Differential Expression of Three Catalase Genes in the Small Radish ...

Mol. Cells, Vol. 24, No. 1, pp. 37-44

Molecules and Cells ©KSMCB 2007

Differential Expression of Three Catalase Genes in the Small Radish (Rhaphanus sativus L. var. sativus) Soon Il Kwon, Hyoungseok Lee, and Chung Sun An* Department of Biological Sciences, Seoul National University, Seoul 151-747, Korea. (Received December 8, 2006; Accepted May 7, 2007)

Three catalase cDNA clones were isolated from the small radish (Raphanus sativus L.). Their nucleotide and deduced amino acid sequences showed the greatest homology to those of Arabidopsis. Genomic Southern blot analysis, using RsCat1 cDNA as a probe, showed that catalases are encoded by small multigene family in the small radish. Nondenaturing polyacrylamide gels revealed the presence of several catalase isozymes, the levels of which varied among the organs examined. The isozyme activities were assigned the individual catalase genes by Northern analysis using total RNA from different organs. The three catalase genes were differentially expressed in response to treatments such as white light, xenobiotics, osmoticum, and UV. Their expression in seedlings was controlled by the circadian clock under a light/dark cycle and/or in constant light. Interestingly, RsCat1 transcripts peaked in the morning, while those of RsCat2 and RsCat3 peaked in the early evening. Our results suggest that the RsCat enzymes are involved in defense against the oxidative stress induced by environmental changes. Keywords: Catalase; Circadian Clock; Light; Osmoticum; Small Radish; Xenobiotics.

Introduction Molecular oxygen, the major electron acceptor in biological systems, plays a vital role in metabolic processes, but when partially reduced it produces toxic reactive oxygen species (ROS) such as superoxide (O2●-), hydroxyl radicals (OH●), and hydrogen peroxide (H2O2) (Scandalios, 2005). ROS also function as signaling molecules in defenses against environmental stresses (Mittler, 2002), such as wounding (Orozco-Cardenas and Ryan, 1999), * To whom correspondence should be addressed. Tel: 82-2-880-6678; Fax: 82-2-872-1993 E-mail: [email protected]

pathogens (Grant and Loake, 2000), and cell death (Bethke and Jones, 2001). To minimize oxidative damage by ROS, all aerobes have evolved both enzymatic and nonenzymatic defense mechanisms. The antioxidant defense system includes enzymes such as catalase, superoxide dismutase (SOD), and peroxidase, and non-enzymatic antioxidants such as ascorbate, α-tocopherol and β-carotene. Catalase (H2O2: H2O2 oxidoreductase, EC 1.11.1.6) is a tetrameric heme-containing enzyme found in all aerobic organisms, which converts hydrogen peroxide to water and molecular oxygen (Scandalios, 2005). In plants, it aids in scavenging the H2O2 generated by photorespiration and by β-oxidation of fatty acids. Multiple isoforms of catalase are found in many plant species and are differentially regulated by spatial, developmental, and environmental factors (Esaka et al., 1997; Frugoli et al., 1996; Guan et al., 1995; Iwamoto et al., 2000; Lee et al., 2005; Mori et al., 1992; Redingaugh et al., 1988; Willekens et al., 1994a; Yi et al., 2003). Catalase activity and gene expression have been characterized in maize, Arabidopsis, and tobacco. In maize, three unlinked structural genes (Cat1, Cat2, and Cat3) encode distinct isozymes; CAT1 and CAT2 are found in the cytosol and/or in glyoxysomes/peroxisomes, and CAT3 in the mitochondrial fraction (Redinbaugh et al., 1990b). The catalases of maize provide an excellent model system for studying the differential regulation of plant genes during embryogenesis, and for examining their roles in normal plant development and in response to environmental stresses (Scandalios, 2005). Catalase activity is affected by many environmental signals, including light (Redinbaugh et al., 1990a) and temperature (Williamson and Scandalios, 1992). The expression of catalase genes is regulated temporally and spatially (Acevedo and Scandalios, 1991; Wadsworth and Scandalios, 1989) and is also controlled differentially by exogenously applied plant hormones and fungal toxin (Guan and Scandalios, 1995; Mylona et al., 1998; Williamson and Scandalios, 1992). The catalase multi-gene family in Arabidopsis includes three genes encoding individual subunits that asso-

38

Differential Expression of Radish Catalase Genes

ciate to form at least six isozymes that are activated by nondenaturing polyacrylamide gel electrophoresis. The levels of transcripts of the three genes show organ-specific expression patterns and are differentially affected by light, ozone, UV irradiation, and SO2 (McClung, 1997; Zhong and McClung, 1996). In Nicotiana plumbaginifolia, four catalase genes have been reported, and three of these were differentially expressed in various organs and regulated by spatial, developmental, and abiotic factors such as ozone, SO2, irradiation, light and temperature (Willekens et al., 1994a; 1994b; 1994c). Catalase-deficient plants are more sensitive to a variety of environmental stress factors and have been used to study the signaling function of hydrogen peroxide-related catalases in plants (Dat et al., 2003; Vandenabeele et al., 2004). Circadian rhythms of expression are common among living organisms including many eukaryotes and prokaryotes (Dunlap, 1999; Somers, 1999). A circadian rhythm is defined as a biological rhythm with a period of about 24 h that is entrained by light/dark cycles and temperature changes. In plants the clock controls a wide variety of processes: gene transcription, Ca2+ levels, CO2 exchange, stomatal opening, leaf movement, odor production, and enzyme activities (Somers, 1999). The expression of several catalase genes including maize cat3 (Redinbaugh et al., 1990a), N. plumbaginifolia cat1 (Willekens et al., 1994a), Arabidopsis cat2/cat3 (Zhong et al., 1994), and rice CatA (Iwamoto et al., 2000) are regulated by the circadian clock. The radish is a member of the same Brassicaceae family as Arabidopsis, and it is a well known model plant and a very useful vegetable. We isolated three catalase cDNAs from the radish (RsCat1, 2, 3). We describe their expression patterns in different organs, and in response to various environmental (or chemical) treatments, such as osmoticum, xenobiotics, UV, as well as their circadian expression under light-dark conditions.

Materials and Methods Plant materials and treatments Small radish (Raphanus sativus L.) seeds were purchased from the TAKII Seed Company (Japan) and stored at 4°C. The seeds were germinated in the dark at room temperature for up to 3−4 days, transferred to soil, and grown in a growth chamber at 30°C with a 14-h light (150−160 mol/m2/s)/10-h dark cycle. For UV treatment of seedlings, seeds were germinated at 25°C for four days in the dark and transferred to growth chambers under UV (60 μW/cm2) for various times. For chemical treatment, they were placed in a dark chamber at 25°C for at least 3−4 days to ensure uniform germination before exposure to various chemical treatments. Radish seedlings (about 3 cm in height) were incubated in liquid MS medium with osmoticum (10% sucrose, 10% mannitol and 100 mM NaCl) for the indicated times. In experiments in which

Table 1. Primer sequences for the amplification of Catalase, CABII and 18S rRNA. 1. Primers used for amplification of catalase coding region RsCatF; AGGGC(ACT)AAGGG(ACT)TTCTT(CT)GA RsCatR; TCCTC(ATG)GGCCA(TGC)GTCTTGGT 2. Primers used for amplification of catalase 3′ UTRs RsCat1F; CTGAACGTGAGACCAAGCATC RsCat1R; TAACAGCATGAGACAAAACCA RsCat2F; CGTCTCAATGTAAGGCCAAGCA RsCat2R; TCAAATAAAATAATAGTCGTCGAA RsCat3F; CTGAACGTGAGGCCAAGCATC RsCat3R; TAGTACTGCGTTTATTTTCATTGA 3. Primers used for amplification of CABII coding region RsCABIIF; CT(CT)GACTA(CT)TTGGG(GC)AACCC RsCABIIR; AACAT(AG)GAGAACAT(AG)GCCA 4. Primer used for amplification of 18S rRNA rRNAF; TACCTGGTTGATCCTGCC rRNAR; CCAATGGATCCTCGTTAA

bp 680

257 311 284

249

550

xenobiotics (paraquat, plumbagin, and cercosporin) were used, 50 μM methyl viologen (Sigma), 50 μM plumbagin (Sigma), and 25 μM cercosporin (Sigma) were sprayed on the leaves of young plants (about 12 cm length) grown in soil for two weeks. To study circadian expression, after germination for two weeks in continuous darkness, seedlings were subjected to photoperiodic treatments [(i) 12 h L/12 h D, (ii) continuous light (iii) continuous dark] and harvested every 4 h. The samples were frozen immediately in liquid nitrogen, stored at −80°C and analyzed as previously described (Kwon and An, 2003). Probe preparation cDNA synthesized from seedling mRNA (or genomic DNA) was used as template for PCR reactions. Degenerate oligonucleotide primers (Table 1) corresponding to two conserved regions of plant catalase genes were used as primers (Guan and Scandalios, 1996). The PCR program was as follows: denaturation at 94°C for 5 min followed by 30 cycles of PCR consisting of annealing at 45°C for 1 min, polymerization at 72°C for 1 min, and denaturation at 94°C for 45 s. PCR products were cloned into the SmaI site of pUC19 vector. Enzyme activity on native gels For the analysis of catalase activity, cell-free protein extracts in 50 mM potassium phosphate buffer (pH 7.0) were centrifuged at 13,000 rpm at 4°C for 10 min. CAT isozymes were separated on 7% non-denaturing polyacrylamide gels at 120 V for 15 h at 4°C, and the gels were stained for CAT activity (Gregory and Fridovich, 1974). Protein concentrations were measured by the Bradford method (Bradford, 1976). Construction and screening of a small radish cDNA library Total RNA was isolated by the acid guanidinium thiocyanate/phenol/chloroform method (Chomczynski and Sacchi, 1987). cDNA

Soon Il Kwon et al.

39

library construction and gene screening have been described (Kwon and An, 2003). The sequences of the selected clones were analyzed with the BLAST program and the Expasy Molecular Biology Server. Phylogenetic analysis was carried out using the PHYLIP program. Southern and Northern analysis Genomic DNA was prepared from seedling of small radish by the method of Ausubel et al. (1987). Gel blotting and filter hybridization were as described previously (Kwon and An, 2003). Total RNA was extracted from small radish seedling or tissues using RNA-PLUS extraction solution (Quantum). Northern blots were hybridized with random-primed DNA probes synthesized with the Prime-a-Gene Labeling System (Promega) using the gene-specific 3′-untranslated regions of the three catalase cDNA clones, CABII, and PCR-amplified fragments of 18s rRNA of the small radish as templates. Hybridization was carried out at 62°C for 20 h; the filters were then washed, and bands visualized by autoradiography at −80°C.

Results and Discussion Isolation and characterization of RsCat cDNA clones In order to isolate cDNA clones encoding catalase from Raphanus sativus, cDNA synthesized from mRNA was amplified by PCR using a pair of degenerate primers (Table 1). One band corresponding to the expected size of about 700 bp was amplified and sequenced. Two different PCR products were amplified and subcloned from this band. Their nucleotide sequences showed 93% homology with those of Arabidopsis catalases cat2 and cat3 (data not shown). By screening the small radish cDNA library using these clones as probes, we finally identified three catalase clones, which were designated RsCat1, RsCat2, and RsCat3 (Fig. 1). These encode proteins of 493 aminoacid residues, with molecular masses of 56.7, 56.8, 56.7 kDa, respectively. The deduced amino acid sequence of RsCat1 has 97% identity with Cat2 of Arabidopsis, while the deduced amino acid sequences of RsCat2 and RsCat3 showed the highest (95%) identity to Arabidopsis Cat3. The homology values of the three catalase genes at the nucleotide level range from 75% to 95% for the coding regions, and 43% to 55% for the 3′UTRs (data not shown). The specificity of each (full-length) 3′-UTR sequence as a probe for use in molecular analysis was confirmed by Southern analysis (Fig. 2A). As shown in Fig. 1, all the amino acids involved in catalytic activity (His-65, Ser104, and Asn-138), and the proximal and distal heme binding sites (Val-64, Arg-102, Tyr-105, Phe-143, Phe151, Pro-326, Arg-344, and Tyr-348) are conserved in the three catalases (Fita and Rossman, 1985). We also identified a putative peroxisome targeting sequence (SRL) nine amino acids from the carboxyl terminus. The S-R/H-L motif in plant catalases is most likely a functional transit

Fig. 1. Alignment of the deduced amino acid sequences of the three catalase genes isolated from small radish. Sequences corresponding to the DNA segments used in PCR experiments are underlined. The peroxisome targeting sequence is boxed. Amino acid residues involved in catalytic activity (●), proximal heme binding (♦), and distal heme binding (★) are indicated. The GenBank accession numbers of RsCat1, RsCat2, and RsCat3 are AF031318, AF139538, and AF139539, respectively.

sequence because plant catalases are generally localized in peroxisomes (Gould et al., 1989). Recently, pumpkin catalase with QKL and SHL triplets in its C-terminal 13 amino acid sequence (QKLASHLNVRPSI) was shown to be targeted to peroxisomes (Kamigaki et al., 2003). Phylogenetic analysis indicates that plant catalase fall into three major classes (Scandalios, 1997). RsCat1 clustered with the Class I enzymes of A. thaliana (Cat1 and Cat2), P. sativum, and G. max, while RsCat2 and RsCat3 clustered with A. thaliana Cat3, N. plubaginifolia Cat2, and N. tabacum Cat1 in Class II. Class III monocot-specific catalases include that of O. sativa, H. vulgare Cat2, and maize Cat3. To investigate the number of catalase gene copies in the radish genome, we used a cDNA fragment correspond-

40


A

B

C

Fig. 2. Southern analysis showing the specificity of the 3-UTR sequences of the small radish catalase genes. A. Twenty nanograms of the cDNA clones of RsCat1, RsCat2, and RsCat3 run on 1.0% (w/v) agarose gels and blotted onto nylon membranes. Each membrane was probed with the 32P-labeled 3’UTR of RsCat1, RsCat2, or RsCat3. B. Zymogram analysis of catalase activity in different organs. Samples (10 μg of crude soluble protein) were isolated from various organs of seedlings and loaded onto 7% acrylamide gels. L, leaf; YC, yellow cotyledon; GC, green cotyledon; EH, etiolated hypocotyls; RH, red hypocotyls; R, root. C. Specific accumulation of catalase transcripts in different organs. Lanes: Y/C, yellow cotyledon; G/C, green cotyledon. Total RNA (30 μg per lane) was separated by gel electrophoresis and blotted onto nylon membranes. Each membrane was probed with the 32P-labeled 3’UTRs of RsCat1, RsCat2, or RsCat3. Details of hybridization and washing conditions are in Materials and Methods.

ing to part of the RsCat1 coding region as probe in a genomic DNA gel-blot analysis. Several bands with sizes between 1.5 and 10 kb were detected (data not shown), indicating that catalases are encoded by a small gene family. In-gel activity and expression of catalase genes in various tissues We examined small radish catalase activity by isozyme gel analysis and detected several catalase isozymes whose distribution was tissue-dependent, suggesting the existence of multiple CAT genes, each encoding a different catalase isozyme (Fig. 2B). About five isozymes were detected in leaves, four in hypocotyls, three in cotyledons, and two in roots. The lowest molecular weight isozyme

was found in all tissues and was particularly abundant in leaves and cotyledons and hence may perform a photorespiratory role. In an attempt to correlate the expression of individual catalase genes with the organ-specific pattern of isozymes, we performed an RNA gel blot analysis of different tissues (Fig. 2C). The RsCat1 transcript was weakly expressed in leaves and present at an increased level in both Y/C (yellow cotyledon) and G/C (green cotyledon). RsCat2 transcripts were more abundant in etiolated hypocotyls (EH) and red hypocotyls (RH) than in cotyledons and were not present in roots. RsCat3 transcripts were the most abundant in leaves, more numerous in RH than EH and expressed to the same extent in Y/C and G/C. None of the three catalases were abundant in roots. Interestingly, although the RsCat2 amino acid sequence was very similar to that of RsCat3, their tissue expression patterns and responses to light and xenobiotics were clearly different. Expression of RsCat2 was higher in hypocotyls than in cotyledons, and the enzyme may play a role in reducing oxidative damage to the vascular system. RsCat3 transcript levels were higher in red hypocotyls than in etiolated hypocotyls, and may therefore be increased by light. RsCat2 transcripts are not present in leaves, unlike RsCat3 which is highly expressed (Fig. 2C). We suggest therefore that RsCat3 expression is induced by light, and that RsCat3 is involved in photorespiration in leaf peroxisomes. RsCat2 may be expressed at a basal level in leaves under normal conditions, but is dramatically induced by environmental stresses, especially xenobiotics. In addition, we think the bottom dark band is RsCAT1 because this band matches the pattern of expression of RsCat1; the middle and top bands may be RsCAT3 and RsCAT2, respectively, based on the expression pattern of their transcripts. Tissue-specific expression and activity of catalase genes has been reported in many plants, such as Arabidopsis, maize, N. plumbaginifolia, pumpkin, rice, and hot pepper (Esaka et al., 1997; Frugoli et al., 1996; Iwamoto et al., 2000; Kwon and An, 2001; Redingaugh et al., 1988; Willekens et al., 1994a). Effects of xenobiotics and osmoticum on catalase transcripts Xenobiotics accept electrons from the electron transport chains in chloroplasts and mitochondria and reduce oxygen to the superoxide radical. Hence, H2O2 production during xenobiotic stress is thought to occur mainly outside peroxisomes. The polyketide toxin, cercosporin, when activated by light, is converted to an electronically excited triplet state, which can react with oxygen to produce singlet oxygen and superoxide radicals (Scandalios, 1997). To investigate the regulation of the three catalase genes in response to xenobiotics, we used several compounds that increase cellular ROS. Changes in catalase transcript levels were observed after spraying leaves with paraquat (PQ), plumbagin (Plu), and cercosporin (Cer) (Fig. 3A). PQ and Plu had the most drastic effect on RsCat1 and RsCat2 transcripts, and none of

Soon Il Kwon et al.

41

A

B

C

Fig. 3. Northern analysis of catalase gene expression in response to redox-cycling agents and osmoticums. A. Leaves grown for two weeks in the light were sprayed with 5 × 10−5 m paraquat (PQ), plumbagin (Plu), and cercosporin (Cer) for 24 h in the light. B. Etiolated seedlings were incubated in MS medium supplemented with 10% sucrose and 10% mannitol (Mann) for 24 h. C. They were then incubated in MS medium supplemented with 100 mM NaCl for various times (minutes). Total RNA (20 μg per lane) was fractionated by gel electrophoresis and blotted onto nylon membranes. Details of hybridization and washing conditions are in Materials and Methods.

these compounds affected RsCat3 expression. Cer had the most effect on RsCat2, induced RsCat1 slightly, and had a small repressive effect on RsCat3. Based on the results with plant catalases such as those of hot pepper and cotton (Bellaire et al., 2000; Lee and An, 2005), the specific induction of RsCat1 and RsCat2 by redox-cycling agents may be to the result of their localization in peroxisomes; other isozymes not considered here may be located in other organelles such as chloroplasts. The regulation of antioxidant enzymes by osmotic stress and salt treatment has been examined in several plants (Bellaire et al., 2000; Guan et al., 2000; Williamson and Scandalios, 1992). During osmoticum treatment of small radish seedlings, RsCat2 transcript levels increased in response to sucrose and mannitol treatment, while RsCat1 was slightly induced by salt stress (Figs. 3B and 3C). Accumulation of catalase transcripts in response to UV

Fig. 4. Northern analysis of catalase genes expression in response to U.V. Seedlings were exposed to U.V. for the indicated times. Details of blotting, hybridization, and washing conditions are in Materials and Methods.

stress The three catalase transcripts were differentially affected by UV treatment of young seedling: RsCat1 was induced within an hour whereas RsCat2/3 were only induced clearly after 6 h (Fig. 4). This UV response pattern is similar to that of the catalase genes of Nicotiana plumbaginifolia (Willekens et al., 1994b) and maize (Boldt and Scandalios, 1997). Small radish RsCat1 probably responds directly to UV, whereas RsCat2 and RsCat3 may respond indirectly to UV-generated metabolic changes or stress. The loss of photosynthetic activity in response to UV-B and PSII seems to be the major stimulus (Renger et al., 1989; Strid et al., 1990). As a consequence, UV-B exposure leads to the generation of ROS such as hydrogen peroxide from many sources and activates parallel signaling pathways mediating the responses of specific genes to UV-B. A light-controlled rhythm of accumulation of catalase mRNAs The expression of several catalase genes is regulated by circadian rhythms (Zhong et al., 1994). This suggests that catalase expression results from the integration of exogenous signals, such as light, and of endogenous developmental and spatial signals. To see whether the catalase genes were expressed in circadian fashion we measured mRNA abundances under various light conditions. Expression of the three catalase transcripts showed typical circadian rhythms under a 12 h L/12 h D period (Fig. 5A) and in continuous light (Fig. 5B), but expression did not appear to be rhythmic in continuous dark (Fig. 5C). Interestingly, levels of RsCat1 mRNA peaked in the morning, while those of RsCat2 mRNA did so in the early evening. The expression pattern of RsCat1 gene is similar to that of the majority of clock-regulated plant genes, such as those encoding the chlorophyll a/b binding proteins (CAB) and nitrate reductase (NIA) (McClung and Kay, 1994). Consistent with their “morning-specific” expression, each of these genes, including CaCat1 (Kwon and An, 2001), N. plumbaginifolia Cat1, and Arabidopsis Cat2 (Willekens et al., 1994a; Zhong et al., 1994) is positively regulated by light (McClung and Kay, 1994) and has the function of scavenging H2O2 generated by the

42


A

A

B

C

D

B

C

Fig. 5. Differential accumulation of RsCat1 and RsCat2 transcripts in small radish seedlings grown under (A) 12 h L/12 h D, (B) continuous light, and (C) continuous dark for 3 d. Seedling material was collected every 4 h for 72 h. Total RNA was extracted, and Northern hybridization was performed using genespecific probes. Filters were re-probed with a 18S ribosomal DNA probe as loading control, and the small radish cab2 probe showing circadian rhythm, as a control for a typical photosynthetic gene. The light and dark periods as well as the time points are indicated by bars and times in hours, respectively, above the Northern blots.

photorespiratory pathway. The early evening RsCat2 transcript pattern resembles that of several RNA-binding protein genes (Carpenter et al., 1994), and is similar to the patterns of the maize (Acevedo et al., 1991) and Arabidopsis (Zhong and McClung, 1996) Cat3 genes. As these “evening-specific” catalase genes have a shoot-preferential expression pattern, we suggest that they play a role in the degradation of H2O2 in plant shoot cells in the dark (Redinbaugh et al., 1990a). We measured mRNA abundances in the cotyledon and hypocotyls of radish seedling grown (1) under a 12 h L/12 h D period and (2) in continuous dark, and found that all three catalase transcripts exhibited circadian expression in the cotyledons of seedlings maintained under a 12 h L/12 h D photoperiod (Fig. 6A), but not in continuous dark (Fig. 6B). Although hypocotyl catalase transcripts failed to display circadian rhythmic expression regardless of photoperiodicity (Fig. 6C), their

Fig. 6. Differential accumulation of RsCat1 and RsCat2 transcripts in cotyledons under a 12 h L/12 h D cycle (A) and in continuous dark (B) and in hypocotyls grown under a 12 h L/12 h D cycle (C) and in continuous dark (D) for 2 d. Cotyledon and hypocotyl material was collected every 4 h for a period of 48 h. Total RNA was extracted, and Northern hybridization was performed using probes specific for each gene. Filters were reprobed with an 18S ribosomal DNA probe as loading control, and the small radish cab2 probe. The light and dark periods as well as the time points are indicated by bars and times in hours, respectively, above the Northern blots.

levels gradually declined during a following dark period (Fig. 6D). The RsCat3 circadian expression pattern was almost the same as that of RsCat2 in all experimental conditions (data not shown). Our findings suggest first, that clock receptors related to circadian expression of the RsCat2 transcript are only present in the cotyledon, not in hypocotyls. Second, RsCat2 transcript expression is down-regulated with time in the etiolated hypocotyls of seedlings grown in the continuous dark. Because it is known that photoreceptors (cryptochromes) inhibit hypocotyl elongation (Ahmad and Cashmore, 1997), we suggest that when CRY1 is expressed, hypocotyls elongation is inhibited and catalase expression is induced. However, if CRY1 is not induced, hypocotyls elongation is not inhibited, and catalase expression is gradually repressed in continuous dark. In conclusion, our results show that the three catalase genes isolated from small radish fulfill detoxifying roles by removing ROS that are formed by the metabolic activities of cellular organelles. Further experiments should clarify the overall roles of the different catalase genes in oxidative stress.

Acknowledgments This work was supported in part by a grant from the Korea Science and Engineering Foundation (98-040105-01-3) to C. S. An. We thank Dr. Ho Bang Kim and Sharon Pike for critical reading of the manuscript.

Soon Il Kwon et al.

References Acevedo, A. and Scandalios J. G. (1991) Catalase and superoxide dismutase gene expression and distribution during stem development in maize. Dev. Genet. 12, 423−430. Acevedo, A., Williamson, J. D., and Scandalios, J. G. (1991) Photoregulation of the Cat2 and Cat3 catalase genes in pigmented and pigment-deficient maize: the circadian regulation of Cat3 is superimposed on its quasi-constitutive expression in maize leaves. Genetics 127, 601−607. Ahmad, M. and Cashmore, A. R. (1997) The blue-light receptor cryptochrome 1 shows functional dependence on the phytochrome A or phytochrome B in Arabidopsis thaliana. Plant J. 11, 421−427. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., et al. (1987) Current Protocols in Molecular Biology, pp. 4.5.1−4.5.3, John Wiley & Sons, New York. Bellaire, B. A., Carmody, J., Braud, J., Gossett, D. R., Banks, S. W., et al. (2000) Involvement of abscisic acid-dependent and -independent pathways in the upregulation of antioxidant enzyme activity during NaCl stress in cotton callus tissue. Free Radic. Res. 33, 531−545. Bethke, P. C. and Jones, R. L. (2001) Cell death of barley aleurone protoplasts is mediated by reactive oxygen species. Plant J. 25, 19−29. Boldt, R. and Scandalios, J. G. (1997) Influence of UV-Light on the Expression of the Cat2 and Cat3 catalase genes in Maize. Free Radic. Biol. Med. 23, 505−514. Bradford, M. M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248−254. Carpenter, C. D., Kreps, J. A., and Simon, A. E. (1994) Genes encoding glycine-rich Arabidopsis thaliana proteins with RNA-binding motifs are influenced by cold treatment and an endogenous circadian rhythm. Plant Physiol. 104, 1015−1025. Chomczynski, P. and Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156−159. Dat, J. F., Pellinen, R., Beeckman, T., Van De Cotte, B., Langebartels, C., et al. (2003) Changes in hydrogenperoxide homeostasis trigger an active cell death process in tobacco. Plant J. 33, 621−632. Dunlap, J. C. (1999) Molecular bases for circadian clocks. Cell 96, 271−290. Esaka, M., Yamada, N., Kitabayashi, M., Setoguchi, Y., Tsugeki, R., et al. (1997) cDNA cloning and differential gene expression of three catalases in pumkin. Plant Mol. Biol. 33, 141− 155. Fita, I. and Rossman, M. G. (1985) The active center of catalase. J. Mol. Biol. 185, 21−37. Frugoli, J. A., Zhong, H. H., Nuccio, M. L., McCourt, P., McPeek, M. A., et al. (1996) Catalase is encoded by a multi-gene family in Arabidopsis thaliana (L) Heynh. Plant Physiol. 112, 327− 336. Gould, S. J., Keller, G. A., Hosken, N., Wilkinson, J., and Subramani, S. (1989) A conserved tripeptide sorts proteins to peroxisomes. J. Cell Biol. 108, 1657−1664. Grant, J. J. and Loake, G. J. (2000) Role of reactive oxygen intermediates and cognate redox signaling in disease resistance. Plant Physiol. 124, 21−29.

43

Gregory, E. M. and Fridovich, I. (1974) Visualization of catalase on acryamide gels. Anal. Biochem. 58, 57−62. Guan, L. and Scandalios, J. G. (1995) Developmentally related responses of maize catalase genes to salicylic acid. Proc. Natl. Acad. Sci. USA 92, 5930−5934. Guan, L. and Scandalios, J. G. (1996) Molecular evolution of maize catalases and their relationship to other eukaryotic and prokaryotic catalases. J. Mol. Evol. 42, 570−579. Guan, L., Zho, J., and Scandalios, J. G. (2000) Cis-elements and trans-factors that regulate expression of the maize Cat1 antioxidant gene in response to ABA and osmotic stress: H2O2 is the likely intermediary signaling molecule for the response. Plant J. 22, 87−95. Iwammoto, M., Higo, H., and Higo, K. (2000) Differential diurnal expression of rice catalase genes: the 5-flanking region of catA is not sufficient for circadian control. Plant Sci. 151, 39−46. Kamigaki, A., Mano, S., Terauchi, K., Nishi, Y., TachibeKinoshita, Y., et al. (2003) Identification of peroxisomal targeting signal of pumpkin catalase and the binding analysis with PTS1 receptor. Plant J. 33, 161−175. Kwon, S. I. and An, C. S. (2001) Molecular cloning, characterization and expression analysis of a catalase cDNA from hot pepper (Capsicum annuum L.). Plant Sci. 160, 961−969. Kwon, S. I. and An, C. S. (2003) Cloning and expression of mitochondrial MnSOD from the small radish (Raphanus sativus L.). Mol. Cells 16, 194−200. Lee, S. H. and An, C. S. (2005) Differential expression of three catalase genes in hot pepper (Capsicum annuum L.). Mol. Cells 20, 247−255. McClung, C. R. (1997) Regulation of catalase in Arabidopsis. Free Rad. Biol. Med. 23, 489−496. McClung, C. R. and Kay, S. A. (1994) Circadian rhythms in Arabidopsis thaliana; in Arabidopsis, Meyerowitz, E. M. and Somerville, C. R. (eds.), pp 615-637, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. Mittler, R. (2002) Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci. 7, 405−410. Mori, H., Hogo, K., Higo, H., Minobe, Y., Matsui, H., et al. (1992) Nucleotide and derived amino acid sequence of a catalase cDNA isolated from rice immature seeds. Plant Mol. Biol. 18, 973−976. Mylona, P. V., Polidoros, A. N., and Scandalios, J. G. (1998) Modulation of antioxidant responses by arsenic in maize. Free Radic. Biol. Med. 25, 576−585. Orozco-Cardenas, M. and Ryan, C. A. (1999) Hydrogen peroxide is generated systemically in plant leaves by wounding and systemin via the octadecanoid pathway. Proc. Natl. Acad. Sci. USA 96, 6553−6557. Redinbaugh, M. G., Wadsworth, G. J., and Scandalios, J. G. (1988) Characterization of catalase transcripts and their differential expression in maize. Biochim. Biophys. Acta. 951, 104−116. Redinbaugh, M. G., Sabre, M., and Scandalios, J. G. (1990a) Expression of the maize Cat3 catalase gene in under the influenceof a circadian rhythm. Proc. Natl. Acad. Sci. USA 87, 6853−6857. Redinbaugh, M. G., Sabre, M., and Scandalios, J. G. (1990b) The distribution of catalase activity, isozyme protein, and transcript in the tissues of the developing maize seedling. Plant Physiol. 92, 375−380.

44


Renger, G., Volker, M., Eckert, H. J., Fromme, R., Hohm-Veit, S., et al. (1989) On the mechanism of photosystem II deterioration by UV-B irradiation. Photochem. Photobiol. 49, 97−105. Scandalios, J. G. (1997) Catalase in plants: gene structure, properties, regulation, and expression. Oxidative Stress and the Molecular Biology of Antioxidant Defenses, Scandalios, J. G. (ed.) pp. 343-406, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Scandalios, J. G. (2005) Oxidative stress: molecular perception and transduction of signals triggering antioxidant gene defenses. Braz. J. Med. Biol. Res. 38, 995−1014. Somers, D. E. (1999) The physiology and molecular bases of the plant circadian clock. Plant Physiol. 121, 9−19. Strid, A., Chow, W. S., and Anderson, J. M. (1990) Effects of supplementary ultraviolet-B radiation on photosynthesis in Pisum sativum. Biochim. Biophys. Acta 1020, 260−268. Vandenabeele, S., Vanderauwera, S., Vuylsteke, M., Rombauts, S., Langebartels, C., et al. (2004) Catalase deficiency drastically affects gene expression induced by high light in Arabidopsis thaliana. Plant J. 39, 45−58. Wadsworth, G. J. and Scandalios, J. G. (1989) Differential expression of the maize catalase genes during kernel development: The role of steady-state mRNA levels. Dev. Genet. 10, 304−310. Williamson, J. D. and Scandalios, J. G. (1992) Differential re-

sponse of maize catalases and superoxide dismutase to the photoactivated fungal toxin cercosporin. Plant J. 2, 351−358. Willekens, H., Langebartles, C., Tire, C., Van Montagu, M., Inze, D., et al. (1994a) Differential expression of catalase genes in Nicotiana plumbaginifolia (L.). Proc. Natl. Acad. Sci. USA 91, 10450−10454. Willekens, H., Van Camp, W., Van Montagu, M., Inze, D., Sandermann, H., et al. (1994b) Ozone, sulfur dioxide, and Ultraviolet B have similar effects on mRNA accumulation of antioxidant genes in Nicotiana plumbaginifolia L. Plant Physiol. 106, 1007−1014. Willekens, H., Villarroel, R., Van Montagu, M., Inze, D., and Van Camp, W. (1994c) Molecular identification of catalases from Nicotiana plumbaginifolia (L.). FEBS Lett. 352, 79−83. Yi, S., Yu, S., and Choi, D. I. (2003) Involvement of hydrogen peroxide in repression of catalase in TMV-infected resistant tobacco. Mol. Cells 15, 364−369. Zhong, H. H. and McClung, C. R. (1996) The circadian clock gates expression of two Arabidopsis catalase genes to distinct and opposite circadian phases. Mol. Gen. Genet. 251, 196− 203. Zhong, H. H., Young, J. C., Pease, E. A., Hangarter, R. P., and McClung, C. R. (1994) Interactions between light and the circadian clock in the regulation of CAT2 expreassion in Arabidopsis. Plant Physiol. 104, 889−898.