tempel W, Dimov S, Shen M, Jha A, Yang H, Mattaini KR, Metallo CM, Fiske BP, Courtney KD, Malstrom S, Khan TM, Kung C, Skoumbourdis AP, Veith H, Southall N, Walsh MJ, Brimacombe KR, Leister W, Lunt SY, Johnson ZR, Yen KE, Kunii K, Davidson SM, Christofk HR, Austin CP, Inglese J, Harris MH, Asara JM, Stephanopoulos G, Salituro FG, Jin S, Dang L, Auld DS, Park HW, Cantley LC, Thomas CJ, Vander
123
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
Heiden MG (2012) Pyruvate kinase M2 activators promote tetramer formation and suppress tumorigenesis. Nat Chem Biol 8(10):839–847. doi:10.1038/nchembio.1060 Ruckenstuhl C, Buttner S, Carmona-Gutierrez D, Eisenberg T, Kroemer G, Sigrist SJ, Frohlich KU, Madeo F (2009) The Warburg effect suppresses oxidative stress induced apoptosis in a yeast model for cancer. Plos One 4(2):e4592. doi:10.1371/jour nal.pone.0004592 Kim JW, Tchernyshyov I, Semenza GL, Dang CV (2006) HIF-1mediated expression of pyruvate dehydrogenase kinase: a metabolic switch required for cellular adaptation to hypoxia. Cell Metab 3(3):177–185. doi:10.1016/j.cmet.2006.02.002 Gatenby RA, Gawlinski ET, Gmitro AF, Kaylor B, Gillies RJ (2006) Acid-mediated tumor invasion: a multidisciplinary study. Cancer Res 66(10):5216–5223. doi:10.1158/0008-5472.can-054193 Michelakis ED, Sutendra G, Dromparis P, Webster L, Haromy A, Niven E, Maguire C, Gammer TL, Mackey JR, Fulton D, Abdulkarim B, McMurtry MS, Petruk KC (2010) Metabolic modulation of glioblastoma with dichloroacetate. Sci Transl Med 2(31):31ra34. doi:10.1126/scitranslmed.3000677 Sutendra G, Dromparis P, Kinnaird A, Stenson TH, Haromy A, Parker JM, McMurtry MS, Michelakis ED (2013) Mitochondrial activation by inhibition of PDKII suppresses HIF1a signaling and angiogenesis in cancer. Oncogene 32(13):1638–1650. doi:10. 1038/onc.2012.198 Stockwin LH, Yu SX, Borgel S, Hancock C, Wolfe TL, Phillips LR, Hollingshead MG, Newton DL (2010) Sodium dichloroacetate selectively targets cells with defects in the mitochondrial ETC. Int J Cancer 127(11):2510–2519. doi:10.1002/ijc.25499 Madhok BM, Yeluri S, Perry SL, Hughes TA, Jayne DG (2010) Dichloroacetate induces apoptosis and cell-cycle arrest in colorectal cancer cells. Br J Cancer 102(12):1746–1752. doi:10.1038/ sj.bjc.6605701 Shahrzad S, Lacombe K, Adamcic U, Minhas K, Coomber BL (2010) Sodium dichloroacetate (DCA) reduces apoptosis in colorectal tumor hypoxia. Cancer Lett 297(1):75–83. doi:10. 1016/j.canlet.2010.04.027 Youle RJ, Strasser A (2008) The BCL-2 protein family: opposing activities that mediate cell death. Nat Rev Mol Cell Biol 9(1):47–59. doi:10.1038/nrm2308 Ding Q, Huo L, Yang JY, Xia W, Wei Y, Liao Y, Chang CJ, Yang Y, Lai CC, Lee DF, Yen CJ, Chen YJ, Hsu JM, Kuo HP, Lin CY, Tsai FJ, Li LY, Tsai CH, Hung MC (2008) Downregulation of myeloid cell leukemia-1 through inhibiting Erk/Pin 1 pathway by sorafenib facilitates chemosensitization in breast cancer. Cancer Res 68(15):6109–6117. doi:10.1158/0008-5472. can-08-0579 Ding Q, He X, Hsu JM, Xia W, Chen CT, Li LY, Lee DF, Liu JC, Zhong Q, Wang X, Hung MC (2007) Degradation of Mcl-1 by beta-TrCP mediates glycogen synthase kinase 3-induced tumor suppression and chemosensitization. Mol Cell Biol 27(11):4006–4017. doi:10.1128/mcb.00620-06 Jamil S, Sobouti R, Hojabrpour P, Raj M, Kast J, Duronio V (2005) A proteolytic fragment of Mcl-1 exhibits nuclear localization and regulates cell growth by interaction with Cdk1. Biochem J 387(Pt 3):659–667. doi:10.1042/bj20041596 Jamil S, Stoica C, Hackett TL, Duronio V (2010) MCL-1 localizes to sites of DNA damage and regulates DNA damage response. Cell Cycle 9(14):2843–2855 Fujise K, Zhang D, Liu J, Yeh ET (2000) Regulation of apoptosis and cell cycle progression by MCL1. Differential role of proliferating cell nuclear antigen. J Biol Chem 275(50):39458–39465. doi:10.1074/jbc.M006626200 Harley ME, Allan LA, Sanderson HS, Clarke PR (2010) Phosphorylation of Mcl-1 by CDK1-cyclin B1 initiates its Cdc20-
Apoptosis (2015) 20:63–74
23.
24.
25. 26.
27.
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
dependent destruction during mitotic arrest. EMBO J 29(14):2407–2420. doi:10.1038/emboj.2010.112 Kobayashi S, Lee SH, Meng XW, Mott JL, Bronk SF, Werneburg NW, Craig RW, Kaufmann SH, Gores GJ (2007) Serine 64 phosphorylation enhances the antiapoptotic function of Mcl-1. J Biol Chem 282(25):18407–18417. doi:10.1074/jbc.M610010200 Edwards BK, Ward E, Kohler BA, Eheman C, Zauber AG, Anderson RN, Jemal A, Schymura MJ, Lansdorp-Vogelaar I, Seeff LC, van Ballegooijen M, Goede SL, Ries LA (2010) Annual report to the nation on the status of cancer, 1975–2006, featuring colorectal cancer trends and impact of interventions (risk factors, screening, and treatment) to reduce future rates. Cancer 116(3):544–573. doi:10.1002/cncr.24760 Vogelstein B, Lane D, Levine AJ (2000) Surfing the p53 network. Nature 408(6810):307–310. doi:10.1038/35042675 Zhang L, Yu J, Park BH, Kinzler KW, Vogelstein B (2000) Role of BAX in the apoptotic response to anticancer agents. Science 290(5493):989–992 Taylor S, Wakem M, Dijkman G, Alsarraj M, Nguyen M (2010) A practical approach to RT-qPCR-Publishing data that conform to the MIQE guidelines. Methods 50(4):S1–S5. doi:10.1016/j. ymeth.2010.01.005 Skowronski K, Dubey S, Rodenhiser D, Coomber B (2010) Ischemia dysregulates DNA methyltransferases and p16INK4a methylation in human colorectal cancer cells. Epigenetics 5(6):547–556 Yecies D, Carlson NE, Deng J, Letai A (2010) Acquired resistance to ABT-737 in lymphoma cells that up-regulate MCL-1 and BFL-1. Blood 115(16):3304–3313. doi:10.1182/blood-2009-07233304 Bi X, Lin Q, Foo TW, Joshi S, You T, Shen HM, Ong CN, Cheah PY, Eu KW, Hew CL (2006) Proteomic analysis of colorectal cancer reveals alterations in metabolic pathways: mechanism of tumorigenesis. Mol Cell Proteomics 5(6):1119–1130. doi:10. 1074/mcp.M500432-MCP200 Babu E, Ramachandran S, CoothanKandaswamy V, Elangovan S, Prasad PD, Ganapathy V, Thangaraju M (2011) Role of SLC5A8, a plasma membrane transporter and a tumor suppressor, in the antitumor activity of dichloroacetate. Oncogene 30(38):4026–4037. doi:10.1038/onc.2011.113 Matthews GM, Howarth GS, Butler RN (2012) Short-chain fatty acids induce apoptosis in colon cancer cells associated with changes to intracellular redox state and glucose metabolism. Chemotherapy 58(2):102–109. doi:10.1159/000335672 Adams KW, Cooper GM (2007) Rapid turnover of mcl-1 couples translation to cell survival and apoptosis. J Biol Chem 282(9):6192–6200. doi:10.1074/jbc.M610643200 Czabotar PE, Lee EF, van Delft MF, Day CL, Smith BJ, Huang DC, Fairlie WD, Hinds MG, Colman PM (2007) Structural insights into the degradation of Mcl-1 induced by BH3 domains. Proc Natl Acad Sci USA 104(15):6217–6222. doi:10.1073/pnas. 0701297104 Gomez-Bougie P, Menoret E, Juin P, Dousset C, Pellat-Deceunynck C, Amiot M (2011) Noxa controls Mule-dependent Mcl-1 ubiquitination through the regulation of the Mcl-1/USP9X interaction. Biochem Biophys Res Commun 413(3):460–464. doi:10.1016/j.bbrc.2011.08.118 Gomez-Bougie P, Wuilleme-Toumi S, Menoret E, Trichet V, Robillard N, Philippe M, Bataille R, Amiot M (2007) Noxa upregulation and Mcl-1 cleavage are associated to apoptosis induction by bortezomib in multiple myeloma. Cancer Res 67(11):5418–5424. doi:10.1158/0008-5472.can-06-4322 Yuan Z, Cao K, Lin C, Li L, Liu HY, Zhao XY, Liu L, Deng HX, Li J, Nie CL, Wei YQ (2011) The p53 upregulated modulator of apoptosis (PUMA) chemosensitizes intrinsically resistant ovarian cancer cells to cisplatin by lowering the threshold set by Bcl-
73
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
x(L) and Mcl-1. Mol Med 17(11–12):1262–1274. doi:10.2119/ molmed.2011.00176 Wong JY, Huggins GS, Debidda M, Munshi NC, De Vivo I (2008) Dichloroacetate induces apoptosis in endometrial cancer cells. Gynecol Oncol 109(3):394–402. doi:10.1016/j.ygyno.2008. 01.038 El Mjiyad N, Caro-Maldonado A, Ramirez-Peinado S, MunozPinedo C (2011) Sugar-free approaches to cancer cell killing. Oncogene 30(3):253–264. doi:10.1038/onc.2010.466 Lowman XH, McDonnell MA, Kosloske A, Odumade OA, Jenness C, Karim CB, Jemmerson R, Kelekar A (2010) The proapoptotic function of Noxa in human leukemia cells is regulated by the kinase Cdk5 and by glucose. Mol Cell 40(5):823–833. doi:10.1016/j.molcel.2010.11.035 Mojsa B, Lassot I, Desagher S (2014) Mcl-1 ubiquitination: unique regulation of an essential survival protein. Cells 3(2):418–437. doi:10.3390/cells3020418 Matoba S, Kang JG, Patino WD, Wragg A, Boehm M, Gavrilova O, Hurley PJ, Bunz F, Hwang PM (2006) p53 regulates mitochondrial respiration. Science 312(5780):1650–1653. doi:10. 1126/science.1126863 Boohaker R, Zhang G, Carlson A, Nemec K, Kahled A (2011) BAX supports the mitochondrial network, promoting bioenergetics in nonapoptotic cells. Am J Physiol Cell Physiol 300(6):1466–1478 Tong J, Xie G, He J, Li J, Pan F, Liang H (2011) Synergistic antitumor effect of dichloroacetate in combination with 5-fluorouracil in colorectal cancer. J Biomed Biotechnol 2011:740564. doi:10.1155/2011/740564 Gao J, Li L, Wu M, Liu M, Xie X, Guo J, Tang H, Xie X (2013) MiR-26a Inhibits Proliferation and Migration of Breast Cancer through Repression of MCL-1. Plos One 8(6):e65138. doi:10. 1371/journal.pone.0065138 Soliera AR, Mariani SA, Audia A, Lidonnici MR, Addya S, Ferrari-Amorotti G, Cattelani S, Manzotti G, Fragliasso V, Peterson L, Perini G, Holyoake TL, Calabretta B (2012) Gfi-1 inhibits proliferation and colony formation of p210BCR/ABLexpressing cells via transcriptional repression of STAT 5 and Mcl-1. Leukemia 26(7):1555–1563. doi:10.1038/leu.2012.19 Henderson-Jackson EB, Helm J, Ghayouri M, Hakam A, Nasir A, Leon M, Bui M, Yeatman T, Coppola D (2010) Correlation between Mcl-1 and pAKT protein expression in colorectal cancer. Int J Clin Exp Pathol 3(8):768–777 Fan F, Tonon G, Bashari MH, Vallet S, Antonini E, Goldschmidt H, Schulze-Bergkamen H, Opferman JT, Sattler M, Anderson KC, Jager D, Podar K (2014) Targeting Mcl-1 for multiple myeloma (MM) therapy: drug-induced generation of Mcl-1 fragment Mcl-1(128-350) triggers MM cell death via c-Jun upregulation. Cancer Lett 343(2):286–294. doi:10.1016/j.canlet. 2013.09.042 Germain M, Duronio V (2007) The N terminus of the antiapoptotic BCL-2 homologue MCL-1 regulates its localization and function. J Biol Chem 282(44):32233–32242. doi:10.1074/jbc. M706408200 Bolesta E, Pfannenstiel LW, Demelash A, Lesniewski ML, Tobin M, Schlanger SE, Nallar SC, Papadimitriou JC, Kalvakolanu DV, Gastman BR (2012) Inhibition of Mcl-1 promotes senescence in cancer cells: implications for preventing tumor growth and chemotherapy resistance. Mol Cell Biol 32(10):1879–1892. doi:10. 1128/mcb.06214-11 Singh S, Bora-Singhal N, Kroeger J, Laklai H, Chellappan SP (2013) bArrestin-1 and Mcl-1 modulate self-renewal growth of cancer stem-like side-population cells in non-small cell lung cancer. Plos One 8(2):e55982. doi:10.1371/journal.pone.0055982 Campbell CJ, Lee JB, Levadoux-Martin M, Wynder T, Xenocostas A, Leber B, Bhatia M (2010) The human stem cell
123
74 hierarchy is defined by a functional dependence on Mcl-1 for self-renewal capacity. Blood 116(9):1433–1442. doi:10.1182/ blood-2009-12-258095 53. Yeung TM, Gandhi SC, Wilding JL, Muschel R, Bodmer WF (2010) Cancer stem cells from colorectal cancer-derived cell lines. Proc Natl Acad Sci USA 107(8):3722–3727. doi:10.1073/ pnas.0915135107
123
Apoptosis (2015) 20:63–74 54. Konno Y, Dong P, Xiong Y, Suzuki F, Lu J, Cai M, Watari H, Mitamura T, Hosaka M, Hanley SJ, Kudo M, Sakuragi N (2014) MicroRNA-101 targets EZH2, MCL-1 and FOS to suppress proliferation, invasion and stem cell-like phenotype of aggressive endometrial cancer cells. Oncotarget 5(15):6049–6062
