Differential display polymerase chain reaction reveals ... - Nature

The Pharmacogenomics Journal (2004) 4, 379–387 & 2004 Nature Publishing Group All rights reserved 1470-269X/04 $30.00 www.nature.com/tpj

ORIGINAL ARTICLE

Differential display polymerase chain reaction reveals increased expression of striatal rat glia-derived nexin following chronic clozapine treatment VZ Chong1 W Costain1 J Marriott1 S Sindwani1 DJ Knauer2 J-F Wang3 LT Young3 D MacCrimmon1 RK Mishra1 1 Department of Psychiatry and Behavioural Neurosciences, McMaster University, Hamilton, ON, Canada; 2Department of Developmental and Cell Biology, School of Biological Sciences, University of California, Irvine, CA, USA; 3Centre for Addiction and Mental Health (Clarke Site), Toronto, ON, Canada

Correspondence: Dr RK Mishra, Department of Psychiatry and Behavioural Neurosciences, McMaster University, 1200 Main St. West, HSC 4N78, Hamilton, ON, Canada L8N 3Z5. Tel: þ 1 905 525 9140 Ext 22396 Fax: þ 1 905 522 8804 E-mail: [email protected]

Received: 07 October 2003 Revised: 26 April 2004 Accepted: 28 June 2004 Published online 7 September 2004

ABSTRACT

Clozapine is considered a prototype of the ‘so-called’ atypical antipsychotic drug class. It has affinity for a broad range of receptors and, in comparison to typical antipsychotic drugs, produces less extrapyramidal side effects. However, its mechanism of action remains unclear. Differential display polymerase chain reaction (ddPCR) was implemented in this study to contribute to the current understanding of this mechanism at the genetic level and to identify novel genes regulated by clozapine. This technique generated approximately 2400 gene sequences that were analyzed for differential gene expression following protracted clozapine treatment. One of these sequences, originally termed Clozapine Regulated Gene (CRG), was shown to be significantly upregulated following the treatment. Northern hybridization confirmation of this finding revealed that chronic clozapine administration caused a five-fold increase in CRG mRNA. Elongation of the 50 - and 30 -ends of CRG indicated that the fragment was in fact rat gliaderived nexin mRNA. Western blotting demonstrated that levels of the mRNA’s associated protein also increased comparably (three-fold) following chronic treatment with the antipsychotic drug. This study presents a possible neuroprotective role of nexin in clozapine treatment, particularly in the prevention of neuronal proteolytic degradation, since nexin has been shown to be a protease inhibitor. The Pharmacogenomics Journal (2004) 4, 379–387. doi:10.1038/sj.tpj.6500274 Published online 7 September 2004 Keywords: clozapine; striatum; schizophrenia; extrapyramidal side effects; serine protease nexin-1; protease inhibitor

INTRODUCTION Schizophrenia is a debilitating psychiatric disorder that has primarily been treated with dopamine (DA)-D2 receptor antagonists, such as haloperidol.1 These pharmacological agents, deemed ‘typical’, are relatively successful at reducing the disease’s psychotic or positive symptoms (ie hallucinations, delusions, disorganized speech and disorganized behavior), but are often insufficient at treating its negative symptoms (ie alogia, affective blunting, avolition, anhedonia and attention impairment).2 Typical antipsychotic drug treatment can also result in extrapyramidal side effects, including tardive dyskinesia, which is

Clozapine upregulates striatal nexin VZ Chong et al

380

characterized by abnormal involuntary movements and is associated with DA-D2 receptor blockage.3 In contrast, atypical antipsychotic compounds have been shown to reduce both groups of schizophrenic symptoms, while causing less extrapyramidal side effects.4 Therefore, a better understanding of their mechanism of action may shed light on more optimal pharmacological therapies. Several theories surrounding the distinguishing features of atypical antipsychotic agents have been proposed. Unlike the typical neuroleptic class that mainly acts at DA-D2 receptors, atypical antipsychotic compounds, such as clozapine, bind DA (D1–D5), serotonin (5HT1A, 5HT2A, 5HT2C, 5HT3, 5HT6, 5HT7), a1-adrenergic, muscarinic cholinergic (M1–M5) and histamine (H1, H3) receptors.5 Studies have postulated that the therapeutic effects of atypical antipsychotic drugs are attributed to an ability to bind a broad range and combination of these receptors in several brain regions.6 Another more recent hypothesis suggests that the action of these compounds lies in their rapid dissociation from the DA-D2 receptor, allowing them treat the psychotic symptoms of schizophrenia with few extrapyramidal side effects.7 Unfortunately, a generally accepted atypical antipsychotic functional definition has yet to be established. Recent investigations have directed attention towards genetic implications of drug therapy, particularly with respect to schizophrenic treatment. Such studies can provide insight into the mechanistic action of pharmacological agents along with the genetic aspects of diseases they treat. Differential display polymerase chain reaction (ddPCR) is an established scientific tool that can profile the expression of several genes by generating differentially expressed genetic products from mRNA using a combination of primers, reverse transcription and the polymerase chain reaction.8 This procedure allowed researchers to establish relationships between schizophrenic drug treatment and gene expression, including the association between neuroleptic therapy and the regulation of novel gene fragments.9 The present study employed this technique to analyze gene expression in the rat striatum following chronic clozapine administration and contribute to the current understanding of atypical antipsychotic drug action at the genetic level. Clozapine has been chosen for investigation because it was the first antipsychotic agent defined as atypical10 and remains a benchmark for more recent compounds of this category.11 Identification of clozapine-mediated genes and establishing their database can increase our comprehension of the molecular and cellular events associated with the administration of atypical antipsychotic drugs. The striatum has been selected for research because of its implications in extrapyramidal side effects of antipsychotic treatment.12 Since these adverse consequences are least observed following atypical antipsychotic drug treatment,4 this study can provide insight into clozapine-regulated genes that function in reducing these side effects. Using ddPCR, we discovered several gene sequences in the rat brain striatum, which were differentially regulated by chronic clozapine treatment. One of these sequences, initially termed clozapine regulated gene (CRG), was significantly upregulated following the

The Pharmacogenomics Journal

treatment and was found to be 100% homologous to rat glia-derived nexin (RGDN) or rat protease nexin 1. Northern blot confirmation of this finding revealed that striatal levels of RGDN mRNA increased approximately five-fold, while immunoblot analysis showed a three-fold increase in RGDN protein in the rat striatum following repeated clozapine exposure. The implications of these results with respect to the advantages of atypical antipsychotic drug treatment will be discussed. MATERIALS AND METHODS Animal Treatment Male Sprague–Dawley rats (Charles River Canada, St. Constant, QC, Canada) were used in this study and handled according to the CCAC guidelines for animal handling. For the ddPCR experiment, nine rats (350–450 g) were divided equally into three groups: haloperidol (n ¼ 3), clozapine (n ¼ 3) and control (n ¼ 3). For the Northern hybridization and immunoblot experiments, 40 rats (350–450 g) were divided equally into four groups: haloperidol (n ¼ 10), clozapine (n ¼ 10) and their respective control groups (n ¼ 10; n ¼ 10). The haloperidol groups received 2 mg/kg of haloperidol (Sigma-Aldrich, Oakville, ON, Canada), the clozapine groups received 30 mg/kg of clozapine (Novartis Pharmaceuticals Canada, Dorval, PQ, Canada) and control groups received sterile saline vehicle at equivalent volume per weight amounts. Rats were administered their respective treatment intraperitoneally between 1000 and 1100 h daily for 28 days. On the last day of treatment, animals were anesthetized with methoxyfluorane and killed by decapitation. Their brains were then removed and placed on ice for dissection of striatal tissues. Dissected tissues were immediately frozen and stored at 801C until further use. RNA Isolation Total RNA was isolated from brain tissues using TRIZOL according to the protocol described by the reagent’s manufacturer (Invitrogen-Life Technologies, Burlington, ON, Canada). RNA quantity and purity were determined by measuring OD260 and calculating OD260/OD280 ratios, respectively. RNA integrity was assessed by running samples on an ethidium bromide-stained 1.2% agarose gel and inspecting the resolution and relative intensities of the 18S and 28S bands on the gel. The Oligotex mRNA Mini Kit (Qiagen, Mississauga, ON, Canada) was used to isolated Poly A þ mRNA from total RNA. Differential Display Polymerase Chain Reaction (ddPCR) ddPCR was conducted using the RNAimage Kit (GenHunter, Nashville, TN, USA) following the manuafacturer’s protocol. For each experimental rat group, 1 mg of DNase I-treated striatal total RNA of each rat was reverse transcribed for a total of three reactions per group. Reactions were performed in 20 ml, including 2 ml of the DNase I-treated RNA of interest and one of three oligo dT anchored primers provided in the kit. Subsequently, eight PCR reactions were conducted on each rat’s synthesized cDNA using eight arbitrary primers in


381

combination with one of the three oligo dT primers for a total of 24 PCR reactions per experimental group. ddPCR products were separated through electrophoresis on a 6% polyacrylamide sequencing gel (6% 19 : 1 acrylamide/bis-acrylamide prepared in a buffer containing 89.1 mM Tris, pH 8.3, 88.9 mM boric acid, 2.5 mM EDTA, 7 M urea, 0.08% TEMED and 0.02% ammonium persulfate), which was then dried on gel blotting paper using a BioRad gel slab dryer (BioRad, Mississauga, ON, Canada). Following drying, the gel was exposed to Kodak X-Omat AR film (Eastman Kodak Company, Rochester, NY, USA) for 24–72 h at room temperature (B251C). The resulting optical density signals were quantified using NIH Image computer software (http://rsb.info.nih.gov/nih-image/Default.html; National Institutes of Health, Bethesda, MD, USA), as done in previous studies.13 Differentially expressed bands were excised from the gel and their corresponding ddPCR fragments were recovered through gel solubilization and precipitation. Fragments were then reamplified using the same primers that were used to generate the fragments and the resulting products were separated on a 1.7% agarose gel. Product sizes observed on the gel were compared to those seen in the acrylamide separation. The reamplified ddPCR fragments were ligated directly into the PCR-TRAP vector using the PCR-TRAP Kit (GenHunter, Nashville, TN, USA), as recommended by the RNAimage Kit. Following this reaction, the vector was used to transform competent GH cells, which were subsequently plated onto agar plates containing 20 mg/ml tetracycline. The agar plates were incubated overnight at 371C and then stored at 41C. In all, 10 colonies from each cloning were chosen for plasmid isolation. Overnight cultures (5 ml LB medium þ 10 mg/ml tetracycline) were made from each colony chosen. Plasmid DNA was isolated by Miniprep from four to six replicates, and was subsequently sequenced at MOBIX (McMaster University, Hamilton, ON, Canada). The determined sequences were compared with GenBank sequences using BLAST analysis (http://www.ncbi.nlm.nih. gov/blast/; National Center for Biotechnology Information, Bethesda, MD, USA) to establish DNA identities and homology profiles.

Rapid Amplification of cDNA Ends Polymerase Chain Reaction (RACE-PCR) Full-length elongation of the novel ddPCR-identified cDNAs was obtained through RACE-PCR using the rat brain Marathon-Ready cDNA kit (BD Biosciences Clontech, Palo Alto, CA, USA). Gene-specific primers designed based on the known sequence of the original cDNA were synthesized at MOBIX. These primers were designed according to the recommendations of the kit. RACE-PCR was then performed using a combination of the gene-specific primers and the kit’s supplied adaptor primers. The primers used for 50 RACE were positioned closer to the 30 end of the ddPCR fragment, while the primers used for 30 RACE were positioned closer to the 50 end of the ddPCR fragment. This measure was taken to ensure the amplification of the correct gene by comparing

the overlapping regions of the ddPCR fragment and the RACE-PCR products. RACE-PCR products were cloned using the AdvanTAget PCR Cloning Kit (BD Biosciences Clontech, Palo Alto, CA, USA), as suggested by the Marathon-Ready cDNA Kit. Briefly, the PCR products were ligated into the pT-Adv vector for 4 h at 141C in a reaction mixture containing the kit’s recommended components. TOP10F’ Escherichia coli competent cells were transformed with the ligated DNA and transformed cells were maintained on ice prior to plating. Cells were then plated on LB/X-Gal/IPTG (40 ml each of 40 mg/ml X-Gal in dimethylformamide and 100 mM IPTG) plates containing 50 mg/ml ampicillin. Subsequently, the plates were incubated at 371C for 18 h and stored at 41C. Plasmids were then isolated and exposed to HindIII or EcoRI restriction enzyme digestion. The resulting fragments were run on an ethidium bromide-stained 1.5% agarose gel and isolated with the QIAEX II Gel Extraction Kit (Qiagen, Mississauga, ON Canada). Following isolation, the fragments were sequenced at MOBIX and their sequences were overlapped to determine full-length sequences. These full-length products were compared with GenBank sequences to confirm homology profiles of original ddPCR fragments and to design specific cDNA probes for Northern hybridization confirmation of findings. Probe Labeling for Northern Hybridization cDNA probe templates were synthesized through PCR using primers designed based on determined full-length sequences of ddPCR fragments. The cDNAs were run on a 1.5% agarose gel and isolated using the QIAEX II Gel Extraction Kit. Probes were then synthesized and labeled using Roche Applied Science’s Random Primed DNA Labeling Kit (Laval, PQ, Canada). Briefly, 25 ng of DNA was denatured at 951C for 5 min and added to a 20 ml reaction containing 2 ml of 10 reaction mixture, 1 ml of each 0.5 mM nonradiolabeled dNTP (ie dATP, dTTP, dGTP), 50 mCi of [a-32P]dCTP, 3000 Ci/ mmol and 2 U of Klenow Enzyme. The reaction was carried out at 371C for B30 min and terminated by the addition of 2 ml of 0.2 M EDTA (pH 8.0). Unincorporated nucleotides were removed by elution of the sample through Sephadex G-50 Quick Spin Columns (Roche Applied Science, Laval, PQ, Canada). Only probes with a specific activity X1 108 cpm/mg were used for Northern hybridization. Northern Hybridization For each sample, 1.0 mg mRNA was separated on a 1% agarose gel for 2–3 h at 60 V. Following electrophoresis, the mRNA was transferred to a nylon membrane by capillary action overnight and fixed to the blot by baking at 801C for 2 h. Northern hybridization was performed using ExpressHyb solution following the procedure described by the solution’s manufacturer (Clontech, Palo Alto, CA, USA). Prior to probe hybridization, blots were incubated with ExpressHyb solution alone for 30 min at 681C. Blots were then exposed to denatured radiolabeled cDNA probes (refer to previous section) diluted in the solution at a concentration of 1–2 106 cpm/ml for 1 h at 681C. Following several

www.nature.com/tpj


382

30 min low-stringency washes at 421C, blots were wrapped in plastic and exposed to Kodak X-OMAT AR film at 801C for 24–72 h. The resulting optical density signals were quantified using NIH Image computer software, as described earlier. All pre-hybridization and hybridization steps were conducted in a Hybaid Micro 4 hybridization chamber (Hybaid, Teddington, Middlesex, UK), where blots were rotated continuously with their appropriate solutions in roller bottles. In addition, b-actin levels were used to ensure equal loading of RNA samples and to normalize the optical density signals of different samples on the same blot before analyses. Immunoblotting Immunoblotting was performed to assess RGDN protein expression. Rat striatal tissues were homogenized in 50 mM Tris, 1 mM EDTA, pH 7.4, using a hand-held glass dounce homogenizer. Protein concentrations of homogenates were estimated using BioRad Protein Assay Reagent (BioRad, Mississauga, ON, Canada), following the procedure described by the reagent’s manufacturer. Homogenates were stored at 801C until further use. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was used to separate proteins. Protein samples were centrifuged at a maximum speed for 2 min, resuspended in 30 ml of SDS-PAGE gel-loading buffer (62.5 mM Tris–HCl, pH 6.8; 10% glycerol; 2% SDS; 5% 2-bmercaptoethanol; 0.00125% bromophenol blue) and boiled for 4 min prior to loading. Proteins were separated through 4% stacking gel, followed by 12% separating gel at 175 V for 1 h. Following SDS-PAGE, protein was transferred to nitrocellulose using a Novex XCell II Blot Module (Invitrogen, Burlington, ON, Canada) at 30 V for 2 h. The transfer buffer contained 12 mM Tris–HCl, 96 mM glycine and 10% methanol. The nitrocellulose was then blocked for 1 h with TBS-T buffer (10 mM Tris–HCl, pH 8.0, 150 mM NaCl, 0.05% Tweens 20) containing 5% skim milk powder. Subsequently, nitrocellulose membranes were incubated with the primary antibodies (rabbit anti-rat RGDN or mouse anti-rat b-actin) on an orbital shaker at 41C overnight, and then exposed to three 5–15 min TBS-T washes at room temperature. The rabbit anti-rat RGDN sera were generated as previously described,14 while mouse anti-rat b-actin was

Table 1

Table of primers used in RACE-PCR reactions

Primer

Region/Tm

Sequence

50 50 30 30

271–294/70 248–270/68 271–294/70 248–294/70

50 -AGCCTTGTTGATCTTCTTCAGCAC-30 50 -CTTTTCCGACTCCGTTCACATTGT-30 50 -ACAATGTGAACGGAGTCGGAAAAG-30 50 -GTGCTGAAGAAGATCAACAAGGCT-30

GSP NGSP GSP NGSP

Gene-specific (GSP) and nested gene-specific (NGSP) primers were designed for both 50 and 30 RACE reactions. Primers were designed for elongation of CRG ddPCR clone ends. The table provides the sequences and melting temperatures (Tm) of the primers, as well as their corresponding regions in the RGDN gene based on BLAST analysis. Tm was calculated using the equation Tm ¼ 2(A+T)+4(G+C).


purchased from Novus Biologicals, Littleton, CO, USA. RGDN and b-actin primary antibodies were used at dilutions of 1 : 1000 and 1 : 7500, respectively. The nitrocellulose membranes were then incubated with the secondary antibody for 1 h at room temperature on an orbital shaker and then exposed to three TBS-T washes at room temperature. Following washes, the blots were incubated with secondary antibodies for 2 h at room temperature. Secondary antibodies for RGDN and b-actin experiments were peroxidaseconjugated anti-rabbit IgG (1 : 7500 dilution) (Amersham Biosciences, Baie d’Urfe´, PQ, Canada) and peroxidaseconjugated goat anti-mouse IgG (1 : 2000 dilution) (Oncogene Research Products, San Diego, CA, USA), respectively. Subsequent detection was accomplished through the enzymatic chemiluminescence (ECL) method (Amersham Biosciences) and blot exposure to Kodak X-OMAT AR film. The resulting optical density signals were quantified using NIH Image computer software, as described earlier. b-Actin levels were used to ensure equal loading of protein samples and to normalize the optical density signals of different samples on the same blot before analyses. Statistical Analysis Relative b-actin-normalized mRNA and protein levels of drug-treated groups and their respective control groups were analyzed with the Student’s t-test (two-tailed) using GraphPad Prism software (GraphPad Software, San Diego, CA, USA). Data are presented as the relative mean optical densities7SEM (Standard Error of the Mean). Control mean optical densities were set to 100%. Differences were defined as significant at Pr0.05. RESULTS ddPCR reveals differential gene expression in the rat striatum following chronic clozapine treatment ddPCR analysis revealed differential expression of several fragments among the experimental groups, but only one

Figure 1 Representative ddPCR gel showing increase in CRG expression following clozapine treatment (boxed and bracketed).


383

product demonstrated consistent expression change. This fragment was found to be upregulated in the striatal tissues of the clozapine group relative to those of the other experimental groups and was termed CRG (Figure 1). CRG was isolated from ddPCR sequencing gels, amplified by PCR, purified by agarose gel electrophoresis and cloned into the PCR-TRAP cloning system. The cDNA clone was sequenced at the MOBIX facility (McMaster University, Hamilton, ON, Canada) and compared with GenBank sequences through BLAST analysis. The fragment (AAGCTTCTCAACGGTGA TGCGATACAATGTGAACGGAGTCGGAAAAGTGTGAAGAA GATCAACAAGGCTATTGTCTCCAAAAAAAAAAAGCTT, plus strand 50 -30 ) possessed significant homology (99–100%) to a region near the 50 end of rat glia-derived nexin mRNA (GenBank #M17784) sequence contained in GenBank. This mRNA contained a poly A-rich region (nucleotides 304–315 of RGDN mRNA) that served as the target for priming the initial ddPCR reaction, which produced a ddPCR fragment corresponding to a region (nucleotides 230–308 of RGDN) distal to the 30 end of the nexin mRNA (refer to Figure 2). RACE-PCR reveals significant homology between rat glia-derived nexin mRNA and clozapine-upregulated CRG Elongation of CRG by RACE-PCR was performed to confirm its identity and design a specific probe for Northern hybridization confirmation of the finding. Gene-specific primers were synthesized at MOBIX and designed so that the cDNA could be extended in both the 50 and 30 directions. Initial and nested gene specific primers for the 50 and 30 RACE reactions were designed near the 30 and 50 ends of the cDNA, respectively (Table 1), producing RACE-PCR products with overlapping regions containing the sequence of the initial ddPCR fragment. The 50 -RACE PCR reaction produced a product of E270 bp, while the 30 -RACE product was E530 bp. These results indicated that CRG was located at the 50 end of the full-length cDNA. Figure 2 provides BLAST comparison of the identity of the combined RACEPCR sequences to the rat, mouse and human GenBank sequences most homologous with the amalgamated sequence. The identity of the combined RACE-PCR sequences was approximately 100% (Identities ¼ 910/911; Gaps ¼ 1/ 911), 92% (Identities ¼ 838/911; Gaps ¼ 1/911) and 82% (Identities ¼ 747/911; Gaps ¼ 1/911), homologous with rat glia-derived nexin mRNA (GenBank #M17784), Mus musculus serine (or cysteine) proteinase inhibitor (clade E, member 2) mRNA (GenBank #BC010675) and Homo sapiens serine (or cysteine) proteinase inhibitor (clade E (nexin, plasminogen activator inhibitor type 1), member 2 (SERPINE2)) mRNA (GenBank #NM_006216), respectively. A singlenucleotide gap following position 440 of the combined RACE-PCR nucleotide sequence was observed in each sequence comparison. Figure 3 shows an open reading frame analysis of the combined RACE-PCR sequence, which was 100% homologous with rat glia-derived nexin mRNA (GenBank #M17784). A potential initiation codon (ATG) was found at 1 bp. The putative amino-acid sequence derived from

Figure 2 Multiple sequence alignment of CRG cDNA with its most homologous rat, mouse and human gene sequences in GenBank. The sequence identities between CRG and M17784, BC010675 and NM_006216 are 100, 92 and 82%, respectively (M17784 ¼ rat gliaderived nexin (GDN) mRNA, 50 end; BC010675 ¼ Mus musculus serine (or cysteine) proteinase inhibitor, clade E, member 2, mRNA; NM_006216 ¼ Homo sapiens serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2(SERPINE2), mRNA). Gaps are indicated by dashes ().

elongated CRG is also provided in Figure 3. The translation product is 147 amino acids in length (Figure 3a). However, since BLAST analysis revealed a gap in the amalgamated RACE-PCR nucleotide sequence analysis, a putative

www.nature.com/tpj


384

amino-acid sequence was also determined from the combined nucleotide sequence including the gap. The translation product of the gap-containing sequence is 397 amino acids (Figure 3b). Figure 4 is an analysis of the rat, mouse and human amino-acid sequences in GenBank, showing the greatest homology with the translation product of the non-gap-containing (Figure 4a) and gap-containing (Figure 4b) CRG nucleotide sequences. Rat glia-derived nexin precursor (protease nexin I) (GenBank #P070921), Mus musculus serine protease inhibitor 4 (protease nexin 1, serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2) (GenBank #NP_033281) and Homo sapiens plasminogen activator inhibitor type 1, member 2

Figure 3 Combined 50 and 30 RACE-PCR sequences for the ddPCR cDNA with the corresponding protein sequence below the nucleotide sequence (GenBank accession number M17784). Sequence identity with the original ddPCR cDNA is indicated by bold underline (nucleotides 212–308). Nucleotides 1–269 were generated by 50 RACE-PCR and nucleotides 270–910 were generated by 30 RACE-PCR. Sequence analysis indicates initiation codon at position 1 of the nucleotide sequence. Initiation codon is underlined. Since BLAST analysis revealed a gap in the amalgamated RACE-PCR nucleotide sequence analysis, a putative amino-acid sequence was determined from the combined nucleotide sequence without (a) and including (b) the gap. Gap is indicated by a dash () in the nucleotide sequence and a bolded X in the protein sequence. (b) also shows additional nucleotides and amino acids (italicized and bolded) believed to be missing from the amalgamated CRG sequence based on BLAST analysis. Stop codons are represented by stars (*).


Figure 4 Multiple sequence alignment of putative CRG translation product with its most homologous rat, mouse and human protein sequences in GenBank. (a) Non-gap-containing CRG homology identities are 100, 91 and 78% for P07092, NP_033281 and NP_006207, respectively, while (b) gap-containing CRG homology identities are 99, 92 and 82% for P07092, NP_033281 and NP_006207, respectively. Gap is indicated by a dash () (P07092 ¼ Glia-derived nexin precursor (GDN) (protease nexin I) (PN-1); NP_033281 ¼ Mus musculus serine protease inhibitor 4, protease nexin 1, serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2; NP_006207 ¼ Homo sapiens plasminogen activator inhibitor type 1, member 2 (protease inhibitor 7 (protease nexin I); glial-derived nexin 1; glial-derived neurite promoting factor)).


385

is most homologous with the nucleotide sequence of rat glia-derived nexin protein, and the putative translation product associated with the cDNA is 100% homologous with rat glia-derived nexin precursor protein.

(protease inhibitor 7 (protease nexin I); glial-derived nexin 1; glial-derived neurite promoting factor) (GenBank #NP_006207) are 100% (Identities ¼ 147/147), 91% (Identities ¼ 135/147) and 78% (Identities ¼ 115/147) homologous with CRG’s non-gap-containing nucleotide sequence-derived protein sequence, respectively. On the other hand, CRG’s gap-containing nucleotide sequencederived protein sequence is 99% (Identities ¼ 302/303), 92% (Identities ¼ 280/303) and 82% (Identities ¼ 251/303) homologous with rat glia-derived nexin precursor (protease nexin I) (GenBank #P070921), Mus musculus serine protease inhibitor 4 (protease nexin 1, serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 2) (GenBank #NP_033281) and Homo sapiens plasminogen activator inhibitor type 1, member 2 (protease inhibitor 7 (protease nexin I); glial-derived nexin 1; glial-derived neurite promoting factor) (GenBank #NP_006207), respectively. In summary, the ddPCR cDNA

Northern hybridization confirms that chronic clozapine treatment increases striatal RGDN mRNA levels RGDN and corresponding b-actin mRNA levels of control and clozapine-treated samples are shown in Figure 5a. Striatal RGDN mRNA significantly increased by 381.4714.5% (*Po0.0001) following clozapine administration. However, no significant differences in striatal RGDN mRNA levels were observed between control and haloperidol-treated groups (Figure 5b). The drug-treated groups and their respective control groups did not show differences in striatal b-actin mRNA levels.

Figure 5 Northern blot analysis of striatal nexin mRNA expression following chronic clozapine or haloperidol treatment. (a) Graph showing relative striatal nexin mRNA levels between control (C) and clozapine- (Cl) treated groups. (b) Graph showing relative striatal nexin mRNA levels between control (C) and haloperidol- (H) treated groups. Inset images are representative Northern blots illustrating nexin (2.2 kb) and corresponding b-actin mRNA expression. Graphical data are presented as mean nexin mRNA expression7SEM after b-actin normalization (*Po0.0001).

Figure 6 Immunoblot analysis of striatal nexin protein expression following chronic clozapine or haloperidol treatment. (a) Graph showing relative striatal nexin protein levels between control (C) and clozapine- (Cl) treated groups. (b) Graph showing relative striatal nexin protein levels between control (C) and haloperidol(H) treated groups. Inset images are representative immunoblots illustrating nexin (43 kDa) and corresponding b-actin protein expression. Graphical data are presented as mean nexin protein expression7SEM after b-actin normalization (*Po0.0001).

www.nature.com/tpj


386

Immunoblotting reveals that chronic clozapine treatment increases corresponding striatal RGDN protein levels RGDN and corresponding b-actin protein levels of control and clozapine-treated samples are shown in Figure 6a. Striatal RGDN protein significantly increased by 186.277.91% (*Po0.0001) following clozapine treatment. However, no significant differences in striatal RGDN protein levels were observed between control and haloperidoltreated groups (Figure 6b). The drug-treated groups and their respective control groups did not show differences in striatal b-actin protein levels.

DISCUSSION Through the use of ddPCR, this study discovered several gene sequences regulated by chronic clozapine treatment. One of these sequences was found to be upregulated following repeated exposure to the drug, and RACE-PCR extension of this sequence in both 50 and 30 directions generated a cDNA 926 nucleotides in length. Since sequence analysis of this cDNA revealed a 100% homology with RGDN mRNA and open reading frame analysis of the cDNA’s sequence revealed a putative translation product 100% homologous with RGDN protein, we hypothesized that the discovered clozapine-regulated ddPCR fragment represents this protein’s transcript. In addition, Northern hybridization and immunoblotting showed that both mRNA and protein levels of RGDN increased significantly following chronic treatment with the atypical antipsychotic drug, confirming the ddPCR finding of clozapine-regulated RGDN expression. The difference in the extent of clozapineinduced RGDN upregulation between Northern blot and immunoblot studies (ie five-fold vs three-fold) may be due to factors associated with RGDN mRNA stability or translation efficiency. In addition, increased expression of RGDN may be an effect specific to chronic clozapine administration, as no significant change in RGDN’s expression was observed following protracted haloperidol treatment. RGDN is predominantly present in the brain and is highly concentrated in the striatum.15 It is a potent protease inhibitor16 binding specific serine proteases in the extracellular environment. The resulting RGDN–protease complexes are subsequently internalized and degraded, which regulates and removes various extracellular proteases.15,17 Since increased serine protease activity has been associated with the pathophysiology of schizophrenia,18 our findings suggest that clozapine may elicit its therapeutic effects in part by increasing RGDN expression. Furthermore, serine proteases can cause neuronal damage and aberrant synapse development upon activation.19 Chronic antipsychotic drug treatment may stimulate such serine proteases and therefore cause these effects, which can lead to the development of extrapyramidal side effects, including tardive dyskinesia.20,21 In fact, long-term treatment with the typical antipsychotic drug, haloperidol, has been shown to increase the activity of certain serine protease-like endopeptidases in various brain regions.22,23 Clozapine’s ability to upregulate RGDN may reduce levels of such protein degradation


enzymes and serve in neuronal protection and promotion of synapse integrity, resulting in fewer antipsychotic druginduced motor dysfunctions during clozapine treatment. Therefore, the observed clozapine-induced increase in RGDN expression may explain why fewer of these negative consequences are seen in clozapine treatment than in haloperidol treatment,24 which had no significant effects on RGDN expression changes in our study. Furthermore, the fact that receptor binding is achieved in hours25 whereas therapeutic effects require months26 raises the possibility that gene expression processes such as we have found may be the mechanism of antipsychotic activity. The question of whether other atypical antipsychotic drugs, such as olanzapine and quitepane, can activate serine protease inhibitors clearly calls for investigation.

ACKNOWLEDGEMENTS This work was supported by the Ontario Mental Health Foundation and National Institutes of Health (USA). RKM is a recipient of the senior fellowship of the Ontario Mental Health Foundation. VZC is a recipient of the NSERC Canada Graduate Scholarship.

DUALITY OF INTEREST None declared.

ABBREVIATIONS CRG ddPCR RACE-PCR RGDN

clozapine regulated gene differential display polymerase chain reaction rapid amplification of cDNA ends polymerase chain reaction rat glia-derived nexin

REFERENCES 1 Kennedy E, Song F, Hunter R, Clarke A, Gilbody S. Risperidone versus typical antipsychotic medication for schizophrenia. Cochrane Database Syst Rev 2000; CD000440. 2 Davis KL, Kahn RS, Ko G, Davidson M. Dopamine in schizophrenia: a review and reconceptualization. Am J Psychiatry 1991; 148: 1474–1486. 3 Tollefson GD, Beasley Jr CM, Tamura RN, Tran PV, Potvin JH. Blind, controlled, long-term study of the comparative incidence of treatmentemergent tardive dyskinesia with olanzapine or haloperidol. Am J Psychiatry 1997; 154: 1248–1254. 4 Moller HJ. Atypical neuroleptics: a new approach in the treatment of negative symptoms. Eur Arch Psychiatry Clin Neurosci 1999; 249(Suppl 4): 99–107. 5 Masellis M, Basile VS, Ozdemir V, Meltzer HY, Macciardi FM, Kennedy JL. Pharmacogenetics of antipsychotic treatment: lessons learned from clozapine. Biol Psychiatry 2000; 47: 252–266. 6 Ashby Jr CR, Wang RY. Pharmacological actions of the atypical antipsychotic drug clozapine: a review. Synapse 1996; 24: 349–394. 7 Kapur S, Seeman P. Does fast dissociation from the dopamine d(2) receptor explain the action of atypical antipsychotics? A new hypothesis. Am J Psychiatry 2001; 158: 360–369. 8 Stein S, Liang P. Differential display analysis of gene expression in mammals: a p53 story. Cell Mol Life Sci 2002; 59: 1274–1279. 9 Fischer V, Schmitt U, Weigmann H, Von Keller B, Reuss S, Hiemke C et al. Chronical haloperidol and clozapine treatment in rats: differential RNA display analysis, behavioral studies and serum level determination. Prog Neuropsychopharmacol Biol Psychiatry 1998; 22: 1129–1139. 10 Hippius H. A historical perspective of clozapine. J Clin Psychiatry 1999; 60(Suppl 12): 22–23.


387

11

12

13

14

15

16

17

18

Tuunainen A, Wahlbeck K, Gilbody S. Newer atypical antipsychotic medication in comparison to clozapine: a systematic review of randomized trials. Schizophr Res 2002; 56: 1–10. Zhang W, Tilson H, Stachowiak MK, Hong JS. Repeated haloperidol administration changes basal release of striatal dopamine and subsequent response to haloperidol challenge. Brain Res 1989; 484: 389–392. Costain WJ, Mishra RK. PLG regulates hnRNP-L expression in the rat striatum and pre-frontal cortex: identification by ddPCR. Peptides 2003; 24: 137–146. Knauer MF, Crisp RJ, Kridel SJ, Knauer DJ. Analysis of a structural determinant in thrombin-protease nexin 1 complexes that mediates clearance by the low density lipoprotein receptor-related protein. J Biol Chem 1999; 274: 275–281. Wagner SL, Van Nostrand WE, Lau AL, Farrow JS, Suzuki M, Bartus RT et al. Co-distribution of protease nexin-1 and protease nexin-2 in brains of non-human primates. Brain Res 1993; 626: 90–98. Abraham CR, Selkoe DJ, Potter H. Immunochemical identification of the serine protease inhibitor alpha 1-antichymotrypsin in the brain amyloid deposits of Alzheimer’s disease. Cell 1988; 52: 487–501. Otsuki T, Kajigaya S, Ozawa K, Liu JM. SNX5, a new member of the sorting nexin family, binds to the Fanconi anemia complementation group A protein. Biochem Biophys Res Commun 1999; 265: 630–635. Maes M, Goossens F, Scharpe S, Calabrese J, Desnyder R, Meltzer HY. Alterations in plasma prolyl endopeptidase activity in depression,

19

20

21

22

23

24 25

26

mania, and schizophrenia: effects of antidepressants, mood stabilizers, and antipsychotic drugs. Psychiatry Res 1995; 58: 217–225. Turgeon VL, Houenou LJ. The role of thrombin-like (serine) proteases in the development, plasticity and pathology of the nervous system. Brain Res Brain Res Rev 1997; 25: 85–95. Andreassen OA, Jorgensen HA. Neurotoxicity associated with neuroleptic-induced oral dyskinesias in rats. Implications for tardive dyskinesia? Prog Neurobiol 2000; 61: 525–541. Roberts RC, Gaither LA, Gao XM, Kashyap SM, Tamminga CA. Ultrastructural correlates of haloperidol-induced oral dyskinesias in rat striatum. Synapse 1995; 20: 234–243. Konkoy CS, Oakes MG, Davis TP. Chronic treatment with neuroleptics alters neutral endopeptidase 24.11 activity in rat brain regions. Peptides 1993; 14: 1017–1020. Welches WR, Brosnihan KB, Ferrario CM. A comparison of the properties and enzymatic activities of three angiotensin processing enzymes: angiotensin converting enzyme, prolyl endopeptidase and neutral endopeptidase 24.11. Life Sci 1993; 52: 1461–1480. Schwartz JT, Brotman AW. A clinical guide to antipsychotic drugs. Drugs 1992; 44: 981–992. Nordstrom AL, Farde L, Halldin C. Time course of D2-dopamine receptor occupancy examined by PET after single oral doses of haloperidol. Psychopharmacology (Berl) 1992; 106: 433–438. Breier A, Buchanan RW, Irish D, Carpenter Jr WT. Clozapine treatment of outpatients with schizophrenia: outcome and long-term response patterns. Hosp Community Psychiatry 1993; 44: 1145–1149.

www.nature.com/tpj