Differential Effects of Nicotine and Tobacco Smoke Condensate on Human Annulus Fibrosus Cell Metabolism Nam Vo,1 Dong Wang,1,2 Gwendolyn Sowa,1,3 William Witt,1 Kevin Ngo,1 Paulo Coelho,1,3 Ronald Bedison,1 Barbara Byer,1 Rebecca Studer,1 Joon Lee,1 Y. Peter Di,4 James Kang1 1
Ferguson Laboratory for Orthopaedic Research, Department of Orthopaedic Surgery, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15261, 2Department of Orthopaedics, Beijing Haidian Hospital, 29 Zhong-Guan-Cun Street, Beijing 100080, China, 3Department of Physical Medicine and Rehabilitation, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15261, 4Center for Lung Regeneration, Department of Environmental and Occupational Health, Graduate School of Public Health, University of Pittsburgh, Pennsylvania 15261 Received 20 October 2010; accepted 28 February 2011 Published online 29 March 2011 in Wiley Online Library (wileyonlinelibrary.com). DOI 10.1002/jor.21417
ABSTRACT: Tobacco smoking increases the risk of intervertebral disc degeneration (IDD) and back pain, but the mechanisms underlying the adverse effects of smoking are largely unknown. Current hypotheses predict that smoking contributes to IDD indirectly through nicotine-mediated vasoconstriction which limits the exchange of nutrients between the discs and their surroundings. We alternatively hypothesize that direct contact of disc cells, that is, cells in the outermost annulus and those present along fissures in degenerating discs, with the vascular system containing soluble tobacco smoking constituents could perturb normal metabolic activities resulting in IDD. In this study, we tested our hypothesis by comparing the effects of direct exposure of human disc cells to tobacco smoke condensate and nicotine on cell viability and metabolic activity. We showed that smoke condensate, which contains all of the water-soluble compounds inhaled by smokers, exerts greater detrimental effects on human disc cell viability and metabolism than nicotine. Smoke condensate greatly induced an inflammatory response and gene expression of metalloproteinases while reduced active matrix synthesis and expression of matrix structural genes. Therefore, we have demonstrated that disc cell exposure to the constituents of tobacco smoke has negative consequences which have the potential to alter disc matrix homeostasis. ß 2011 Orthopaedic Research Society Published by Wiley Periodicals, Inc. J Orthop Res 29:1585–1591, 2011 Keywords: intervertebral disc degeneration; back pain; tobacco smoking; extracellular matrix; proteoglycans
Despite the devastating health impact of tobacco smoking, over 1.1 billion people worldwide continue to smoke, representing one-sixth of the world’s population.1 The incidence of smoking among young adults is increasing, particularly in developing countries. Tobacco use in the United States annually results in more than $75 billion in direct medical costs and nearly 1 of every 5 deaths, or about half a million people.2 Tobacco smoking harms nearly every organ of the body and causes many diseases.3 Epidemiological evidence implicating tobacco smoking in intervertebral disc degeneration (IDD) includes the study of identical twins by Battie et al.4 who found about 20% greater MRI disc degeneration score in smokers than nonsmokers. Tobacco smoking increases the risk for lumbar discectomy in an 11-year follow-up study of nearly 60,000 adolescents.5 Other research studies also suggest that smoking can exacerbate preexisting disc degeneration and delay recovery from post-discal surgery.6,7 Despite this epidemiologic association, how smoking contributes to IDD is still not well understood. Rats exposed to tobacco smoke to mimic passive smoking for up to 8 weeks exhibit reduced collagen gene expression, increased level of pro-inflammatory cytokine interleukin-1b and annular disorganization in their intervertebral discs.8 Holm and Nachemson9 in the late 1980s demonstrated a 30–50% reduction in solute Nam Vo and Dong Wang equally contributed to this study. Correspondence to: Nam Vo (T: 412-648-1092; F: 412-383-5307; E-mail:
[email protected]) ß 2011 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.
exchange capacity in intervertebral discs of porcine smoking models. These investigators suggested that tobacco smoking induces vasoconstriction, thereby reducing the nutrient uptake within the disc leading to disc degeneration. This was supported by subsequent studies of rabbits treated with patches of nicotine, a major tobacco smoke constituent responsible for addiction and vasoconstriction.10 Smoking in this model decreased the density of vascular buds and caused narrowing of the vascular lumen in the vicinity of the vertebral endplate. Current hypotheses generally favor this mechanism by which tobacco smoke causes IDD indirectly via nicotine-induced vasoconstriction, resulting in decreased nutrient and waste exchange between discs and the surrounding vascular system. It is conceivable that direct contact of disc cells, that is, cells in the outermost annulus and those present along fissures in degenerating discs, with the vascular system containing soluble tobacco smoking constituents could perturb normal metabolic activities resulting in IDD. Cells of NP tissue could also come in direct contact with the water-soluble constituents of tobacco smoke which diffuse through the endplate. This is not inconceivable as previous studies demonstrate that smoke constituents penetrate and induce DNA damage in many tissues, including bone marrow.11 Effects of nicotine exposure on bovine disc cell culture matrix synthesis has been reported,12 but the effects of tobacco smoke, which contains a mixture of many other toxic chemicals found in smokers, on human disc cellular metabolism have not been investigated. Hence, this study tests this alternative hypothesis by JOURNAL OF ORTHOPAEDIC RESEARCH OCTOBER 2011
1585
1586
VO ET AL.
comparing the effects of direct exposure of human disc cells to smoke condensate and nicotine on cell viability and metabolic activity.
MATERIALS AND METHODS Cell Isolation and Culture Disc tissues were harvested from 9 female patients (age 46– 75 years, mean ¼ 55 years), and 6 males (age 22–59 years, mean ¼ 52 years) whose diagnosis was disc degeneration. The discs were classified as grades 2–4 disc degeneration according to the Thompson scale,13 and the average was 2.8 (females) and 2.7 (males); only one grade 4 preparation was used for these cell preparations. The patient population included 1 with ‘‘neuritis,’’ 1 with disc fracture, 1 with disc herniation, 2 with scoliosis, and 8 with stenosis, and thus represent a range of conditions associated with disc degeneration. No granulation tissue was present, and the nucleus could be clearly defined from the anulus. Human anulus fibrosus (hAF) and nucleus pulposus (hNP) were dissected from patient disc surgical specimens as follows. First a box shaped annulotomy was made and the outer annulus was harvested. Then the inner annulus was carefully separated from the inner nucleus disc material which was harvested with a pituitary rongeur without violating the endplates and the posterior annulus. The annulus and the inner nucleus disc material were sent out in a separate container. Maticulous hemostasis was performed as much as possible throughout tissue harvest to decrease cross contamination from the blood. The experimental protocol was approved by the human subjects Institutional Review Board at the University of Pittsburgh. hAF and hNP cells were isolated and cultured in monolayer culture or in 1.2% alginate bead culture, respectively, in F-12/D-MEM containing 10% FCS, 1% PS, and 25 mg/ml L-ascorbic acid under standard conditions (378C, 5% CO2, 95% air, bicarbonate buffering to maintain pH at 7.2) as previously described.14 Cell culture materials were purchased from Invitrogen/Gibco, Carlsbad, CA unless noted otherwise, and the hAF and hNP cells were used at passage 1 or 2. Preparation of Tobacco Smoke Extract Particulates from tobacco smoke collected on a membrane filter15 (Pallflex filters 25 mm 7219, VWR) through a sampling vacuum of air in an environmental chamber that was filled with cigarette smoke produced by a cigarette smoke generator (Teague Enterprise, TE-10z, Davis, CA) were quantified by weighing the membrane before and after collection. Tobacco smoke extract (TSE) was prepared by soaking the Pallflex filter containing known quantity of
collected smoke particulates in serum-free F-12/D-MEM medium, and the tube was rotated for 3 days at 48C to completely extract the water-soluble smoke compounds from the filter. This TSE mixture was filtered (MILLEX GP, 0.22 mm) and used immediately or stored at 808C for future use. Exposure to Tobacco Smoke Extract and Nicotine To remove assay interference by serum, cell cultures were serum starved for 24 h in serum-free F-12/D-MEM media supplemented with 1 mg/ml BSA and insulin–transferrin– selenium (ITS, 1 ml ITS/100 ml media) before TSE treatment. Cells in monolayer or alginate beads were exposed to different concentrations of TSE (0–1 mg/ml) and free base nicotine (0–10 mg/ml, Sigma–Aldrich, St. Louis, MO, cat no. N5260) for 72 h. Total RNA was extracted using the RNeasy Mini Kit (Qiagen, Germantown, MD), and conditioned media were collected and stored at 808C for prostaglandin (PGE2) measurement. The A260/280 and A260/230 ratios of our purified RNA samples were between 1.8 and 2, indicating acceptably high RNA purity. Determination of Cell Viability by MTT Assay After TSE exposure, media of cell culture were replaced with 500 ml of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide (MTT), a compound which is converted into a purple byproduct by the mitochondrial reductase in live cells.16 Cells were incubated in 1 mg/ml MTT in a 48-well plate for 2 h at 378C, washed three times with PBS, and incubated with 300 ml of an organic solvent (n-hexane chromasolve, Sigma–Aldrich, cat no. 34859) for 1 h at 378C to extract the colored product. Chromasolve cell extract was assayed spectrophotometrically at 570 nm. Percent cell viability was calculated relative to untreated control cells.17 Gene Expression Analysis Relative mRNA levels of selected genes (Table 1) were analyzed by real-time RT-PCR using a Bio-Rad iCycler IQ4 detection system. The reactions were done with validated primers (Table 1) in duplicate in 96-well plates in 25 ml using the reagents and protocol per the Bio-Rad iScript One-Step RT-PCR Kit (Hercules, CA). The cycle threshold (Ct) values were obtained, and data normalized to GAPDH expression using the DDCt method to calculate relative mRNA levels compared to untreated samples. PGF2a and PGE2 Analysis The concentration of PGE2 and prostaglandin F2a (PGF2a) in condition media of TSE-treated cells was quantified using a competitive binding assay (Parameter PGE2 ELISA
Table 1. Primers Used for RT-PCR Analysis of Gene Expression Gene GAPDH Aggrecan Col 1a 2 MMP-1 MMP-3 TIMP-1 TIMP-3 ADAMTS4 COX-2
Forward
Reverse
ACCCACTCCTCCACCTTTGAC AAGAATCAAGTGGAGCCGTGTGTC GGAAACAGACAAGCAACCCAAACT CCCAAAAGCGTGTGACAGTA CAAGGAGGCAGGCAAGACAGC TGGCTTCTGGCATCCTGTTGTTG AGGACGCCTTCTGCAACTC TCACTGACTTCCTGGACAATGG TCCACCAACTTACAATGCTGACTATG
TCCACCACCCTGTTGCTGTAG TGAGACCTTGTCCTGATAGGCACT GGTCATGTTCGGTTGGTCAAAGATA GAGCTCAACTTCCGGGTAGA GCCACGCACAGCAACAGTAGG CGCTGGTATAAGGTGGTCTGGTTG GTACTGCACATGGGGCATCT ACTGGCGGTCAGCATCATAGT AATCATCAGGCACAGGAGGAAGG
JOURNAL OF ORTHOPAEDIC RESEARCH OCTOBER 2011
TOBACCO SMOKING AND DISC CELL METABOLISM
kits from R&D Systems, Minneapolis, MN and High Sensitivity PGFF2a from Assay Designs, Ann Arbor, MI, cat no. # 931-069) as described by the high sensitivity option instructions provided with the kits. PGF2a and PGE2 concentrations were measured in the 150 ml of conditioned media diluted 1:5 from each sample and reported relative to controls. Determination of Matrix Protein Synthesis Cell cultures in 48-well plate format were dual labeled with 20 mCi/ml 35S-sulfate and10 mCi/ml 3H-L-proline in 0.5 ml F-12/DMEM media with 50 mg/ml L-ascorbate and 50 mg/ml b-aminopropionitrile for 3 days under standard conditions (378C, 5% CO2, 95% air, bicarbonate buffering to maintain pH at 7.2). Proteoglycan synthesis was measured as 35S-sulfate incorporation using size-exclusion chromatography as previously described,18 and the results calculated as pmol 35S incorporated/mg DNA and expressed relative to control. Collagenase sensitive protein synthesis was measured as 3H-Proline incorporation as described,19 calculated as dpm/mg DNA, and expressed relative to untreated control. Statistical Analysis Values represent the average of 3–5 samples standard error (SE), with 95% confidence intervals calculated to determine statistical significance. The confidence intervals were calculated based on the t-distribution because of the small sample size.
1587
RESULTS Dose-Dependent Effects of TSE and Nicotine on Cell Viability of Human IVD Cells TSE contains many toxic compounds in addition to nicotine, thus we tested their differential cytotoxicities by exposing cultures of human IVD cells to various concentrations of TSE and nicotine dissolved in media. Human IVD cells exposed to TSE underwent dramatic morphological changes, taking on an elongated appearance at low smoke concentrations (0.1–0.5 mg/ml) and densely compacted appearance at high smoke concentrations (>0.5 mg/ml; Fig. 1). Nicotine treatment produced different morphologic changes, with cells appearing as large granular aggregates when exposed to 0.3–3 mg/ml nicotine and becoming amorphous and detached at 10 mg/ml nicotine. Changes in cellular morphology accompanied cell death, which increased with increasing concentrations of TSE and nicotine. Human disc cells showed about 20% and 70% cell death after exposure to 0.5 mg/ml and 1 mg/ml TSE, respectively, for 3 days. Exposure to nicotine at these concentrations resulted in negligible cell death. Only exposure at higher nicotine concentrations (>3 mg/ml) did cell death became apparent (Fig. 1). TSE decreased cell viability of human disc cells in a dose-dependent manner, with the calculated lethal dose (LD50) of 0.8 mg/ml after a 72 h exposure. TSE is much more
Figure 1. TSE and nicotine alter disc cell morphology and decrease cell viability. (A) Effects of TSE and nicotine on hAF cell morphology as assessed by bright field microscopy. Cell viability at different concentrations of TSE (B) and nicotine (C) as determined by the MTT colorimetric assay16 and expressed as the percentage of unexposed control. Values are mean SE of n ¼ 4. JOURNAL OF ORTHOPAEDIC RESEARCH OCTOBER 2011
1588
VO ET AL.
toxic than nicotine as the latter requires 10-fold higher concentration to produce equivalent cell death (Fig. 1B and C). TSE is estimated to contain about 9% of nicotine,15,20 hence the observed cytoxicity is most likely due to smoke constituents other than nicotine. TSE Decreased Matrix Protein Synthesis by Human AF and NP Cells Three days exposure to free base nicotine at 0.3 mg/ ml, a concentration many folds higher than what is found in plasma of heavy smokers,21 had no significant effects on either collagen or proteoglycan (PG) synthesis by hNP cells (Fig. 2). In contrast, 3 days exposure to TSE caused a dose-dependent decrease of both PG and collagen syntheses by human disc cells. Collagen and PG syntheses by hAF cells were reduced by 30% at 0.05 mg/ml TSE and 40–50% at 0.5 mg/ml TSE (Fig. 2). Interestingly, TSE exposure under our conditions had little effect on PG synthesis by hNP cells grown on monolayer cultures, while collagen synthesis was reduced by TSE in a concentration-dependent manner in hNP cells. Overall, TSE negatively impacts matrix synthesis by human IVD cells much more severely than nicotine. TSE Enhanced Expression of MMPs and Suppressed Matrix Structural Genes To investigate whether TSE and nicotine modulates expression of genes that regulate disc matrix homeostasis, we measured the mRNA levels of selected catabolic and matrix structural genes. At 0.1 mg/ml, TSE exposure decreased matrix genes expression (aggrecan by 60%, and collagen type 1 by 80%), and the anti-catabolic factors (TIMP1 and TIMP3 by 50%; Fig. 3C), while it increased gene expression of the matrix metalloproteinases (MMP1 by 80-fold, MMP3
by 6-fold, ADAMTs4 4-fold) in hAF cells (Fig. 3B). In contrast, nicotine exposure produced a much more modest effect. hAF cells exposed to 0.1 mg/ml nicotine showed a slight increase in TIMP1 and TIMP3 expression, a modest decrease in aggrecan (50%) and collagen type 1 (20%) expression, and no significant change in MMP1 and MMP3 gene expression (Fig. 3A). Interestingly, TSE exposure has a greater impact on hAF than hNP cells in monolayer cultures. For instance, TSE exposure increased expression of MMP1 (82-fold) and MMP3 (sixfold) in hAF cells, while the same treatment on hNP cells only caused an eightfold increase of MMP1 and 50% increase in MMP3 gene expression. Moreover, TIMP1 gene expression was downregulated by twofold in hAF cells but remained unaffected in hNP cells after TSE exposure (Fig. 3C). Effects of TSE and Nicotine on Expression of the Inflammatory Mediator PGE2 We have previously demonstrated that the PGE2 and PGF2a negatively impacts disc matrix homeostasis.22 Since tobacco smoking upregulates prostaglandins in other tissue types, we investigated whether TSE would also stimulate disc cell prostaglandin production. Indeed, TSE at 0.1 mg/ml increased the concentration of PGE2 in culture conditioned media fourfold in hAF cells and sixfold in hNP cells (Fig. 4). 0.1 mg/ml TSE also increased conditioned media PGF2a fivefold (hAF cells) and threefold (hNP cells), while exposure to 0.1 mg/ml nicotine produced no significant changes in the levels of PGE2 (Fig. 4) or PGF2a (data not shown) in the culture conditioned media. TSE-induced increase of PGF2a and PGE2 correlated with the increase (threefold) of cyclooxygenase 2 (COX-2) gene expression, a key enzyme for prostaglandin biosynthesis (Fig. 4, inset). Exposure of hAF or hNP cell cultures to 0.1 mg/ml
Figure 2. TSE suppressed proteoglycan and collagen synthesis. Disc annulus fibrosus cells grown on monolayer culture [AF(m)], and nucleus pulposus cells on monolayer [NP(m)] or three-dimensional alginate bead [NP(b)] cultures were exposed to different concentrations of TSE or nicotine for 3 days and proteoglycan (A) and collagen (B) synthesis were assayed by 35 Sulfate and 3H proline incorporation, respectively, as described in Materials and Methods Section. Dash line, untreated control. Values for collagen (n ¼ 3) and proteoglycan (n ¼ 5) synthesis are mean SE with asterisk () denoting statistical difference versus control.
JOURNAL OF ORTHOPAEDIC RESEARCH OCTOBER 2011
TOBACCO SMOKING AND DISC CELL METABOLISM
1589
Figure 3. Effects of TSE and nicotine on expression of matrix and MMP genes. (A) Comparing the effects of nicotine versus TSE exposure on gene expression. Semiquantitative RT-PCR determination of mRNA expression by hAF monolayer cell culture of matrix aggrecan, collagen I, and the anti-catabolic TIMP1and TIMP3 genes in the presence of 0.1 mg/ml TSE (black bars) or 0.1 mg/ml nicotine (gray bars). Inset, effects on MMP1 and MMP3 gene expression. (B,C) Comparing the differential gene expression response by hAF versus hNP cells to TSE exposure. Effects on gene expression of the catabolic factors MMP and ADAMTS (panel B) and the anti-catabolic factors TIMPs and matrix genes (panel C). hNP (gray) and hAF (black) cells grown on monolayer cultures were exposed to 0.1 mg/ ml TSE for 72 h. Y-axis, level of mRNA expression normalized to untreated control (dash line) which is taken as 1. Dash line, untreated control. Values are mean SE of n ¼ 5 with asterisk () denoting statistical difference versus control.
nicotine did not significantly affect COX-2 expression or PGE2 and PGF2a production (Fig. 4, inset).
DISCUSSION Several hypotheses have been put forth to explain how tobacco smoking increases IDD and back pain. Frymoyer et al.23 suggested that repeated abrupt increases in intradiscal pressure from frequent chronic cough among smokers injure the discs mechanically. Holm and Nachemson9 hypothesized that tobacco
Figure 4. TSE increased COX-2 expression and prostaglandin production in disc cells. PGE2 production in cell culture condition media increased sixfold (hAF, black bars) and fourfold (hNP, gray bars) after 0.1 mg/ml TSE exposure. Exposure to 0.1 mg/ml nicotine yielded no significant changes in PGE2 level in cell culture conditioned media. Inset, COX-2 mRNA expression was unchanged after 3 days exposure to 0.1 mg/ml nicotine (gray) and increased about threefold with 0.1 mg/ml TSE exposure as compared to untreated control. Dash line, untreated control. Values for COX-2 mRNA expression (n ¼ 6) and PGE2 (n ¼ 4) are mean SE with asterisk () denoting statistical difference versus control.
smoking increases IDD primarily through nicotineinduced vasoconstriction. The avascular nature of IVD and its relatively poor nutrition supply makes it more susceptible to degeneration under nicotine-induced vasoconstriction, which would further limit nutrient and waste exchange. Tobacco smoking also increases CO-hemoglobin content24 and accelerates aortic atherosclerosis and stenosis of the orifices of the arteries feeding the spine,25,26 both of which could negatively impact disc nutrition. Smoking increases serum degradative activity by releasing proteolytic enzymes from neutrophils in alveolar capillaries, and by inhibiting the activity of alpha-1-antiprotease, a potent protease inhibitor.27,28 Based on this observation, Fogelholm and Alho29 proposed that the high serum proteolytic activity of cigarette-smokers gets access to a previously degenerated neovascularized disc and accelerates the degenerative process. A commonality in all of these hypotheses is that tobacco smoking contributes to IDD through indirect mechanisms. Our study tests an alternative hypothesis that tobacco smoking may influence IDD through direct effects of smoke chemical compounds on disc cells. Several lines of evidence support this hypothesis. Watersoluble components of tobacco smoke, for example, quinones, acrolein, and saturated aldehydes are prooxidant substances that have the potential to increase cellular production of reactive oxygen species (ROS).30,31 These soluble compounds reach the systemic circulation and directly promote oxidative stress in all systemic vascular beds and their neighboring tissues.32–34 The presence of tobacco smokeinduced DNA damage in a variety of tissues, bone marrow, bladder, and urethra, for example, which are far from the primary respiratory sites of initial contact, suggest infiltration of harmful TSE components JOURNAL OF ORTHOPAEDIC RESEARCH OCTOBER 2011
1590
VO ET AL.
into these cells.35–37 It is plausible that infiltration of TSE also occurs in disc tissue as hAF is peripherally vascularized and that certain smoke constituents can diffuse through the endplate into the hNP. Moreover, aged and degenerated discs, especially those found in older smokers, would have increased neovascularization38–40 as a consequence of tissue cracks and tears which would in turn enhance the exposure of disc cells to the soluble TSE chemicals in the circulatory system. Exposure of resident disc cells to TSE could induce DNA damage which is recently demonstrated to play a causal role in degenerative changes in discs.41 We tested this alternative hypothesis by exposing disc cells in culture directly to smoke condensate. This caused a dose-dependent decrease in disc cell viability and dramatic perturbation of matrix cell metabolism. Tobacco smoke exposure decreased expression of matrix aggrecan and the anti-catabolic factors TIMP1 and TIMP3, while increasing MMP expression, resulting in a net catabolic imbalance. TSE treatment of disc cells also increased PGE2, a prostaglandin that downregulates disc matrix synthesis.22 Since TSE exposure produced a dose-dependent decrease in prostaglandin and collagen syntheses (Fig. 2), it is possible that this is mediated in part through the prostaglandin pathway. These data are consistent with those previously reported in a rat model in which smoke exposure increased disc tissue IL-1b,42 a proinflammatory cytokine known to upregulate COX-2 and PGE2. Our in vitro results support the idea that TSE could induce an overall net loss of disc matrix proteoglycan as consequence of suppressed synthesis and enhanced catabolism as well as potential cytotoxic loss of cells. The anabolic/catabolic imbalance might explain how TSE contributes to IDD and prolongs the recovery time after disc surgery. It should be noted that 72 h time point was chosen for our study because 3 days exposure had the most dramatic effects on disc cell metabolism with minimal cell death under the TSE concentrations tested. Longer exposure resulted in greater cell death and shorter exposure yielded less dramatic effects on cell metabolism (data not shown). In our study, TSE affects disc cell metabolism more dramatically than nicotine. Nicotine exposure at 0.3 mg/ml for 3 days had no significant effect on gene expression of catabolic factors, such as MMPs or PG matrix synthesis. This is consistent with the report by Akmal et al.12 using bovine NP cell culture in which the investigators found minimal change in sulfated GAG content during the first 3 days of exposure; significant changes were observed only in nicotine treatment longer than 3 days. Despite this short-termed exposure, TSE treatment adversely affects all facets of disc cell metabolism, including PG synthesis after 3 days of exposure. This is not surprising as nicotine is just one of the many thousands of compounds found in TSE, many of which are proven carcinogens and toxins.43 It is also interesting to note that TSE appears JOURNAL OF ORTHOPAEDIC RESEARCH OCTOBER 2011
to affect hAF cells more that hNP cells. For example, matrix gene expression was suppressed while MMP expression was induced more profoundly in hAF cells than NP (Fig. 3). It is possible that the differential sensitivities are simply due to different hAF and hNP cell phenotypes. The significance of this observation still awaits further investigation. Use of a complex undefined mixture like TSE has the advantage of containing all of the compounds inhaled by smokers. However, the very complexity of TSE makes it difficult to identify the specific chemical component(s) mediating the effects observed in our study. On the other hand, exposure to nicotine has the advantage that it is a well-defined biologically relevant agent, but its effects might not be representative of those triggered by smoking which produces other chemicals in addition to nicotine. Other limitations of our study include the fact that TSE differs from gaseous smoke which makes it difficult to determine the dose and exposure time that best recreate the effects of smoking in vivo. Additionally, cell culture experiments cannot duplicate all of the components of the microenvironment found in disc tissue in vivo in which the extracellular matrix may protect cells from this effect or exacerbate it. Finally, our study employed short-term exposure at relatively high TSE concentrations, which might not extrapolate to long-term, low concentrations inhaled by smokers. Despite these limitations, the use of TSE in a cell culture system allows us to determine the direct influence of TSE on disc cellular functions while eliminating other complex variables, and thus has the potential to uncover important biological pathways.
ACKNOWLEDGMENTS This work was supported in part by The Albert B. Ferguson, Jr. MD Orthopaedic Fund of The Pittsburgh Foundation. We also gratefully acknowledge the support of the University of Pittsburgh Department of Orthopaedic Surgery and the Ferguson Laboratory for Orthopaedic and Spine Research. We thank Lou Duerring for her administrative assistance. N.V.V. is supported by NIH (R21 AG033046).
REFERENCES 1. Jha P, Ranson MK, Nguyen SN, et al. 2002. Estimates of global and regional smoking prevalence in 1995, by age and sex. Am J Public Health 92:1002–1006. 2. Adhikari B, Kahende J, Malarcher A, et al. 2008. Smokingattributable mortality, years of potential life lost, and productivity losses—United States, 2000–2004. Morb Mortal Wkly Rep 57(45): 1226–1228. 3. Gerberding JL, CDC. 2004. Surgeon General’s Report. The Health Consequences of Smoking. 4. Battie MC, Videman T, Gil K, et al. 1991. Volvo Award in clinical sciences. Smoking and lumbar intervertebral disc degeneration: an MRI study of identical twins. Spine (PhilaPa 1976) 16:1015–1021. 5. Mattila VM, Saarni L, Parkkari J, et al. 2008. Early risk factors for lumbar discectomy: an 11-year follow-up of 57,408 adolescents. Eur Spine J 17:1317–1323.
TOBACCO SMOKING AND DISC CELL METABOLISM 6. Hanley EN Jr, Shapiro DE. 1989. The development of lowback pain after excision of a lumbar disc. J Bone Joint Surg Am 71:719–721. 7. Glassman SD, et al. 2000. The effect of cigarette smoking and smoking cessation on spinal fusion. Spine (PhilaPa 1976) 25:2608–2615. 8. Ogawa T, et al. 2005. Alteration of gene expression in intervertebral disc degeneration of passive cigarette-smoking rats: separate quantitation in separated nucleus pulposus and annulus fibrosus. Pathobiology 72:146–151. 9. Holm S, Nachemson A. 1988. Nutrition of the intervertebral disc: acute effects of cigarette smoking. An experimental animal study. Ups J Med Sci 93:91–99. 10. Uematsu Y, Matuzaki H, Iwahashi M. 2001. Effects of nicotine on the intervertebral disc: an experimental study in rabbits. J Orthop Sci 6:177–182. 11. Izzotti A, et al. 2001. Modulation of biomarkers by chemopreventive agents in smoke-exposed rats. Cancer Res 61: 2472–2479. 12. Akmal M, et al. 2004. Effect of nicotine on spinal disc cells: a cellular mechanism for disc degeneration. Spine (PhilaPa 1976) 29:568–575. 13. Thompson JP, et al. 1990. Preliminary evaluation of a scheme for grading the gross morphology of the human intervertebral disc. Spine 15:411–415. 14. Studer RK, et al. 2007. p38 MAPK inhibition in nucleus pulposus cells: a potential target for treating intervertebral disc degeneration. Spine 32:2827–2833. 15. Gensch E, et al. 2004. Tobacco smoke control of mucin production in lung cells requires oxygen radicals AP-1 and JNK. J Biol Chem 279:39085–39093. 16. Mosmann T. 1983. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J Immunol Methods 65:55–63. 17. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(delta delta C(T)) method. Methods 25:402–408. 18. Studer RK, Gilbertson LG, Georgescu H, et al. 2008. p38 MAPK inhibition modulates rabbit nucleus pulposus cell response to IL-1. J Orthop Res 26:991–998. 19. Gilbertson L, et al. 2008. The effects of recombinant human bone morphogenetic protein-2, recombinant human bone morphogenetic protein-12, and adenoviral bone morphogenetic protein-12 on matrix synthesis in human annulus fibrosis and nucleus pulposus cells. Spine J 8:449–456. 20. Lemjabbar-Alaoui H, et al. 2006. Wnt and Hedgehog are critical mediators of cigarette smoke-induced lung cancer. PLoS ONE 1:e93. 21. Benowitz NL. 1992. Cigarette smoking and nicotine addiction. Med Clin North Am 76:415–437. 22. Vo NV, Sowa GA, Kang JD, et al. 2010. Prostaglandin E2 and prostaglandin F2alpha differentially modulate matrix metabolism of human nucleus pulposus cells. J Orthop Res 28:1259–1266. 23. Frymoyer JW, et al. 1980. Epidemiologic studies of low-back pain. Spine (PhilaPa 1976) 5:419–423. 24. Andersson MF, Moller AM. 2010. Assessment of carbon monoxide values in smokers: a comparison of carbon monoxide in expired air and carboxyhaemoglobin in arterial blood. Eur J Anaesthesiol 27:812–818.
1591
25. Auerbach O, Garfinkel L. 1980. Atherosclerosis and aneurysm of aorta in relation to smoking habits and age. Chest 78:805–809. 26. Kauppila LI, Penttila A, Karhunen PJ, et al. 1994. Lumbar disc degeneration and atherosclerosis of the abdominal aorta. Spine (PhilaPa 1976) 19:923–929. 27. Donaldson K, Brown GM, Drost E, et al. 1991. Does cigarette smoke enhance the proteolytic activity of neutrophils? Ann NY Acad Sci 624:325–327. 28. Laurent P, Bieth JG. 1985. Cigarette smoke decreases the rate constant for the association of elastase with alpha 1proteinase inhibitor by a non-oxidative mechanism. Biochem Biophys Res Commun 126:275–281. 29. Fogelholm RR, Alho AV. 2001. Smoking and intervertebral disc degeneration. Med Hypotheses 56:537–539. 30. Bock FG, Swain AP, Stedman RL. 1972. Carcinogenesis assay of subfractions of cigarette smoke condensate prepared by solvent–solvent separation of the neutral fraction. J Natl Cancer Inst 49:477–483. 31. Pryor WA, Stone K, Zang LY, et al. 1998. Fractionation of aqueous cigarette tar extracts: fractions that contain the tar radical cause DNA damage. Chem Res Toxicol 11:441– 448. 32. Celermajer DS, et al. 1993. Cigarette smoking is associated with dose-related and potentially reversible impairment of endothelium-dependent dilation in healthy young adults. Circulation 88:2149–2155. 33. Czernin J, Waldherr C. 2003. Cigarette smoking and coronary blood flow. Prog Cardiovasc Dis 45:395–404. 34. Raij L, DeMaster EG, Jaimes EA. 2001. Cigarette smokeinduced endothelium dysfunction: role of superoxide anion. J Hypertens 19:891–897. 35. Izzotti A, et al. 1999. Formation and persistence of nucleotide alterations in rats exposed whole-body to environmental cigarette smoke. Carcinogenesis 20:1499–1505. 36. Mohtashamipur E, Steinforth T, Norpoth K. 1988. Comparative bone marrow clastogenicity of cigarette sidestream, mainstream and recombined smoke condensates in mice. Mutagenesis 3:419–422. 37. Husgafvel-Pursiainen K. 2004. Genotoxicity of environmental tobacco smoke: a review. Mutat Res 567:427–445. 38. Kauppila LI. 1995. Ingrowth of blood vessels in disc degeneration. Angiographic and histological studies of cadaveric spines. J Bone Joint Surg Am 77:26–31. 39. Hirsch C, Schajowicz F. 1953. Studies on structural changes in the lumbar annulus fibrosus. Acta Orthop Scand 22:184– 231. 40. Ali R, Le Maitre CL, Richardson SM, et al. 2008. Connective tissue growth factor expression in human intervertebral disc: implications for angiogenesis in intervertebral disc degeneration. Biotech Histochem 83:239–245. 41. Vo N, et al. 2010. Accelerated aging of intervertebral discs in a mouse model of progeria. J Orthop Res 28:1600–1607. 42. Nemoto Y, et al. 2006. Histological changes in intervertebral discs after smoking and cessation: experimental study using a rat passive smoking model. J Orthop Sci 11:191– 197. 43. Hoffmann D, Hoffmann I, El-Bayoumy K. 2001. The less harmful cigarette: a controversial issue. A tribute to Ernst L. Wynder. Chem Res Toxicol 14:767–790.
JOURNAL OF ORTHOPAEDIC RESEARCH OCTOBER 2011
