Differential Accumulation of Phytohormones in Wheat Seedlings ...

PLANT RESISTANCE

Differential Accumulation of Phytohormones in Wheat Seedlings Attacked by Avirulent and Virulent Hessian Fly (Diptera: Cecidomyiidae) Larvae LIECENG ZHU,1 XIANG LIU,2,3

AND

MING-SHUN CHEN2,4

J. Econ. Entomol. 103(1): 178Ð185 (2010); DOI: 10.1603/EC09224

ABSTRACT We analyzed the accumulation of six phytohormones and phytohormone-related compounds in a wheat, Triticum aestivium L., genotype, ÔMollyÕ, after attacks by avirulent and virulent Hessian ßy, Mayetiola destructor (Say) (Diptera: Cecidomyiidae), larvae, respectively, and we examined the expression of genes in the jasmonic acid (JA) pathway by Northern blot analysis. Compared with uninfested plants, attacks by avirulent larvae resulted in increased accumulation of salicylic acid (SA) by 11.3- and 8.2-fold, 12-oxo-phytodienoic acid (OPDA) by 36.4-and 18.7-fold, 18:3 fatty acid by 4.5- and 2.2-fold, and 18:1 fatty acid by 1.8- and 1.9-fold at 24 and 72 h post-initial attack (hpia), respectively, but an 20% decrease in JA accumulation at 24 hpia at the attack site. Attacks by the virulent larvae did not affect the accumulation of SA, OPDA, and 18:3 and 18:1 fatty acids but dramatically increased the concentration of auxin (AUX) from undetectable in uninfested plants to 381.7 ng/g fresh weight at 24 hpia and 71.0 ng/g fresh weight at 72 hpia in infested plants. Transcript levels of genes encoding lipoxygenase 2, allene oxide synthase, and Arabidopsis storage protein 2 were increased after avirulent larval attacks but decreased after virulent larval attacks. Our results suggest that OPDA and SA may act together in wheat resistance to the Hessian ßy, whereas AUX may play a role in the susceptibility of wheat plants. The increased OPDA accumulation after avirulent larval attacks was at least partially regulated through gene transcription. KEY WORDS phytohormones, Mayetiola destructor, wheat, resistance

Plants are under constant attack from herbivores and other biotic agents. To survive and prosper under such environmental conditions, plants have evolved both direct and indirect defense strategies. Direct defenses include any plant traits that by themselves affect the susceptibility of host plants to insect attacks (Kessler and Baldwin 2002). Indirect defenses, however, include plant traits that by themselves do not affect the susceptibility of host plants but that can serve as attractants to natural enemies of the attacking insect (Chen 2008). Generally, plant defense involves three steps: surveillance (invasion detection), signal transduction, and the launch of speciÞc defenses (Kessler and Baldwin 2002, Ferry et al. 2004, Dangl and McDowell 2006). In the Þrst step, the plantÕs surveillance system detects invading signals, such as herbivoreassociated molecular patterns (Mitho¨ fer and Boland 2008). The detected signal is then transduced through a network of signal transduction pathways, which 1 Corresponding author: Department of Natural Science, Fayetteville State University, Fayetteville, NC 28301 (e-mail: [email protected]). 2 Department of Entomology, Kansas State University, Manhattan, KS 66506. 3 Department of Plant Biology, North Carolina State University, Raleigh, NC 27695. 4 Plant Science and Entomology Research Unit, USDAÐARS, Manhattan, KS 66502.

eventually lead to the synthesis of toxic or deterrent chemicals and physical structures against invading herbivores (Wan et al. 2002, Hahlbrock et al. 2003). Plants also can produce volatiles that attract natural enemies of the herbivore, resulting in the suppression of the herbivoreÕs population (De Moraes et al. 2001, Kessler and Baldwin 2001). Phytohormones, a group of chemicals that regulate plant growth and development, are involved in signal transduction in plant defense (Delaney et al. 1994, McConn et al. 1997). Of the phytohormones identiÞed so far, jasmonic acid (JA) and salicylic acid (SA) have been studied extensively (Halitschke and Baldwin 2005, Loake and Grant 2007). SA and JA can act either individually or interactively in plant responses to phytopathogens, depending on speciÞc plantÐ herbivore interactions. Generally, JA regulates plant defenses against necrotic pathogens or herbivores that injure plants mechanically (Farmer et al. 2003). JA can induce, in some species, gene expression of proteins such as lectin (Chen et al. 2002) and the Arapidopsis vegetative storage protein 2 (AtVSP2) (Taki et al. 2005) that are antibiotic to insects (Liu et al. 2005, Subramanyam et al. 2008), whereas SA regulates plant defenses against biotrophic pathogens or herbivores such as aphids that cause minimal damage to plants (Farmer et al. 2003, Glazebrook 2005, Halitschke and

0022-0493/10/0178Ð0185$04.00/0 䉷 2010 Entomological Society of America

February 2010

ZHU ET AL.: PHYTOHORMONES IN WHEAT RESISTANCE TO HESSIAN FLIES

Baldwin 2005, Loake and Grant 2007). Many studies have indicated that JA and SA act antagonistically (Takahashi et al. 2004, Loake and Grant 2007). When it reaches a certain level in plants in response to herbivore attacks, SA suppresses JA synthesis (Harms et al. 1998, Mur et al. 2006). The antagonism, however, does not occur between SA and 12-oxo-phytodienoic acid (OPDA), a precursor in the JA biosynthetic pathway. In fact, a high level of SA in plants results in up-regulation of genes in the pathway for OPDA synthesis (Laudert and Weiler 1998). OPDA can be synthesized from 18:3 fatty acid by actions of enzymes lipoxygenase 2 (LOX2), allene oxide synthase (AOS), and allene oxide cyclase (AOC) in the JA pathway (Turner et al. 2002). Both OPDA and 18:1 fatty acids play regulatory roles in plant defenses (Stintzi et al. 2001, Chandra-Shekara et al. 2007). Another important phytohormone contributing to plantÐ herbivore interaction is auxin (AUX). In contrast to the defensive roles of JA, OPDA, and SA, AUX usually suppresses plant defenses, resulting in increased pathogen virulence (Spoel and Dong 2008). The Hessian ßy, Mayetiola destructor (Say) (Diptera: Cecidomyiidae), is one of the most destructive pests of wheat, Triticum aestivium L., in North America and North Africa (Berzonsky et al. 2003). The interaction between wheat and Hessian ßy follows a typical gene-for-gene relationship (Hatchett and Gallun 1970). Each Hessian ßy biotype carries an avirulence (Avr) gene that is speciÞc to the corresponding resistance (R) gene in host plants. Attacks from an avirulent Hessian ßy larva to a plant containing the corresponding R gene invoke vigorous defense responses from the plant, resulting in the death of the attacking insect (Shukle et al. 1990). In contrast, a virulent Hessian ßy larva is able to establish a feeding site by inducing the formation of nutritive cells at the attack site (Harris et al. 2006), and complete its life cycle. Hessian ßy larvae, the only feeding stage, have piercingÐsucking mouthparts (Hatchett et al. 1990, Harris et al. 2006). Unlike chewing insects such as caterpillars that cause signiÞcant injury and loss of plant tissues, piercingÐsucking insects access plant tissues stealthily and cause minimal tissue damage (Walling 2000, Smith and Boyko 2007). For example, the phloem-feeding aphids pierce through plant tissues with their long and tiny stylets carefully moving between cells to avoid injuring cell along the way, resulting in minimum cell damage. The SA signaling pathway plays a predominant role in plant defense against phloem-feeding insects (Walling 2000, ZhuSalzman et al. 2004, Smith and Boyko 2007). Hessian ßy larvae, however, have highly modiÞed mandibles or paired teeth (Hatchett et al. 1990) that produce punctures in the outer cell wall of epidermal cells (Harris et al. 2006). Therefore, the injury in wheat cells caused by Hessian ßy larva feeding is much more substantial than that caused by phloem feeding insects. Such an interaction pattern suggests that there could be a different signaling system involved in the response of wheat seedlings to Hessian ßy larval attacks. Previously, a genome-wide analysis using microarrays in-

179

dicated that many genes related to phytohormones JA, SA, and AUX were differentially regulated between compatible and incompatible interactions (Liu et al. 2007). However, little is known about how phytohormones are accumulated in wheat plants in responses to Hessian ßy larval attacks. The purpose of the current study was to quantify the accumulation of phytohormones and phytohormone-related compounds (phytohormones hereafter) in wheat plants responding to avirulent or virulent Hessian ßy larval attacks. Materials and Methods Plants and Insects. The wheat genotype ÔMollyÕ and two Hessian ßy populations, biotypes GP and vH13, were used in this study. Molly carries the Hessian ßy R gene H13, which confers resistance to biotype GP Hessian ßies but is susceptible to biotype vH13 Hessian ßies. Hessian ßy voucher specimens (no. 150) are located in the Museum of Entomological and Prairie Arthropod Research, Kansas State University, Manhattan, KS. Twenty germinated Molly seeds were planted in each 10-cm-diameter pot Þlled with PROMIX ÔBXÕ potting mix (Hummert Inc., Earth City, MO) in a growth chamber programmed at 20:18⬚C (L:D), with a photoperiod of 14:10 (L:D) h, and plants was allowed to grow until 1.5-leaf stage (stage 11 on Zadoks scale) (Zadoks et al. 1974, Zhu et al. 2008). Hessian ßy populations were maintained on two-leafÐ stage seedlings of susceptible wheat genotype ÔKarl 92Õ in the USDA greenhouse at Kansas State University, under conditions of 27⬚C (mean day) and 20⬚C (mean night), 50 Ð70% RH, and a photoperiod of 15:9 (L:D) h. The pupae were collected from plants and stored at 4⬚C before the experiment took place. For infestation, pupae were placed at room temperature for 10 d to allow them to emerge into adults. Experimental Design. Three treatments (controls, incompatible interaction, and compatible interaction treatments) were included in the experiment. Controls were uninfested Molly seedlings, incompatible interactions were Molly seedlings infested with avirulent biotype GP Hessian ßies, whereas compatible interactions were Molly seedlings infested with virulent biotype vH13 Hessian ßies. Plants in different treatments were arranged as randomized complete block design (RCBD) in a growth chamber in the Department of Entomology at Kansas State University. Each treatment was biologically repeated Þve times for phytohormone proÞling but three times for Northern blot analysis. Each sample was collected from 20 individual plants in a pot. For Northern blot analysis, samples from three biological replicates were pooled for each treatment. The control and infested plants were allowed to grow in the same growth chamber under the same environmental conditions and caged immediately before infestation. Infestation and Sample Collection. Molly wheat seedlings were infested with either biotype GP or vH13 Hessian ßies. Twenty mated females (with ovipositor retracted) were released onto plants conÞned within a mesh screen. Controls, which were caged

180 Table 1. GenBank accession AJ611407 DR739362 DR739073

JOURNAL OF ECONOMIC ENTOMOLOGY

Vol. 103, no. 1

Probe information on genes associated with JA pathway Name of gene

Abbreviation

Function

Lipoxygenase 2 Allene oxide synthase Arabidopsis vegetative storage protein 2

LOX2 AOS AtVSP2

OPDA and JA biosynthesis OPDA and JA biosynthesis JA responsive

before infestation, were not exposed to egg-laying females. To precisely determine the time of initial larval attacks, some extra infested plants were dissected and observed hourly under dissection microscope (4⫻ magniÞcation) starting at 72 h after infestation. The time when Hessian ßy larvae were Þrst observed at the base of wheat seedlings was taken as the time for the initial larval attack. Samples from the attack (feeding) site were collected by obtaining a 10-mm-long section of the second leaf sheath where Hessian ßy larvae resided in each plant. Samples were also collected from the second leaves by cutting 40-mm sections from the tip to determine whether the Hessian ßy larval attacks at the base caused differential accumulation of phytohormones in leaves that were not attacked directly. Samples were collected in 24 h post-initial attack (hpia) and 72 hpia for phytohormone assays and collected in 24, 48, and 72 hpia for Northern blot analysis. All samples were frozen in liquid nitrogen (N2) immediately after sampling and stored at ⫺80⬚C until hormonal or RNA extraction. Verification of Compatible and Incompatible Interactions in Infested Wheat Seedlings. A separate experiment was conducted to verify incompatibility and compatibility of Molly wheat seedlings to biotype GP and biotype vH13 Hessian ßy infestations, respectively, under the same conditions as described in the previous sections. Five days after the initial attack, infested plants were examined for surviving larvae. No surviving larvae were found in Molly wheat seedlings infested with biotype GP Hessian ßies, whereas larvae in wheat seedlings infested with biotype vH13 Hessian ßies survived with increased body size and white body color. Northern Blot Analysis. Expressions of LOX2, AOS, and AtVSP2 were examined. LOX2 is the rate-limiting enzyme in JA pathway and AOS converts the hydroperoxy derivatives into OPDA (Turner et al. 2002). AtVSP2 is JA or MeJA responsive in Arabidopsis thaliana (L.) (Taki et al. 2005). The putative functions of wheat genes were deduced based on the similarity of the translated amino acid sequences between each wheat expressed sequence tag (EST) sequence and its corresponding gene in A. thaliana. The putative wheat LOX2 gene shares 43% identity to an Arabidposis LOX2 gene (NM_114383), with E ⫽ 6e⫺50. The putative wheat AOS gene shares 40% identity to an A. thaliana AOS gene (NM_123629.3), with E ⫽ 2e⫺57. The putative wheat AtVSP2 gene shares 39% identity to the AtVSP2 gene (NM_001036860), with E ⫽ 6e⫺34. Total RNA was extracted from plant tissues using TRI reagent (Molecular Research Center Inc., Cincinnati,

Primer Forward

Reverse

cagggacaagtttgcttggt gcgaccgccttgactactac ctacgtcgactccctcaagc

actgcctcctcagctgtcat tcgagtgtgtcggtcttgtc ggaacactggcttgataccg

OH), following the protocol provided by the manufacturer. Equal amounts (⬇5 ␮g) of total RNA of each sample were separated on 1.5% agarose gels containing formaldehyde and blotted onto a GeneScreen membrane (Perkin Elmer Life and Analytical Sciences, Boston, MA). The membranes were then baked at 80⬚C for 2 h. cDNA fragments were used as probes, which were obtained by polymerase chain reaction (PCR) by using speciÞc primers. The accession numbers of wheat EST sequences in GenBank, names, and putative functions of the genes as well as sequences of primers are listed in Table 1. The probes were labeled with [32P]dCTP by using the random labeling kit from Stratagene (La Jolla, CA). Hybridization, washing, and image analyses were carried out as described previously (Zhu et al. 2008). In addition, hybridization signals were quantiÞed by scanning laser densitometry with an Ultroscan XL laser densitometer and the GSXL2 software package (Pharmacia, Piscataway, NJ). Densitometry signals were read three times from X-ray Þlms for each sample. The averages of three readings were used to represent the intensity of hybridization signals. Phytohormone Profiling. Chemical ionization-gas chromatography-chemical ionization-mass spectrometry (GC-CI-MS) was used to proÞle phytohormones. The measurement was carried out in Kansas Lipidomics Center at Kansas State University following the procedure described by Schmelz et al. (2004). In brief, frozen tissue was ground in liquid nitrogen and poured into 1.5 ml of FastPrep tubes containing ⬇1 g of 1.1-mm Zirmil beads (Saint-Gobain ZirPro, Mountainside, NJ). Then, 300 ␮l of 1-propanol:H2O:HCl (2:1: 0.005, vol/vol/vol) extraction buffer and a mixture of internal standards (100 ng of each phytohorome) were added to the samples. Tissue was pulverized by a FastPrep FP 120 homogenizer (Qbiogene, Carlsbad, CA). After homogenizing for 10 s, 1 ml of dichloromethane (CH2Cl2) was added to each sample, and the samples were rehomogenized and centrifuged for 3 min at room temperature (21Ð23⬚C) at 12,000 rpm. For the derivatization, the bottom CH2Cl2:1-propanol layer was transferred to a 4-ml glass vial in which 20 ␮l of 400 mM trimethylsilyldiazomethane in CH2Cl2 was added. The samples were vortexed and incubated for 30 min at room temperature to allow for methyl ester formation. Once methyl ester formation was complete, 20 ␮l of 400 mM acetic acid in CH2Cl2 was added to quench the reagent. The samples were vortexed again and then incubated for 30 min at room temperature. Finally, a vapor phase extraction was performed to the samples. Super Q Þlters (Alltech Associates Inc.,

February 2010 Table 2. (n ⴝ 5)

181

Mean ⴞ SEM concentration of phytohormones at Hessian fly larval attack sites in wheat seedlings at 24 and 72 hpia

hpia

Phytohormone

24

SA JA OPDA 18:3 18:1 IAA SA JA OPDA 18:3 18:1 IAA

72


Mean⫾ SEM (ng/g fresh wt)a

Statistical parameter

Phytohormonefold changeb

C

R

S

df

F

P

R/C

S/C

150.4 ⫾ 10.0b 433.0 ⫾ 37.6a 102.3 ⫾ 23.2b 4,313.9 ⫾ 289.3b 1,196.4 ⫾ 141.7b 0.0 ⫾ 0.0b 125.9 ⫾ 5.9b 314.6 ⫾ 20.8a 51.6 ⫾ 9.4b 3,247.4 ⫾ 170.6b 1,304.3 ⫾ 65.0b 0.0 ⫾ 00.0b

1,693.8 ⫾ 94.0a 329.0 ⫾ 27.8b 3,723.5 ⫾ 944.1a 19,375.9 ⫾ 1543.7a 2,123.2 ⫾ 151.5a 14.2 ⫾ 8.8b 1,030.1 ⫾ 120.5a 303.1 ⫾ 20.4a 964.0 ⫾ 206.0a 7,224.1 ⫾ 1887.9a 2,422.7 ⫾ 372.9a 0.0 ⫾ 0.0b

206.4 ⫾ 29.7b 424.2 ⫾ 35.3a 56.5 ⫾ 5.8b 2,597.8 ⫾ 225.1b 846.2 ⫾ 60.7b 381.7 ⫾ 84.3a 140.8 ⫾ 7.4b 323.8 ⫾ 6.7a 52.2 ⫾ 9.2b 2,174.9 ⫾ 106.5b 662.4 ⫾ 151.1b 71.0 ⫾ 4.9a

2, 8 2, 8 2, 8 2, 8 2, 8 2, 8 2, 8 2, 8 2, 8 2, 8 2, 8 2, 8

250.9 23.3 15.1 114.3 53.1 16.5 55.6 0.9 20.1 5.9 14.1 204.9

⬍0.0001 0.0005 0.0019 ⬍0.0001 ⬍0.0001 0.0014 ⬍0.0001 0.4544 0.0008 0.0267 0.0024 ⬍0.0001

11.3 0.8 36.4 4.5 1.8 NAc 8.2 1.0 18.7 2.2 1.9 NA

1.4 1.0 0.6 0.6 0.7 NA 1.1 1.0 1.0 0.7 0.5 NA

Means within a row followed by different letters are signiÞcantly different at ␣ ⫽ 0.05. a C, uninfested control; R, plants attacked by avirulent larvae; S, plants attacked by virulent larvae. b R/C, mean concentration in plants attacked by avirulent larvae/mean concentration in uninfested control; S/R, mean concentration in plants attacked by virulent larvae/mean concentration in uninfested control. c NA, not applicable because IAA concentration in uninfested control plants is zero.

DeerÞeld, IL) were used to collect the phytohormones. The Super Q Þlter was placed in the high temperature septum of the vial. A needle supplying a stream of nitrogen gas was inserted into the septum and a vacuum line was connected to the Super Q Þlter. The vial was placed in a 70⬚C heating block until the solvent evaporated. The dry vial was then transferred to a heating block at 200⬚C for 2 min. These elevated temperatures are required to aid in the recovery of less volatile compounds. The Super Q Þlters were eluted into inserts of GC vials with 150 ␮l of CH2Cl2 and analyzed by GC-MS (Agilent Technologies, Wilmington, DE). GC-MS analysis of the derivatized extracts was performed on an Agilent model 6890N GC coupled to an Agilent model 5975 quadrupole mass selective detector. Separation was achieved on a DB1MS fused silica capillary column. One microliter of each sample was injected in a splitless mode with an Agilent 7683B series autosampler. The mass spectrometer was operated in the CI mode, with methane as the ionization gas. The phytohormones and fatty acids, as well as their corresponding internal standards, were monitored using a selective ion for each analyte (selective ion monitoring mode) as follows: SA (153), JA (225), IAA (190), 18:3 fatty acid (293), 18:1 fatty acid (297), 19:0 fatty acid (313), OPDA (307), H6-SA (157), dhJA (227), and H5-IAA (195). QuantiÞcations of 18:1, 18:3 fatty acids and OPDA were based on 19:0 fatty acid. Data were acquired and processed with Agilent Chemstation software (Agilent Technologies, Santa Clara, CA). Data Analysis. Data from phytohormone proÞling were analyzed by using PROC GLM (SAS Institute 1999), and the means were separated using the least signiÞcant difference (LSD) test (␣ ⫽ 0.05). Mean concentrations of phytohormones were compared among control, incompatible interaction and compatible interaction at 24 and 72 hpia, respectively.

Results Accumulation of Phytohormones at the Larval Attack Site. Attacks from Hessian ßy larvae signiÞcantly altered accumulation of phytohormones in Molly wheat plants. At 24 hpia, there were signiÞcant differences (P ⱕ 0.0019) in the accumulation of all six phytorhormones among three treatments (Table 2). At 72 hpia, concentrations of all phytohormons except JA were signiÞcantly different (P ⱕ 0.0267). The changes in the accumulation of phytohormones caused by aviruent and virulent larvae are distinctively different. SpeciÞcally, attacks from avirulent larvae resulted in signiÞcantly increased accumulation of SA, OPDA and 18:3 and 18:1 fatty acids; decreased accumulation of JA; but did not signiÞcantly alter the accumulation of IAA (Table 2), the most active form of AUX. In contrast, attacks from virulent larvae resulted in signiÞcantly increased accumulation of IAA but did not signiÞcantly affect accumulation of SA, OPDA, and 18:3 and 18:1 fatty acids, as well as JA (Table 2). Changes in accumulation of phytohormones caused by Hessian ßy larval attacks were more dramatic for OPDA and SA than for JA and 18:3 and 18:1 fatty acids. More signiÞcant changes were observed at 24 hpia than at 72 hpia. As Table 2 demonstrated, attacks from avirulent larvae signiÞcantly elevated accumulation of OPDA by 36.4-fold, SA by 11.3-fold, and 18:3 fatty acid by 4.5-fold at 24 hpia. The increases were reduced to 18.7-fold for OPDA, 8.2-fold for SA, and 2.2-fold for 18:3 fatty acid at 72 hpia. Meanwhile, JA accumulation was reduced by 20% at 24 hpia but remained unchanged at 72 hpia. Similarly, attacks from virulent larvae signiÞcantly increased the concentration of IAA from undetectable in uninfested plants to 381.7 ng/g fresh weight at 24 hpia but to 71.0 ng/g fresh weight at 72 hpia. However, the increased accumulation of 18:1 fatty acid caused by avirulent larval attacks remained similar at both time points (approximately two-fold) (Table 2).

182


Vol. 103, no. 1

virulent larval attacks on the levels of LOX2 and AOS transcripts was opposite, causing a two- to three-fold decrease in the level of LOX2 transcripts and a fourto 10-fold decrease in the level of AOS transcripts. For AtVSP2, avirulent larval attacks resulted in a three-fold increase in the level of transcripts initially, followed by a decline to an undetectable level. Virulent larval attacks, however, resulted in undetectable transcripts at all time points. Discussion

Fig. 1. Mean concentrations (nanograms per gram fresh weight) of JA in the second leaf of Molly seedlings at 24 and 72 hpia. White bars represent uninfested control, black bars represent plants attacked by avirulent larvae; gray bars represent plants attacked by virulent larvae. Comparison was made among treatments at 24 and 72 hpia, respectively.

Accumulation of Phytohormones in the Second Leaf. Attacks from Hessian ßy larvae did not signiÞcantly affect accumulation of all phytohormones except JA in the second leaf. There was a 44% increase (P ⫽ 0.0428) in JA accumulation in the second leaf after virulent larval attacks at 24 hpia (Fig. 1). However, no statistically signiÞcant difference was detected in the accumulation of JA at 72 hpia (P ⫽ 0.0936) (Fig. 1). Expression of Genes Associated with JA Pathway. Genes coding for LOX2, AOS, and AtVSP2 were constitutively expressed in uninfested plants (Fig. 2), and levels of corresponding transcripts were considerably altered after attacks from both biotypes (Fig. 2). The transcript levels of LOX2 and AOS were increased by avirulent larvae but decreased by virulent larvae. Based on densitometry estimation, attacks from avirulent larvae caused two to three-fold increase in the level of LOX2 transcripts and a four- to Þve-fold increase in the level of AOS transcripts. The effect of

Fig. 2. Accumulation of wheat LOX2, AOS, and AtVSP2 mRNAs at the attack site of Molly seedlings in response to Hessian ßy larval attacks on 24, 48, and 72 hpia. C, uninfested control; R, plants attacked by avirulent larvae; S, plants attacked by virulent larvae.

SA and JA Pathways and Wheat Resistance to Hessian Flies. Although generic evidences for antagonism of SA and JA signaling pathways have been well documented (Glazebrook 2005), emerging data suggest that a synergistic interaction exist between SA and JA pathways because some of SA- and JA-responsive genes are simultaneously induced by infestation of certain herbivores (Zhu-Salzman et al. 2004, Liu et al. 2007). Such Þndings revealed the complexity of the interaction between SA and JA pathways. Our current studies demonstrated that attacks from avirulent larvae resulted in dramatic increases in SA and OPDA accumulation at the attack site in wheat plants (Table 2). Because attacks by avirulent larvae invoke incompatible reactions in wheat plants, the dramatic increase in SA and OPDA suggests that both SA and OPDA might have been involved in wheat resistance to Hessian ßy infestation. OPDA is a precursor for JA synthesis, the simultaneously increased SA and OPDA accumulation caused by avirulent larvae also suggests a possible coordinated interaction between SA and JA pathways in regulating wheat resistance to Hessian ßy. Interestingly, JA level was slightly but signiÞcantly reduced by attacks from avirulent larvae, which is in agreement with the previous study that a high SA concentration inhibits endogenous production of JA (Mur et al. 2006). The reduction of JA suggests that JA does not play a critical role in wheat resistance to Hessian ßies under the current experimental conditions. Given the Þnding that A. thaliana opr3 mutant defective in JA synthesis but with highly accumulated OPDA expressed strong resistance against dipteran Bradysia impatiens (Johannsen) (Stintzi et al. 2001), our results suggest that OPDA may regulate wheat resistance to Hessian ßies and that OPDA and SA may act together. The differential changes in phytohormone accumulation after Hessian ßy larval attacks occurred only at the attack site for most of the phytohormones we measured, indicating that the effect of Hessian ßy larval attacks is largely localized. Our study also showed a signiÞcant increase in the transcripts of JA- and OPDA-related genes after avirulent larval attacks and decrease after virulent larval attacks (Fig. 2). The increase in the mRNA transcripts of OPDA synthesis genes, LOX2 and AOS, together with the increased accumulation of 18:3 fatty acid, the necessary precursors for OPDA synthesis, demonstrated the increased biosynthesis of OPDA and sug-

February 2010


gests that the dramatically increased OPDA accumulation after avirulent larval attacks is at least partly regulated through gene transcription. AtVSP2 is a classical marker for JA and responds speciÞcally to JA or MeJA but not to OPDA in A. thaliana (Taki et al. 2005). In our current study, the enhanced OPDA accumulation paralleled with the enhanced gene expression of wheat AtVSP2 gene, suggesting that OPDA is capable of regulating AtVSP2 gene expression in wheat plants. Providing that AtVSP2 has insecticidal activities (Liu et al. 2005), the dramatic increase of its transcripts after avirulent larval attacks but decrease after virulent larval attacks in the early stage of wheatÐHessian ßy interaction (Fig. 2) suggests that AtVSP2 is an important component of antibiotic resistance in wheat plants against Hessian ßies. The antibiotic role of AtVSP2 gene products can be further supported by our Þnding that the expression of the AtVSP2-like gene diminished in plants attacked by avirulent larvae at 72-hpia, the time when the majority of avirulent larvae were killed by plant resistance, and the expression of AtVSP2 gene is no longer essential for plant defenses. Similar expression pattern was found in HRF-1, a pectin-like gene that apparently contributes to wheatÕs antibiotic resistance to Hessian ßy (Williams et al. 2002, Subramanyam et al. 2008). Both JA and OPDA trigger the expression of lectin gene in tobacco plants (Vandenborre et al. 2009); however, the reduced JA accumulation but increased OPDA accumulation by the avirulent larvae at the attack site in the current study seemed to suggest that the wheat HFR-1 lectin like gene may be regulated by OPDA. The 18:1 fatty acid was critical for the regulation of SA- and JA-mediated defense signaling in plants (Kachroo et al. 2005). An A. thaliana ssi2 mutation resulted in reduced accumulation of 18:1 fatty acid and conferred constitutive SA-dependent PR gene expression (Kachroo et al. 2001, Shah et al., 2001) but was unable to induce JA-responsive gene PDF1.2 (Kachroo et al. 2001, 2003). In our study, the increased accumulation of 18:1 fatty acid synchronized with the increased accumulation of SA and OPDA, suggesting that 18:1 fatty acid may be involved in wheat resistance to Hessian ßies. Further study is needed to determine the speciÞc function of 18:1 fatty acid in wheatÐHessian ßy interaction. Auxin and Plant Susceptibility. Many studies have indicated that AUX is involved in promoting pathogenesis or pathogen virulence (Glickmann et al. 1998, OÕDonnell et al. 2003). Certain pathogens even synthesize AUX-like molecules. Loss of the ability to synthesize AUX-like molecules rendered these pathogens less virulent (Robert-Seilaniantz et al. 2007). Furthermore, the gall-inducing pathogen Agrobacterium tumefaciens is able to use AUX and other plant hormones to induce abnormal cell growth and division, which leads to the formation of galls that provides the bacterium with a carbon and nitrogen sources (Spoel and Dong 2008). Virulent Hessian ßy larvae are able to induce the formation of nutritive tissue in the attack site of plants (Harris et al. 2006), where carboncontaining metabolites are converted into nitrogen-

183

containing metabolites such as amino acids (Zhu et al. 2008). Avirulent larvae are unable to induce nutritive tissues at attack site and are largely denied of nutrient (Harris et al. 2006). Our results demonstrated the dramatic increase of AUX accumulation after virulent larval attacks (Table 2), which suggest that AUX may be important for the success of virulent larvae to establish feeding. Although AUX accumulation was dramatically increased by virulent larval attacks, SA and OPDA accumulation remained unchanged. Conversely, in plants attacked by avirulent larvae, SA and OPDA accumulation increased dramatically but AUX accumulation remained unchanged (Table 2). Such results seemed to suggest that AUX acts differently from SA and OPDA in wheat-Hessian ßy interaction. Acknowledgments We thank the Kansas Lipidomics Center at Kansas State University for proÞling phytohormones and providing written measurement procedures. This research was supported by grant P20 MD001089 from the Department of Health and Human Services, National Institutes of Health, National Center on Minority Health and Health Disparities.

References Cited Berzonsky, W. A., H. Ding, S. D. Haley, M. O. Harris, R. J. Lamb, R.I.H. McKenzie, H. W. Ohm, F. L. Patterson, F. B. Peairs, D. R. Porter, et al. 2003. Breeding wheat for resistance to insects. Plant Breed. Rev. 22: 221Ð296. Chandra-Shekara, A. C., S. C. Venugopa, S. R. Barman, A. Kachroo, and P. Kachroo. 2007. Plastidial fatty acid levels regulate resistance gene-dependent defense signaling in Arabidopsis. Proc. Natl. Acad. Sci. U.S.A. 104: 7277Ð 7282. Chen, M. S. 2008. Inducible direct plant defense against insect herbivores: a review. Insect Sci. 15: 101Ð114. Chen, Y., W. J. Peumans, B. Hause, J. Bras, M. Kumar, P. Proost, A. Barre, P. Rouge´, and J. M. Van Damme. 2002. Jasmonic acid methyl ester induces the synthesis of a cytoplasmic/nuclear chitooligosaccharide-binding lectin in tobacco leaves. FASEB J. 16: 905Ð907. Dangl, J. L., and J. M. McDowell. 2006. Two modes of pathogen recognition by plants. Proc. Natl. Acad. Sci. U.S.A. 103: 8575Ð 8576. De Moraes, C. M., M. C. Mescher, and J. H. Tumlinson. 2001. Caterpillar-induced nocturnal plant volatiles repel conspeciÞc females. Nature 410: 577Ð580. Delaney, T. P., S. Uknes, B. Vernooij, L. Friedrich, K. Weymann, D. Negrotto, T. Gaffney, M. Gut-Rella, H. Kessmann, E. Ward, et al. 1994. A central role of salicylic acid in plant disease resistance. Science (Wash., D.C.) 266: 1247Ð1250. Farmer, E., E. Alme´ras, and V. Krishnamurthy. 2003. Jasmonates and related oxylipins in plant responses to pathogenesis and herbivory. Curr. Opin. Plant Biol. 6: 372Ð378. Ferry, N., M. G. Edwards, J. A. Gatehouse, and A.M.R. Gatehouse. 2004. Plant-insect interactions: molecular approaches to insect resistance. Curr. Opin. Biotechnol. 15: 155Ð161. Glazebrook, J. 2005. Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens. Annu. Rev. Phytopathol. 43: 205Ð227.

184


Glickmann, E., L. Gardan, S. Jacquet, S. Hussain, M. Elasri, A. Petit, and Y. Dessaux. 1998. Auxin production is a common feature of most pathovars of Pseudomonas syringae. Mol. Plant Microbe Interact. 11: 156 Ð162. Hahlbrock, K., P. Bednarek, I. Ciolkowski, B. Hamberger, A. Heise, H. Liedgens, E. Logemann, T. Nu¨ rnberger, E. Schmelzer, I. E. Somssich, et al. 2003. Non-self recognition, transcriptional reprogramming, and secondary metabolite accumulation during plant/pathogen interactions. Proc. Natl. Acad. Sci. U.S.A. 100: 14569 Ð14576. Halitschke, R., and I. T. Baldwin. 2005. Jasmonates and related compounds in plant-insect interactions. J. Plant Growth Regul. 23: 238 Ð245. Harms, K., I. Ramirez, and H. Pen˜ a-Cortes. 1998. Inhibition of wound-induced accumulation of allene oxide synthase transcripts in ßax leaves by aspirin and salicylic acid. Plant Physiol. 118: 1057Ð1065. Harris, M. O., T. P. Freeman, O. Rohfritsch, K. G. Anderson, S. A. Payne, and J. A. Moore. 2006. Virulent Hessian ßy (Diptera: Cecidomyiidae) larvae induce a nutritive tissue during compatible interactions with wheat. Ann. Entomol. Soc. Am. 99: 305Ð316. Hatchett, J. H., and R. L. Gallun. 1970. Genetics of the ability of the Hessian ßy, Mayetiola destructor, to survive on wheat having different genes for resistance. Ann. Entomol. Soc. Am. 63: 1400 Ð1407. Hatchett, J. H., G. L. Kreitner, and R. J. Elzinga. 1990. Larval mouthparts and feeding mechanism of the Hessian ßy (Diptera: Cecidomyiidae). Ann. Entomol. Soc. Am. 83: 1137Ð1147. Kachroo, A., L. Lapchyk, H. Fukushigae, D. Hildebrand, D. F. Klessig, and P. Kachroo. 2003. Plastidial fatty acid signaling modulates salicylic acid- and jasmonic acidmediated defense pathways in the Arabidopsis ssi2 mutant. Plant Cell 15: 2952Ð2965. Kachroo, P., J. Shanklin, J. Shah, E. J. Whittle, and D. F. Klessig. 2001. A fatty acid desaturase modulates the activation of defense signaling pathways in plants. Proc. Natl. Acad. Sci. U.S.A. 98: 9448 Ð9453. Kachroo, P., S. C. Venugopal, D. A. Navarre, L. Lapchyk, and A. Kachroo. 2005. Role of salicylic acid and fatty acid desaturation pathways in ssi2-mediated signaling. Plant Physiol. 139: 1717Ð1735. Kessler, A., and I. T. Baldwin. 2001. Defensive function of herbivore-induced plant volatile emissions in nature. Science (Wash., D.C.) 291: 2141Ð2144. Kessler, A., and I. T. Baldwin. 2002. Plant responses to insect herbivory. Annu. Rev. Plant Biol. 53: 299 Ð328. Laudert, D., and E. W. Weiler. 1998. Allene oxide synthase: a major control point in Arabidopsis thaliana octadecanoid signaling. Plant J. 15: 675Ð 684. Liu, X. M., J. Bai, L. Huang, L. Zhu, X. Liu, N. Weng, J. Reese, M. Harris, J. Stuart, and M. Chen. 2007. Gene expression of different wheat genotypes during attack by virulent and avirulent Hessian ßy (Mayetiola destructor) larvae. J. Chem. Ecol. 33: 2171Ð2194. Liu, Y., J. Ahn, S. Datta, R. A. Salzman, J. Moon, B. HuyghuesDespointes, B. Pittendrigh, L. L. Murdock, H. Koiwa, and K. Zhu-Salzman. 2005. Arabidopsis vegetative storage protein is an anti-insect acid phosphatase. Plant Physiol. 139: 1545Ð1556. Loake, G., and M. Grant. 2007. Salicylic acid in plant defense-the players and protagonists. Curr. Opin. Plant Biol. 10: 466 Ð 472. McConn, M., R. A. Creelman, E. Bell, J. E. Mullet, and J. Browse. 1997. Jasmonate is essential for insect defense in Arabidopsis. Proc. Natl. Acad. Sci. U.S.A. 94: 5473Ð5477.

Vol. 103, no. 1

Mitho¨ fer, A., and W. Boland. 2008. Recognition of herbivory-associated molecular patterns. Plant Physiol. 146: 825Ð 831. Mur, L. A., P. Kenton, R. Atzorn, O. Miersch, and C. Wasternack. 2006. The outcomes of concentration-speciÞc interactions between salicylate and jasmonate signaling include synergy, antagonism, and oxidative stress leading to cell death. Plant Physiol. 140: 249 Ð262. O’Donnell, P. J., E. A. Schmelz, P. Moussatche, S. T. Lund, J. B. Jones, and H. J. Klee. 2003. Susceptible to intolerance-a range of hormonal actions in a susceptible Arabidopsis pathogen response. Plant J. 33: 245Ð257. Robert-Seilaniantz, A., L. Navarro, R. Bari, and J. D. Jones. 2007. Pathological hormone imbalances. Curr. Opin. Plant Biol. 10: 372Ð379. SAS Institute. 1999. SAS/STAT userÕs guide, version 6. SAS Institute, Cary, NC. Schmelz, E. A., J. Engelberth, J. H. Tumlinson, A. Block, and H. T. Alborn. 2004. The use of vapor phase extraction in metabolic proÞling of phytohormones and other metabolites. Plant J. 39: 790 Ð 808. Shah, J., P. Kachroo, A. Nandi, and D. F. Klessig. 2001. A recessive mutation in the Arabidopsis SSI2 gene confers SA- and NPR1-independent expression of PR genes and resistance against bacterial and oomycete pathogens. Plant J. 25: 563Ð574. Shukle, R. H., P. B. Grover, and J. E. Foster. 1990. Feeding of Hessian ßy (Diptera: Cecidomyiidae) larvae on resistant and susceptible wheat. Environ. Entomol. 19: 494 Ð 500. Smith, C. M., and E. V. Boyko. 2007. The molecular bases of plant resistance and defense responses to aphid feeding: current status. Entomol. Exp. Appl. 122: 1Ð16. Spoel, S. H., and X. Dong. 2008. Making sense of hormone crosstalk during plant immune responses. Cell Host Microbe 3: 348 Ð351. Stintzi, A., H. Weber, P. Remond, J. Brows, and E. E. Farmer. 2001. Plant defense in the absence of jasmonic acid: the role of cyclopetenones. Proc. Natl. Acad. Sci. U.S.A. 98: 12837Ð12842. Subramanyam, S., D. F. Smith, J. C. Clemens, M. A. Webb, N. Sardesai, and C. E. Williams. 2008. Functional characterization of HFR1, a high mannose N-glycan-speciÞc wheat lectin induced by Hessian ßy larvae. Plant Physiol. 147: 1412Ð1426. Takahashi, H., Y. Kanayama, M. S. Zheng, T. Kusano, S. Hase, M. Ikegami, and J. Shah. 2004. Antagonistic interactions between the SA and JA signaling pathways in Arabidopsis modulate expression of defense genes and gene-for-gene resistance to Cucumber Mosaic Virus. Plant Cell Physiol. 45: 803Ð 809. Taki, N., Y. Sasaki-Sekimoto, T. Obayashi, A. Kikuta, K. Kobayashi, T. Ainai, K. Yagi, N. Sakurai, H. Suzuki, T. Masuda, et al. 2005. 12-oxo-phytodienoic acid triggers expression of a distinct set of genes and plays a role in woundinduced gene expression in Arabidopsis. Plant Physiol. 139: 1268 Ð1283. Turner, J. G., C. Ellis, and A. Devoto. 2002. The jasmonate signal pathway. Plant Cell 14: S153ÐS164. Vandenborre, G., O. Miersch, B. Hause, G. Smagghe, C. Wasternack, and E.J.M. Van Damme. 2009. Spodoptera littoralis-induced lectin expression in tobacco. Plant Cell Physiol. 50: 1142Ð1155. Walling, L. L. 2000. The myriad plant responses to herbivores. J. Plant Growth Reg. 19: 195Ð216. Wan, J., F. M. Duning, and A. F. Bent. 2002. Probing plantpathogen interactions and downstream defense signaling

February 2010


using DNA microarrays. Funct. Integr. Genomics 2: 259 Ð 273. Williams, C. E., C. C. Collier, J. A. Nemacheck, C. Liang, and S. E. Cambron. 2002. A lectin-like wheat gene responds systemically to attempted feeding by avirulent Þrst-instar Hessian ßy larvae. J. Chem. Ecol. 28: 1411Ð1428. Zadoks, J. C., T. T. Chang, and C. F. Konzak. 1974. A decimal code for growth stages of cereals. Weed Res. 14: 415Ð 421. Zhu, L., X. M. Liu, X. Liu, R. Jeannotte, J. C. Reese, R. Welti, M. Harris, J. J. Stuart, and M. S. Chen. 2008. Hessian ßy

185

(Mayetiola destructor) attack causes dramatic shift in carbon/nitrogen metabolism in wheat. Mol. Plant Microbe Interact. 21: 70 Ð78. Zhu-Salzman, K., R. A. Salzman, J. Ahn, and H. Koiwa. 2004. Transcriptional regulation of sorghum defense determinants against a phloem-feeding aphid. Plant Physiol. 134: 420 Ð 431. Received 9 July 2009; accepted 26 October 2009.