Jan 15, 2016 - genes are expressed in leaf, stem, flower, and root tissues, albeit at ... bp, base pair(s); uORF, upstream open reading frame; Pipes, 1,4-.
THEJOURNAL OF BIOLOGICAL CHEMISTRY Q 1992 by T h e American Society for Biochemistryand Molecular Biology,
Vol. 267,No. 2,
Inc.
Issue of January
15, pp. 1204-1211,1992 Printed in U.S.A.
Differential Expression within a Three-gene Subfamily Encodinga Plasma Membrane H+-ATPasein Nicotiana plumbaginifoh* (Received for publication, June 17, 1991)
Christine Perez$, Baudouin Michelet, Veronique Ferrant, Pierre Bogaerts, andMarc BoutryQ From the Unit6 de Biochimie Physiologigue,Uniuersiti Cathlique de Louuain, Pluce Croix du Sud 2-20, B-1348 Louuain-la-Neuue, Belgium
Genomic and cDNAclones for the three members of ported to respond to hormonal signals (auxins, cytokinins, a gene subfamily(pma)encoding a plasma membrane gibberellic acid), to pathogenic agents (fusicoccin), and to H*-translocatingATPasein Nicotianaplumbaginiphysical factors such as light (for a review, see Marrb and folia were isolated and sequenced. They are between Ballarin-Denti (1985), Serrano (1989),and Sussman and Har96 and 96% identical at the deduced amino acid se- per (1989)). quence level. Sequence comparisons with the correThe proton pump of the plant plasma membrane belongs sponding tomatogenes (Ewing, N. N., Wimmers, L. E., to the P-type ATPases, a class of cation-translocating ATMeyer, D. J., Chetelat, R. T., and Bennett, A. B. (1990) Pases that form a phosphorylated intermediate during the Plant Phyeiol. 94, 1874-1881) indicatethat diver- catalytic process (Briskin and Leonard, 1982; Clbmentet al., gence among the threeN . plumbaginifolia pma genes 1986). These ATPases are inhibited by vanadate, contrary to occurredbeforethedevelopmentoftheSolanaceae pmal transcriptionini- the ATPases of the V (vacuolar) or F (mitochondrial FIFofamily. Here, determination of tiation sites reveals several 6’ boundaries located266 ATPase) types (for a review, see Bowmanand Bowman (1986) to 120 nucleotides upstream from the plasma mem- and Pedersen and Carafoli (1987)). A partial protein sequence was obtained from tryptic frag6’brane H*-ATPase translation initiation codon. The ments of the oatplasma membrane H+-ATPase (Schaller and untranlatedregioncontainsasmallopenreading frame, 9 residues long.pma3 has asingle, 264-nucleo- Sussman, 1988). The complete protein sequence has been a open reading deduced fromthe corresponding genes in Arabidopsis thaliuna tide long 6’ leader containing 6-residue frame. The latter is completely conserved in a corre- (Harper et al., 1989; Pardo and Serrano, 1989; Harper et al., 1990), in Nicotiana plumbaginifoliu (Boutry et al., 1989), and sponding tomato gene. These features suggest the possibility of translational regulationof plantpma genes. in Lycopersicon esculentum (Ewing et al., 1990). These studies S 1 nuclease protection assays on total cellular RNA have shown that the plant plasma membrane H+-ATPase is isolated from different organs reveals that all three encoded by a multigenic family. However,functional data are genes areexpressedin leaf, stem, flower, androot scarce concerning the different genes. Becausetheir products tissues, albeit at different levels according to the organmay play different physiological roles in distinct tissues durand gene. The different genes for the plant H+-trans- ing plant growth and development, the genes encoding the locating ATPase are thus subjectto differential regu- different PMA isoforms may be subject to differential regulation of transcription, possibly related to specificas- lation. In mammals, for instance, it has been shown that the pects of enzyme function. Na+/K+-and Ca*+-ATPase isoforms are differentially expressed according to the tissue (Orlowski and Lingrel, 1988, Burk et aL, 1989). We have previouslyreported the isolation and preliminary Biochemical and electrophysiological studies have estab- characterization of three different clones from a root cDNA lished that the major transport ATPase activity associated library, encoding distinct isoforms of the H+-ATPase of N. with the plasma membrane of plants and fungi is an H+- plumbaginifoh (Boutry et al., 1989; Michelet et al., 1989). We translocating ATPase. This enzyme is responsible for creating present here the isolation and characterization of genomic an electrochemical proton gradient (proton motiveforce) and cDNA clones constituting a three-gene subfamily. Analywhich is used for ion and nutrient transport mediated by sis of their relative mRNA levels in different organs shows specific carriers and channels (secondary transport). The that they are differentially expressed. plant plasma membrane H+-ATPase (PMA)’ has been reMATERIALS ANDMETHODS
* This work was supported by Services de Programmation de la Politique Scientifique Grant BI0/02. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 solelyto indicate this fact. The nucleotidesequence(s) reported in this paper has been submitted to the GenBankTM/EMBLDataBank withaccession numbeds) M80489-M80492. $Holder of a fellowship from the Commission of the European Communities. 5 Research Associate of the Belgian Fund for Scientific Research. To whom correspondence should be addressed. The abbreviations used are: PMA, plasma membrane H+-ATPase; bp, base pair(s); uORF, upstream open reading frame; Pipes, 1,4piperazinediethanesulfonic acid.
Plant Material-N. plumbaginifolia plants were grown in soil at 24 “C with a 16-h light period until they had two or three developed leaves. They were then either transplanted in soil or hydroponically grown in MS medium (Murashige and Skoog, 1962). Screening of the Genomic Library-A genomic library of N . plumbaginifolia constructed in X EMBL4 (Boutry and Chua, 1985) was screened with a cDNA clone for the N. plumbaginifolia pmal gene (Boutry et al., 1989). Hybridizations were carried out overnight at 42 ‘C in 6 x SSC, 50% formamide. Final washes were performed at 50 “C in 2 X SSC, 0.1% sodium dodecyl sulfate. Screening of the cDNA Library-A Xgtll root cDNA library of N. plumbaginifolia generously provided by Tingey and Coruzzi (1987) was screened by the hybridization plaque method (Maniatis et al., 1982). The 109-bp nonsense pma3 probe was synthesized with the
1204
Expression of Plant Plasma Membrane H+-ATPase Genes Klenow fragment of DNA polymerase I from the synthetic primer 5’ AGCACTTCAGGCTTC 3’ tothe EcoRI siteupstream from the initiation codon. Single-stranded DNA obtained from the pma3 genomic clone was used as a template.Hybridization was performed a t 42 “C in 6 X SSC, 50% formamide, and final washes were performed at 65 “C in 0.25 X SSC, 0.1% sodium dodecyl sulfate. Sequencing-The DNA fragments were subcloned in pBluescript (Stratagene) or pTZl8 (U. S. Biochemical Corp.) vectors. Overlapping deleted clones were obtained using the progressive deletion strategy described by Barnes et al. (1983) or the unidirectional deletion strategy according to the Stratagene instruction manual. The dideoxynucleotide chain termination method was used to sequence singlestranded DNA (Biggins et al., 1983). The complete sequence was obtained from both strands. RNA Isolation-Plant material was ground in a mortar in liquid nitrogen, and total cellular RNAwas extracted by the guanidine chloride method (Maniatis et al., 1982). SI Mapping Experiments-For RNA quantitation and p m 3 5‘ end mapping, 10 pgof total RNAwas hybridized overnight with 20,000 cpm of the labeled probe in hybridization buffer (65% formamide ,400 mM NaCl, 40 mM Pipes, pH 6.8, 1 mM EDTA) at 50 “C for the pma2 gene or at 37 “C for pmal and pma3genes. S1 nuclease reactions were then performed at 25 “Cfor 1h with 2 unitsof enzyme/ pl of reaction medium. After ethanol precipitation, the samples were loaded on denaturing urea polyacrylamide gels of various concentrations depending on the expected size of the protected fragments. For pmal 5’ end mapping, 20 pg of total RNA were hybridized as above except that hybridization was conducted at 42 “C in the presence of 50% formamide. Probe Labeling-All probes were labeled by primer extension (Maniatis et al., 1982).Their locations are indicated on the restriction map displayed in Fig. 1 (probes used for RNA quantitation) or in Fig. 3 (probes used for determining 5’ transcript boundaries). For the pma3 probe used for RNA quantitation and mapping, single-stranded DNA from a genomic subclone containing the HindIII fragment surrounding the initiation codon was used as a template with the primer 5’ AGCACTTCAGGCTT 3‘. The 859-nucleotide labeled probe extended to theHindIII site located upstream from the ATG codon. The probe used to determine the 5’ boundary of the pmal transcripts was obtained from the synthetic primer 5’ AGACCACTAAAGAACCACC 3’ and a genomic clone containing the EcoRI fragment surrounding the 5’ end ofpmal. The3’ end of the probe corresponded to the HincII site located 289 nucleotides upstream from the initiation ATG. Since several 5’ pmal boundaries were observed (see “Results”), a 3’ probe giving a single signal was designed to quantitate RNA. A genomic subclone containing the EcoRI fragment surrounding the 3’ end ofpmalwas usedto synthesize a 244-nucleotide noncoding strand probe extending from the universal primer located in the pBluescript cloning vector to the EcoRV site located 52 nucleotides downstream from the PMAl stop codon. A genomic subclone containing the EcoRI fragment surrounding the 3’ end of pma2 was used as a template to synthesize a 254nucleotide probe extending from the reverse primer located in the pBluescript vector to the HpaII site located 33 nucleotides downstream from the pma2 stop codon. RESULTS
Isolation and Characterization of pma Genomic and cDNA Clones-The existence of several genes for the plasma membrane H+-ATPase in N. plumbaginifolia has been previously reported, and three complete or partial cDNA clones have been isolated, corresponding to the genes previously named pmal, pma2, and pma3 (Boutry et al., 1989; Michelet et al., 1989). In this work, we screened a genomic library of N. plumbaginifolia with a pmal cDNA sequence and obtained three positive clones Np-a, Np-b, and Np-f, shown by restriction analysis to contain different genes. Southern blot analyses with 5‘ and 3’ regions of pma cDNAs (not shown) indicated that Np-b containsa complete pmu gene, whereas Np-a and Np-f respectively contain the5’ and 3’ parts of two other pma genes (Fig. 1).The hybridizing fragments were subcloned and sequenced. The complete pma nucleotide sequence of the Np-b clone is presented in Fig. 2. Nucleotide
1205
sequence comparisons of the genomic clones with the previously reported cDNA clones of N. plumbaginifolia (Boutry et al., 1989) showed that Np-b corresponds to pmal andNp-f to pma2. As no cDNA corresponding to Np-a was yet available, we screened a root cDNA library of N. plumbaginifolia with a probe derived from the upstream region of the gene. A cDNA clone witha 3.3-kilobase pair EcoRI insert was isolated, sequenced and shown to be identical to Np-a. This gene was named pma3 and,together with pmal andpma2, completes a pmu subfamily predicted, on the basis of a Southern blot analysis of N. plumbaginifolia genomic DNA, to contain three closely related genes (Boutry etal., 1989; Michelet et al., 1989) (see below). As a previous cDNA clone named cpma3 (Boutry et al., 1989) appears tobe quite differentfrom those described above (data not shown), it belongs to another pmasubfamily and will be renamed when further characterized. Nucleotide Sequence Analysis-Fig. 1 compares, the structures of the complete pmal and partial pma2 and pma3 genomic clones. The genomic pmal sequence and pma2 and 3 cDNA sequences are shown in Fig. 2. The pmalgene is interrupted by 20 introns ranging in size from 75 to 738 bp. pma2 and 3 display introns at identical positions where the genomic sequence is available. However, corresponding intronsshare no sequence similarity (not shown). Analogous genes from A. thaliana (aha) are interrupted by intervening sequences at thesame locations (Pardo and Serrano, 1989; Harper et al., 1990) but introns 3, 5, 6, 7 and 8 are found only in N. plumbaginifolia genes. All introns have the consensus sequence 5’ GT. . .AG 3’, except intron 6 of pmal and pma3, which has an unusual 5’ GC site. Since intron 6 is not present in the Arabidopsis aha genes, we cannot determine whether the GC donor site is an ancient particularity of this gene family. A GC donor site has already been found in another plant gene (Katinakis and Verma, 1985) and inseveral animal genes (Jackson, 1991). As already noted for the latters, thesequence at the5’ splice site of pmal and pma3 intron 6 displays a high complementarity to the 5‘ end of the U1 snRNA of the spliceosome, thus allowing correct pairing. The polyadenylation site of pmal was not identified since the genomic clone ends 256 nucleotides downstream from the stop codon and the cDNA we have analyzed contains a 293bp untranslated region not terminated by a poly(A) tail. On the other hand, the polyadenylation site of pma2 could be identified since the cDNA clone possesses a poly(A) tail 261 nucleotides downstream from the stop codon (Boutry et al., 1989). Amino Acid Sequence Analysis-Long open reading frames of 956 (pma2and 3) and 957 (pmal) amino acids were predicted. A three-base insertion located in the 5‘ region of the coding sequence is responsible for the additional amino acid encoded by pmal. Translationinitiation codons could be identified unambiguously since, in each case, the ATG codon was preceded by an in-frame stop codon. The three pmagenes are very closely related. Many amino acid substitutions are conservative (Table I). The deduced amino acid sequences of pmal and pma3display 95.9% identity with that of pma2, whereas pmal and pma3show 96.4% amino acid identity (Table 11).Comparison with the analogous genes ofA. thuliana ( a h ) (Table 11) indicates an overall identity of 8042%. More recently, sequences from a complete and a partial cDNA clone for analogous tomato genes ( l h u ) were made available (Ewing et al., 1990). The protein encoded by the complete clone ( l h u l ) is 97.5% identical to N. plumbaginifolia PMA3. This figure, higher than the identity observed among the three N. plumbaginifolia PMAs, indicates
Expression of Plant Plasma Membrane H+-ATPase
1206
NP-b (pma7)
____
E
H
I
P
I
I1 1 2
P
P
E H
I
I 3 4
Genes H
H P
H
I II
5 6
7
I Ir m l r
8 9 10 11
12 13 14 1516 17
18 19 20
21 Y
P
I
11 91 5 81 4 73 6
20
E
21 Y
FIG. 1. Restriction map of the genomic clones for the N.plumbaginifoliapmal-3 genes. Restriction sites for the restriction endonucleases BarnHI ( E ) ,EcoRI ( E ) , HindIII ( H ) ,and PstI ( P ) are shown. The EcoRI site shown in parentheses is a site of the X vector. Sequence analysis of Np-a indicates that its similarity to p m suddenly ends at the Sau3A site (indicated by an asterisk), suggesting that two distinct genomic fragments were inserted into the X vector. Exons are in black boxes and are numbered. Introns are in open boxes. Bars below the genes represent the fragments used for RNA quantitation by S1 nuclease assays.
that the latter three diverged before N. plumbaginifolia and tomato (L. esculentum) emerged within the Solanaceae family. A similar reasoning is supported by analysis of the partial cDNA clone for LHA2 which is closer to the N. plumbaginifolia PMA2 than to LHAl (notshown). The major sequence divergence between the various plant plasma membrane ATPases is located in the C-terminal third of the proteins (not shown) which is the least conserved region among all the P-type ATPases. A 33-residue stretch (918950) constitutes an exception; it is found to be almost invariable at theC terminus of all plant H’-ATPases sequenced so far. It could correspond to a regulatory sequence since Palmgren et al. (1990) have reported an activation of the oat plasma membrane H+-ATPase by a proteolytic removal of the Cterminal region and have suggested that this region could be involved in the regulation of proton pumping. Moreover, the C-terminal regions of the yeast H+-ATPase (Portillo et al., 1989)* and of the mammalian Ca2+-ATPase (James et al., 1989) also contain regulatory elements. Determination of the Transcription Starts-The genomic clones of pmal and pma3 have enabled us to carry out S1 nuclease protection experiments to determine the 5’ termini of their transcripts. Single-stranded probes were synthesized from a primer complementary to a sequence located near the first ATG. The results revealed a complex pattern of 5’ boundaries for pmal (Fig. 3A). One was located 120 nucleotides upstream from the start codon, and a cluster of four additional sites were located 212-266 nucleotides upstream from the initiation ATG codon. They do not correspond to different splicing events of a single primary transcript since no 3‘ intron border is found just in front of the various leaders. A fifth protected fragment seen in Fig. 3A was also observed with yeast tRNA used as a control and was not considered a pmal 5‘ boundary. No other transcription start is located further upstream, since no additional fragment was observed when the probe was extended to the HindIII site located approximately 1 kilobase pair upstream from the initiation ATG (not shown). A single 5’ boundary was observed for p m 3 at position -264 of the initiatorATG (Fig. 3B). The similar 5’ boundaries were obtained for pmal and pma3 with total RNAfrom different tissues (not shown). Thus the mRNA leader sequences of these two p m genes are unusually long for a plant species. Moreover, they contain a small, upstream open read-
’A. Wach and A. Goffeau, personal communication.
ing frame (uORF) of 9 ( p m l ) or 5 ( p m 3 ) amino acid residues located, respectively, 61 or 42 nucleotides upstream from the ATG of the PMA coding sequence(see Fig. 5). Because a genomic clonefor the 5’ region of the pma2 gene was not available, we could not conduct S1 nuclease mapping of the pma2 mRNA. However, this gene seems to possess a long leader as well, since the longest cDNA clonefound so far contains a 5 ’-untranslated leader sequence 86 nucleotides long. Differential Expression of pmal, 2, and 3 in Various Organs-Quantitation of thepma transcripts could not be achieved by Northern blot analysis, since the three genes are too similar to enable us to design probes longenough to specifically hybridize with each of the pma transcripts separately. However, the high divergence of the three pma genes outside their coding sequenceenabled us to design specific5’ or 3‘ probes from genomic clones and toconduct S1 nuclease mapping in order to analyze the transcript level in different organs. The probes were designedto contain in part an intron or plasmid vector sequence which should not hybridize with the transcript. Thus, the expected protected fragments are shorter than theprobes which therefore do not interfere with the quantitation.For eachpma gene, we obtained the expected protected fragment (Fig. 4).A broader signal was obtained for p m l , probably because of the AT-rich region apparent in the nucleotide sequence at the boundary of the protected fragment. Transcripts for the three pma genes were found in all organs analyzed, namely roots, stems, leaves from both vegetative and flowering plants, and flowers at early and late developmental stages. Very high expression of the three p m genes was found in flowers. In addition, each gene showed a different pattern of expression. For instance, the mRNA level difference between stems and flowers is more marked for p m 2 and p m 3 than for pmal. Since all the experiments were conducted using the same RNA preparation, these results reveal real differences in pmamRNA levels betweenthe organs tested. DISCUSSION
The three genes analyzed here form a pma subfamily predicted to contain threemembers (Boutry et al., 1989).Restriction maps of the available genomic clones are in agreement with a Southernblot analysis of genomic DNA (Boutry et al., 1989). However, the previous report also mentioned the isolation of a cDNA clone whose partial sequence indicated a
1207
Expression of Plant PlasmaMembrane H+-ATPase Genes
- 301
1
-
3
1 3
1
201
101
3 -
1
1
2 3
1
+
102
+
202
1
302
2 3
1 2 3
1 2 3
+ 402 + 502
1 1 1 1
602
1 2 3
FIG. 2. Nucleotide sequenceof the pmal-3 genes. Lane 1 displays the genomic nucleotide sequence of pmal. Exons are inboldface upper case and are topped by the deduced amino acid sequence in one-letter code and numbered (underlined). The nucleotide sequence is numbered from the first nucleotide of the translation initiation codon. Lanes 2 and 3 report the nucleotide sequence of the largest cDNA clones for pmu2 and 3 respectively. In addition, lane 3 (pma3) displays a 400-nucleotide sequence upstream from the translationinitiation codon obtained from the genomic clone. Transcription starts are indicated by arrows. uORFs are in upper case. Polyadenylation sites areshown by an asterisk.
f
702
+
802
1 2 3
+ 902
1 2 3
+
1 2 3
+ 1102
1002
1
1202
1
+ 1302
2 3
+ 1402
1 2 3
1 2 3
+ 1502
1 2 3
+
1602
1
t
1702
2 3
1
..............T ..........................
2 3 1 2 3
a........
+ 1802
.................................................. I I E I I V N Y P I Q B R A Y R P ~ I D N L L V L L I ~ U I P I A OATM~AaATITTCTCATBTICCCTATC~CACCaCaCATACCaTCCTOOOA~A~TC~C~~CTI~A~T~MTIC~~~C + 1902 A.. A.....T..C..C..T.........M...T........A.................C.....C..................... G M...T.....C.....A..............T.....~........~............
...... ......... .................. ..................... 300
1
*
2
2002
3
1 2 3
+ 2102
1 2 3
f
1 +
2
2202
2302
3 1 2
3 1 2 3
Q V D A D Y V V L M A A R A S R T E N Q D A I D A A I V a U L ~ ~ P O ~ ~ ~ a A T A ~ T A ~ ~ M ~ a C T C O A a C C T ~ O M ~ a A a M T C A O O A ~ C U ~ A m C ~ A ~ ~ A ~ + 1402 .C c..........~~..~.....a..............a..zc..........c...............~.~...............c..~....... C.CT TC C.
.. .............
..........................
.......... ...........................................
+ 2502
Expression of Plant PlasmaMembrane H+-ATPaseGenes
1208
+ 2602
1 2 3
+ 2102
+ 2802
+ 2902 + 3002
+
3102
+ 3202
+ 3302 1 2 3
+ 3402
1 2 3
+ 3502
+ 3602
+
3702
1 2 3
+ 3802
1
+ 3902
2 3 1
+ 4002
1
+ 4102
2 3 1 2 3
+ 4202
1
+
4302
2 3
+
1 1
4402 + 4502 + 4602 t 4702 + 4802 + 4902
1 1 1 1
1 2 3
+ 5002
1
+ 5102
2 3
+ 5202
+ 5302
+ 5402
1 2
3 1 2 3
+ 5502
1
+ 5602
2 3
+
1 2 3
FIG.2"Continued
5702
Expression of Plant PlasmaMembrane H+-ATPaseGenes P
L
D
I
I
K
F
F
I
R
Y
I
L
S
O
R
A
W
D
L
V
F
E
R
1209
R
1 2 3
C " A T A T A l T C M a a T c U T C C ~ A T a C T ~ C A a - A l ~ C C T ~ A T C ~ G ~ A ~ a M ~ t = t q = ~ t = q t 9 = ~ ~ q = 9 a = q = t+ = 5802 a..... T. a A.A.................................c......A.... a C. T ~.A................A......A....
1
t.cttatgcaqqgctctc.tcctattgtcatcttaattgcatttqatttttt~~tttttctacttctctacaqATmCmTACU~M~M~~+ ~ C5902
... ... .......... ... ... ..A...T.~......... ...... ..............
I
A
P
T
R
K
K
D
........c ..a.............. ........c .....A . . . . . . . . . . . .
2 3
F
T
+ 6002
1 2 3
+ 6102
1 2 3
+ 6202 + 6302
1
1 1
+
6402
+ 6502
1 2
3
+ 6602
1 2 3
+ 6702
1 2
3 1 2 3
+ 6802
1 2 3
TABLE I Amino acid modifications between the deduced protein sequences of the threegenes p m l , pma2, and pma3 The first column indicates the amino acid residues of PMAl which are modified in PMAB (column 2) or PMAB (column 3). Numbering of residues corresponds to the PMAlsequence. PMA2 PMAl
Glu-4 Ala-16 Thr-39 Ala-40 Thr-41 Ala-48 Asp-60 Leu-63 Leu-64 Ile-109 Arg-144 LYS-146 Glu-148 Val-152 Ile-215 Ala-274 Asn-349 Ile-351 LYS-356 Met-362 Ala-381 Ala-388 Asn-436 Ala-450 Gly-464 Ala-478 Gly-486 Val-515
PMAB
Absent Thr Ser GlY Pro Glu Phe Val LYS ASP Gln Ile Val LYS Val Thr Thr Ser
Absent Thr
Ser Glu Phe Ser LYS
Val LYS TYr Arg Thr His
Ser Ala Thr Ile
Ala Ile
PMA2 PMAl
Ser-552 Ala-553 Ile-556 LYS-673 Ile-719 LYS-738 Asn-740 His-744 Glu-752 Ile-772 Val-789 Phe-794 Ile-798 Val-801 Ser-817 Ile-834 Leu-837 Ile-841 Ile-845 Phe-849 Arg-857 Phe-863 Arg-865 Thr-899 Leu-901 Ala-905 Leu-927 Ala-954
PMAB
Ala Ser Val Glu ASP Arg Gln Thr Leu Val Leu Ala Leu
Leu Gln
PMAl
PMA2
PMA3
%
%
%
PMAl 10095.7 96.4 95.9 80.7 Val 96.1 95.9 100PMAB 81.5 PMA3 80.2 97.5 Gln 79.9 LHAl 81.5 80.2 Val 80.1 AHAl AHA2 AHA3 -4% Thr Met Leu Val Phe Leu Ile
Phe Leu
TABLEI1 Percentages of amino acid identity between the deduced amino acid sequences for the p m genes of N. plumbaginifolia (this work) and the aha genes of A. thnlinna (Harper et al., 1989; Harper et al.,1990; Pardo and Serrano, 1989) and the lhnl gene of tomato (Ewing et al.,19901
Leu Leu LYS Ile Gln Pro Ile Thr
Gln Ser
high divergence from the pmal-3 subfamily. This indicates the existence of a second pma subfamily whose composition and function are still unknown. The amino acid sequences deduced from the sequences of thepmal-3 genes are about 96% identical (Table 11). All three genes are transcribed, since corresponding cDNA clones were
LHAl AHAl %
AHA2 %
80.3
%
AHA3 %
81.1 82.1
79.8 80.6
94.3 100
88.5
100 100 87.7
100
isolated (Boutry et aL, 1989 and this paper). These results raise the question of whether the encoded polypeptides have the same function and the same pattern of expression. Because of their high level of similarity, it is most likely that the three genes encode H+-translocating ATPases with similar functions. However, we must consider the possibility of different regulations at the enzyme level. H+-ATPases are thought to play a major role in tissues or cells, such as root epidermal or sieve element-companion cells, where intense cellular transport occurs. It is conceivable that the enzymes expressed in different tissues evolved differently to respond to regulatory factors specifically occurring in those tissues. This hypothesis cannot be verified easily since it appears difficult to isolate a single isoform on which biochemical analyses can be performed. On the other hand, we were able to assess the transcriptional regulation of the pma genes by analyzing their respective mRNA distribution inthe different organs of the plant. pma transcripts were found in all organs analyzed roots, leaves from both vegetative and flowering plants, stems, and flowers at two developmental stages. Thus, the PMA enzyme as a wholemaybe considered a housekeeping enzyme at theorgan level at least. Although the use of different probes prevented us from
Expression of Plant PlasmaMembrane H+-ATPase Genes
1210
A
I
1
T
C
G
A
-lab-
plul
-141-
-
-111* -111-
I
l
A
G
C
T
-144,
ma3
-110-
ATQ
Hoall
Hlndlll uaal
I
-1
Probe Protected fragments
-
ATQ
hProbe
STOP ECORV
I
Protwed fragment
pBLUESCRlPT
244n Prow
200 bp
172 n
100 bp
FIG. 3. Mapping of the 5‘ termini of thepmal ( A )andpma3
( B ) transcripts by S1 nuclease protection. Mapping was carried out asdescribed under “Materials and Methods.” Lane 1, yeast tRNA (20 pg); lane 2, N. plumbaginifolia flower ( A , 20 pg) or stem ( B , 5 pg) RNA; T,C, G, and A represent the sequence ladder generated from the primer used for probe labeling. Numbers indicate position of the 5’ boundary of the protected fragments. Probes and protected fragments are displayed in the lower panel.
making a quantitativecomparison of transcript levels between the different genes ina same organ, the distribution of mRNAs for pmal, pma2, and pma3 in the different organs clearly indicated differential expression. Besides the high RNA level observedin flower tissues for the three genes,pmal was mainly active in the stem, pma2 showed a similar transcript level in vegetative leaves and in the stem, and the highest activity for pma3 was observed in root tissues (Fig. 4). A . thalianu genes aha1 and a h 2 have also been shown to be differently expressed in root and shoot tissues (Harper et al., 1990). In animal cells, it has been demonstrated that the genes encodingdifferent isoforms of the a subunit of the Na+/ K+-ATPase or the plasma membrane Ca2+-ATPaseare differentially expressed in a tissue-specific manner (Orlowski and Lingrel, 1988;Burk et al., 1989; Greeb and Schull, 1989). Although, to our knowledge, the level of H+-ATPase in flower tissues has not been documented to date, the high pma transcript level in this organ is not really unexpected. The flower is a fast-developingsink organ which must receive metabolites from other parts of the plant. Thus H+-ATPase-dependent active transport may be well-developed in this organ. The comparative study of promoter regions linked to reporter genes such as uidA (8-glucuronidase), whose expression can be monitored in situ, will revealthe specific expression of the different pma genes at thetissue or cell level. The size of the untranslated 5’ region of the pma messengers is much larger (120-270 nucleotides) than themean size
STOP
Protected fragment
-
pBLUESCRlPT
256 n
190 n
Probe Protected fragment
FIG.4. Analysis of transcript levels for the different p m a genes in various organsby S1 nuclease mapping. Mapping was carried out as described under “Materials and Methods” with total RNA prepared from the following organs. Leaves were harvested either from the rosette of young vegetative plants ( V L ) or from the stem of the floweringplant ( S L ) .Flowers were collected a t two stages of development characterized as follows. Stage 1 was defined as applying to flowers from0.5 to 1.8 cm long (F,). Stage 2 corresponded to flowers from 1.8 to 4 cm long (F2).Roots ( R ) were obtained from the hydroponically grown plants. Stems( S )were collected from young flowering plants. Yeast tRNA was used as a control (C). The probes used for pmal and pmu2 are presented a t the bottom of the figure whereas the pma3 probe was the same as used for the determination of the transcription start site (see Fig. 3 B ) .
for a plant leader sequence (40-80 nucleotides, reviewed in Joshi (1987)). This observation is not specific to N. plumbaginifolia pma, since the determined length of the leader sequence of the A. thaliana aha2 gene is 133nucleotides (Harper et aL, 1990). In addition, the pmal and pma3 leaders contain a small uORF, 5 (pma3) or 9 (pmal) amino acids long, located 42 or 61 nucleotides upstream from the ATG of the PMA ORF. These uORFs are in agood context for translation asdefined by Kozak‘s model,there being an A-3 and G+l in pma3 and an A-3 and T+1 in pmal (Kozak, 1986; Kozak, 1989). The presence of a shortuORF has also been observedin theleader sequences of the A. thaliana aha2 gene (Harper et al., 1990) and of the L. esculentum lhal gene (Ewing et al., 1990) (Fig. 5). The latter case is interesting since the highsequence similarity between the L. esculentum lhal and the N. plum-
Expression of Plant PlasmaMembrane H+-ATPaseGenes FIG. 5. Sequencecomparison of the leader sequencesof N . plumbaginifolia pma genes, A. th&iana a h a 2 and L.esculentum lhal genes. caps have been introduced in the l h l sequence to optimize its alignment with the pma3 sequence. Numbers indicate the position Of the transcription start sites (pmul (only the shortestis displayed), pma3, aha2)or (in parentheses) the 5' boundary of the largest cDNA clones (pma2,h l ) .The 14-bp sequence between pmal, pma39 and lhal is double-underlined. Start of the PMA coding sequence is indicated (+I). uORFs are in boldface uDDercase and are topped by the deduced amino acid sequence.
1211
-1
..................... .-264 ~gcgugaacagacaaaccaaaggccuaguaqaacu~gcauuu~aacuguucucuacucuuccauuuccc .................................................................. .-I20 GCaUCaUaaU-a
pus
uuguagacugggugguagugagqugugugugacccuuuggcugcuaacaaaauccuacuucuuug~ucuaacaaacuccacuuuuu~uccccuacuu~
-3
lhal aha2
.............................................................. ...................................................... -133
(-120)aaaucuuguccucuuuu-cuucaucugcuuc
I;j;;;fCCaCCU~~UCUCUCCUCCUCUCCUUCUCUCU~UUUUg
U F S L L M V V L +l p u l aaAQQOQCQCQCWIIUUQWQW~CQQQAQug~cuucuugaucugaaacu~gacaag~agua~u~gagugu~uagaa~gaagagag~
puz
+1
. . (-86)ggauuuggugggcuacuuaaccaauccuauuuuccguaccccaaaaauccuauccuucuuu~agggagaggaaauugaagcaa~~~
U V P L I +1 p u 3 accaaa~gagaauucuauugAOWQQQ~MOCQQAga~guuuuugacagaaggcgaaagaacaa~uuaaagaaagAOWQA M V P L I +1 cugaguuauauuuAQ~QQQ~MOCQQ~ac~cuguu-~ucaaaagggggaaaaacaa~uuuaggaa-gAO~ acc-uaauuuu~uacuucq U I E +1 aha2 ccggaauacauAoQAQCQAQOQ~acggcggacaaagcuguc~guug~guacuaauucgccguc~uuuucuca~gaagga~g~gagagAO~Q~
Bennett, A. B. (1990) Plant Physwl. 9 4 , 1874-1881 baginifoliapma3 (97.5 % identical at the protein level) clearly indicates a recent common origin. Analysis ofthe two leader Greeb, J., and Schull, G. E. (1989) J. Bwl. Chem. 2 6 4 , 18569-18576 J. F., Surowy, T. K., and Sussman, M. R. (1989) Proc. Natl. sequences shows that the uORF is 100% identical, while the Harper, Acad. Sci. U. S. A. 86,1234-1238 surroundingsequence is less conserved except for a 14-bp Harper, J. F., Manney, L., DeWitt, N. D., Yoo, M. H., and Sussman, conserved sequence which is found upstream of the pmal, M. R. (1990) J. Bwl. Chem. 265,13601-13608 pma3, and lhal uORFs (Fig. 5). This observation suggeststhe Hartings, H.,Maddaloni, M., Lazzaroni, N., Di Fonzo, N., Motto, M., Salamini, F., and Thompson, R. (1989) EMBO J. 8 , 2795-2801 possible existence of regulationof the pma genes at the translational level, in which the uORF nucleotide or amino Jackson, 1. J. (1991) Nucleic Acids Res. 19,3795-3798 acid sequence could be involved. The presence of long leaders James, P., Pruschy, M., Vorherr, T. E., Penniston, J. T., and Carafoli, E. (1989) Biochemistry 28,4253-4258 containing small uORFs has also been detected in the leader Joshi, C. P. (1987) Nucleic Acids Res. 15,6643-6651 of a few other plant genes and their possible involvementin Katinakis, P., and Verma, D. P. S. (1985) Proc. Natl.Acad.Sci. translational regulation has been proposed (for instance, see U. S. A. 82,4157-4161 Snustad et al. (1988), Hartings et al. (1989), Singh et al. (1990), Kozak, M. (1986) Cell 4 4 , 283-292 Kozak, M. (1989) J. Cell Bwl. 1 0 8 , 229-241 Schmidt et al. (1990)). Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) Molecular In conclusion, ourdata suggest both transcriptional and Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, translational regulation ofplant pma genes. Regulationat the Cold Spring Harbor, NY protein level hasalso been documented (for review,see Suss- Marrb, E., and Ballarin-Denti, A. (1985) J. Bioenerg. Bwmembr. 17, 1-21 man and Harper (1989)). Consequently, understanding how the expression of the different pma genes is regulated within Michelet, B., Perez, C., Goffeau, A., and Boutry, M. (1989) in Plant (Dainty, J., De MiMembrane Transport: The Current Position a plant organism and howthey participate in the physiology chaelis, M. I., Mar&, E., and Rasi-Caldogno, F., eds) pp. 455-460, oftransportwillrequiredevelopingappropriate tools or Elsevier Science Publishers, Amsterdam probes which are specific for each gene and for each regulatory Murashige, T., and Skoog, F. (1962) Physiol. Plant. 15,473-497 level. Orlowski, J., and Lingrel, J. B. (1988) J. Biol. Chem. 2 6 3 , 1781717821 Palmgren, M. G., Larsson, C., and Sommarin, M. (1990) J. Biol. Chem. 265,13423-13426 Pardo, J. M., and Serrano, R. (1989) J. Biol. Chem. 264,8557-8562 Pedersen, P. N., and Carafoli, E. (1987) Trends Biochem. Sci. 1 2 , REFERENCES 146-150 Barnes, W. M., Bereau, M., and Son, P. H.(1983) Methods Enzymol. Portillo, F., de Larrinoa, I. F., and Serrano, R. (1989) FEBS Lett. 101,98-122 247,381-385 Biggins, M. D., Gilson, T. J., andHong, G. F. (1983) Proc. Natl. Acad. Schaller, G. E., and Sussman, M. R. (1988) Plant Physiol. 8 6 , 512Sci. U. S. A. 80,3963-3965 516 Boutry, M., and Chua, N. H. (1985) EMBO J. 4,2159-2165 Schmidt, R. J., Burr, F. A., Aukerman, M. J., and Burr, B. (1990) Boutry, M., Michelet, B., and Goffeau, A. (1989) Biochem. Biophys. Proc. Natl. Acad. Sci. U. S. A. 8 7 , 46-50 Res. Commun. 162,567-574 Serrano, R. (1989) Annu. Rev. Plant Physiol. Plant Mol. Bwl. 40,61Bowman, B. J., and Bowman, E. J. (1986) J. Membr. Biol. 44,83-97 94 Briskin, D. P., and Leonard, R. T. (1982) Proc.Natl.Acad.Sci. Singh, K., Dennis, E. S., Ellis, J. G., Llewellyn, D. J., Tokuhisa, J. U. S. A. 79,6922-6926 G., Wahleithner, J. A., and Peacock, W. J. (1990) Plant Cell 2 , Burk, S. E., Lytton, J., McLennan, D. H., and Schull, G. E. (1989) J. 891-903 Biol. Chem. 264,18561-18568 Snustad, D. R., Hunsperger, J. P., Chereskin, B. M., and Messing, J. Clkment, J. D., Ghislain, M., Dufour, J. P., and Scalla, R. (1986) (1988) Genetics 1 2 0 , 1111-1124 Plant Sci. 6,43-50 Sussman, M. R., and Harper, J. F. (1989) Plant Cell 1,953-960 Ewing, N. N., Wimmers, L. E., Meyer, D. J., Chetelat, R. T., and Tingey, S., and Coruzzi, G. (1987) Plant Physwl. 8 4 , 366-373
Acknowledgments- We thank A. Goffeau for support and interest and A. M. Hubermont-Faber for excellent technical assistance.
