Differential Regulation of Cytokine Gene Expression by Avian ... - USDA

5 downloads 6 Views 2MB Size Report
flammatory cytokines and 'I'aqMan technology to ascertain levels of cytokine gene expression in avian het- er()phils following receptor-mediated phagocytosis of ...

JOURNAL OF INTERFERON & CY'FOKINE RESEARCH 23:319-327 (2003) © Mary Ann Liebert, Inc.

Differential Regulation of Cytokine Gene Expression by Avian Heterophils During Receptor-Mediated Phagocytosis of Opsonized and Nonopsonized Salmonella enteritidis MICHAEL H. KOGUT,' LISA ROTHWELL. 2 and PETE KAISER2

It

ABSTRACT Internalization of pathogens by phagocytic cells triggers the innate immune response, which in turn regulates the acquired response. Phagocytes express a variety of receptors that are involved in recognition of pathogens, including (1) pattern recognition receptors (PRR), which recognize conserved motifs, (2) complement receptors (CR), which recognize complement-opsonized pathogens, and (3) Fe receptors (FcR), which recognize antibody-opsonized pathogens. Recognition of microbes is accompanied by the induction of multiple cell processes, including the production of proinflammatory and anti-inflammatory cytokines and chemokines. The objective of the present experiments was to use probes to known avian proinflammatory and anti-inflammatory cytokines and 'I'aqMan technology to ascertain levels of cytokine gene expression in avian heter()phils following receptor-mediated phagocytosis of either nonopsonized Salmonella enferitidis (SE), serumopsonized SE, or IgG-opsonized SE. Expression of interleukin-6 (IL-6) and IL-8, considered in mammals as a proinflammatory chemokine, were upregulated following exposure to the nonopsonized or the opsonized SE. However, mRNA expression for IL-18 and interferon-'y (IFN-y) was downregulated, and the expression of mRNA for the anti-inflammatory cytokine transforming growth factor-134 ('FGF- 164). was upregulated. Interestingly, IL- 1 3 mRNA expression was significantly upregulated in heterophils that phagocytized either the nonopsonized SE via PRRs or IgG-opsonized SE via FcRs, whereas serum-opsonized SE phagocytized by CRs induced a downregulation of IL-113 mRNA. These results suggest that signaling interactions initiated by receptor recognition of the microbe surface differentially regulate the induction of inflammatory cytokines in avian heterophils.

1

INTRODUCTION is followed by a series events designed to control (recognition. phagocytosis, microhicidal activities) and eventually resolve (inflammation and acquired immunity) the infection.° The immediate re.sponse to invasive pathogens, clearance via the inflammatory response, and activation of the appropriate acquired responses are all coordinated and orchestrated by the innate host defenses. ) Recognition of potential pathogenic microbes by the innate immune system is the function of a restricted class of cellular receptors known as the nonclonal pattern recognition receptors (PRRs), such as the toll-like receptors (TLRs). The innate system uses these germ-line encoded receptors to recognize evolutionarily conserved molecular motifs (pathogen-associated 1CROI3IAL INVASION OF THE Hosr

M of

- IJ.

molecular patterns {PAMP5]) of infectious microbes. 23 The phagocytic process is triggered by two distinct cell surface receptors, one involving the recognition of the carhoxy-terminus of immunoglohulin (Ig) molecules by the Fe receptor (FcR) and the other where complement receptors (CR) recognize complement fragments .(1.5 Likewise, some PRRs, such as mannose receptors and scavenger receptors, have been shown to be involved in the phagocytosis process as well. 5 The end product of microbial recognition and phagocytosis by cells of the innate response is the activation of intracellular signaling pathways that initiate cellular processes, such as activation of microbicidal killing mechanisms, the production of proinfiammatory and anti-inflammatory cytokines. and the production of costimulatory molecules required for antigen presentation to the acquired immune system.9' ) As the first cells to migrate to a site of infection, polymor-

'USDA-ARS, SPARC. College Station, TX 77845, Institute for Animal Health. Compton. Berkshire RG20 7N. U.K. 319

320



phonuclear leukocytes (PMNs) are vital cellular components of inflammatory and innate immune responses.' I) The primary PMN in poultry is the heterophil, the avian equivalent of the mammalian neutrophil. Like neutrophils, avian heterophils are involved in the phagocytosis of invading microbes and foreign particles, the production of oxygen intermediates, and the release of proteolytic enzyme. 024 As was formerly the case with neutrophils, heterophils have been regarded as terminally differentiated cells, devoid of transcriptional activity and with little protein synthesis. Neutrophil activation, following receptor-mediated phagocytosis, induces proinilammatory gene transcription that mediates the host innate responses and modulates the acquired responses. ( '°' 57 However, unlike in neutrophils where various stimuli have been shown to induce gene transcription and translation of inflammatory mediators, heterophil responses at the level of gene transcription and expression are virtually unknown. The recent cloning of chicken cytokines has driven the development of a more comprehensive panel of reagents for investigation of innate and acquired immune mechanisms at the cellular and molecular levels. Therefore, we have the opportunity to consider the role of heterophils and cytokines in the development of inflammatory and immune responses when stimulated with various phagocytic and inflammatory stimuli. Chicken orthologs of the ThI cytokines interferon-y (IFN-y) and iiiterleukin- 18 (IL-1 8) ( ' 8.9) and the proinflammatory cytokines 1L-1 20 and 1L6(2i) have been cloned and sequenced. The chicken chemokine lL-8 2223 also has been cloned and sequenced. Genornic sequences and gene structures for 1FN-y.24 IL-18 (P. Kaiser, unpublished observations). 11--1 (P. Kaiser, unpublished observations), lL-8. 25 and IL-6 (P. Kaiser, unpublished observations) have been fully determined. Information on gene structure now makes it possible to design probes and primers to specifically quantify cytokine mRNA using realtime quantitative fluorescent RT-PCR and to follow changes in cytokine transcription during heterophi I phagocytosis. Receptor activation in mammalian neutrophils and macrophages induces transcriptional events in these cells that mediate host cell responses. 2 There is no information on regulation of the pattern of cytokine gene expression during receptor activation in heterophils. Therefore, we used real-time quantitative RT-PCR to determine gene expression in heterophils for proinflammatory and Tb I cytokines following receptor-mediated phagocytosis. particularly after the activation of PRRs, FcRs, and CRs. The results of these experiments should provide insights into the potential role of heterophils in the induction of an effector inflammatory response and also the development of the correct acquired response to a stimulus.

MATERIALS AND METHODS Experimental animals Outhred Rhode Island red (RIR) chickens were obtained from a local hatchery and reared and maintained at the Institute for Animal Health (IAH). Newly hatched chickens were reared in metal cages in rooms with temperatures of 31°C. The birds were provided with an animal protein-free diet (SDS Feeds, Manea, Cambridgeshire, U.K.) and water ad lihiti4ni.

KOGUT El' AL. Isolation of peripheral blood heterophil.c Avian heterophils were isolated from the peripheral blood of day-old RIR chickens as described previousIy. 27 Briefly. EDTA-anticoagulated blood was mixed with 1% methylcellulose (25 centipoises Icpl) (Sigma Chemical Co.. St. Louis. MO) at a 1.5:1 ratio and centrifuged at 25g for 30 mm. The serum and huffy coat layers were retained and suspended in Cal Mg 2 -free Hanks' balanced salt solution (HBSS, 1:1) (Sigma Chemical Co.). This suspension was layered over a discontinuous Ficoll-Hypaque (Sigma Chemical Co.) gradient (specific gravity 1.077 over specific gravity 1.119). The gradient was then centrifuged at 2508 for 60 mm. After centrifugation. the 1.077/1.119 interfaces and 1.119 band containing the heterophils were collected, washed twice in RPM] 1640 medium (Sigma Chemical Co.). and resuspended in fresh RPM! 1640. Cell viability was determined by trypan blue exclusion. The purity of the heterophil suspensions was assessed by microscopic examination of Hema-3-stained (Curtin Mathison Scientific, Dallas. TX) cytospin (Shandon Scientific. Pittsburgh. PA) smears. Heterophil preparations obtained by this method were typically >98% pure and >95% viabIe. 2733 On average, the other 2% comprised monocytes (at most 0.5%), lymphocytes (0.8%). and thrombocytes (at most 0.7%).(272 The cell concentration was adjusted to 4 X 10 heterophils/mI and stored on ice until used. Bacteria A poultry isolate of Salmonella enteritidi.v (SE) was obtained front National Veterinary Services Laboratory (NVSL) (Ames, Iowa) and approved by the USDA Animal and Plant Health Inspection Service for use in our facilities. A carbonicillin-novobiocin (C-N)-resistant isolate was selected and stored in 75% TSB + 25% sterile glycerol in aliquots of I X 10 colony-forming units (CFU) at —70°C until used. Tryptic soy broth (TSB) medium used to culture the resistant isolates in experimental studies contained 25 pg/mI novohiocin and 100 g/ml carbonicillin to inhibit the growth of other bacteria. SE cells used for opsonization were prepared in sterile phosphatebuffered saline (PBS). pH 7.2, and adjusted to a concentration of 10 CFU/ml using a spectrophotometer with a 625-nm reference wavelength. The viable cell concentration of SE was determined by colony counts on brilliant green agar (BGA) 4C-N (Oxoid Ltd., Basingstoke. Hampshire, U.K.) plates. Opsonization of SE Normal chicken serum (NCS) was used as a source of complement for opsonization of SE as described previously. 2 The SE (10 bacteria/ml) was suspended in pooled NCS, opsonized for 30 min at 39°C on a rotary shaker, washed twice with Ca2, Mg2 -free HBSS, and stored at 4°C in HBSS (108 bacteria/in]) until used. A hyperimmune serum against the homologous serovar of SE used in the experiments was prepared in 42-week-old layer hens (Hy-Line W-36). 27) The hyperimmune sera were collected from the blood of these hens and pooled. The pooled sera were octanic acid-fractionated, and the supernatant was submitted to DEAE chromatography (Bethyl Lab, Montgomery, TX). The predominantly lgG fractions were pooled and concentrated. SE

'5



CY'I'OKINE GENE EXPRESSION IN AVIAN HETEROPHILS (108 bacteria/ml) were suspended in a suhagglutinating concentration of IgG for 30 min at 39°C on a rotary shaker, washed twice with Ca2 , Mg2 -free HBSS, and stored at 4°C in HBSS (108 bacteria/ml) until used. Phagocvtosis

p.

Phagocytosis of unopsonized SE by the heterophils was determined using duplicate, sterile 15-ml polypropylene screwcapped centrifuge tubes that contained 2 X 106 heterophils (500 .rl) and 2 X 1 0bacteria (200 gil) in a total volume of I ml RPM] 1640 as described .127.28) The tubes were centrifuged (450g for iS min at ambient temperature) in order to maximize contact. The cells were then allowed to incubate at 39°C for 30-120 min on a rotary shaker to allow for phagocytosis. After each incubation period, the tubes were placed on ice to stop phagocytosis. An individual unaware of the groups performed all counts. At least 100 heterophils on each slide were scored for the percentage of heterophils that contained bacteria and for the number of bacteria associated with each heterophil. The results are expressed as the percentage of heterophils that contain bacteria.2728 Real-time quantitative RT-PCR Cytokine mRNA levels in control heterophils and heterophils following phagocytosis with opsonized or nonopsonized SE were quantitated using a method based on that of Kaiser et al.33 Total RNA was prepared from heterophils using the RNeasy minikit (Qiagen. Valencia, CA) following the manufacturer's



instructions. Purified RNA was eluted in 50 tki RNase-free wa(er and stored at —70°C. For both cytokine and 28S rRNA-specific amplification, primers and probes were designed using the Primer Express software program (PE Applied Biosystems, Foster City, CA). Details of the probes and primers are given in Table I. All cytokine probes were designed, from the sequence of the relevant genes, to lie across intron/exon boundaries. Cytokine and 28S rRNA probes were labeled with the fluorescent reporter dye 5-carboxyfluorescein at the 5-end and with the quencher N,N,N.N'-tetramethyl-6-carboxyrhodamine (TAMRA) at the 3'-end. RT-PCR was performed using the Reverse Transcriptase qPCR Master Mix RT-PCR kit (Eurogentec, Seraing, Belgium). Amplification and detectioti of specific products were performed using the ABI PRISM 7700 Sequence Detection System (PE Applied Biosystems) with the following cycle profile: one cycle of 50°C for 2 mm, 96°C for 5 mm. 60°C for 30 mm, and 95°C for 5 min and 40 cycles of 94°C for 20 see, 59°C for I mm. Quantification was based on the increased fluorescence detected by the ABI PRISM 7700 Sequence Detection System caused by hydrolysis of the target-specific probes by the 5'-nuclease activity of the rTth DNA polymerase during PCR amplification. The passive reference dye 6-carboxy-X-rhodamine, which is not involved in amplification, was used to correct for fluorescent fluctuations, resulting from changes in the reaction conditions, for normalization of the reporter signal. Results are expressed in terms of the threshold cycle value (C 1 ), the cycle at which the change in the reporter dye passes a significance

TABLE I. REAL-TIME QUANTITATIVE RT-PCR

RNA target 28S Probe Fb Rc IL-1)3 Probe F R IL-6 Probe F R IL-8 Probe F R IL-18 Probe F R IFN-y Probe F R TGF-/34 Probe F R

321

PROBES

AND PRIMERS

Probe/primer sequence 5 '-(FAM)-AGGACCGCTACGGACCTCCACCA-(TAMRA)-3' S '-GGCGAAGCCAGAGGAAACT-3' 5' -GACGACCGATFGCACGTC-3' 5 '(FAMd)CCACACTGCAGCTGGAGGAAGCC(TAMRA)3 5' -GCTCTACATGTCGTGTGTGATGAG-3', 5' -TGTCGATGTCCCGCATGA-3' 5'-(FAM)-AGGAGAAATGCCTGACGAAGCTCTCCA-(TAMRA)-3' 5' -GCTCGCCGGCTrCGA-3' 5 '-GGTAGGTCTGAAAGGCGAACAG-3' 5' -(FA M)-CTTTACCAGCGCGTCCTACCTFGCGACA-(TAMRA)-3' S '-GCCCTCCTCCTGGTITCAG-3' 5'-TGGCACCGCCAGCTCA'TT-3' 5 '-(FAM)-CCGCGCCTTCAGCAGGGATG-(TAMRA)-3' 5 '-AGGTGAAATCTGGCAGTGGAAT-3' 5 '-ACCTGGACGCTGAATGCAA-3' 5' -(FAM)-TGGCCAAGCTCCCGATGAACGA-(TAMRA)-3' S '-GTGAAGAAGGTGAAAGATATATCATGGA-3' 5 '-GCTTrGCGCTGGATT'CTCA-3' 5' -(FAM)-ACCCAAAGG'fi'AI'AI'GGCCAACTTCTGCAT-(TAMRA)-3' 5 '-AGGATCTGCAGTGGAAGTGGAT-3' 5' -CCCCGGGTT'GTGTGTTGGT-3'

1Genomic DNA sequence. 6Forward CRe,erse dsCarhoxyfluorescein.

Exon Accession boundary no.' X59733 5/6 AJ245728 3/4 AJ250838 1/2 AJ009800 4/5 A34I6937 3/4 Y07922 5/6 M31160

322



KOGUT ET AL. TAttlE 2. STANDARD CURVE DATA FROM ReAi-Tls1i QUANTITATiVF RT-PCRs ON Tot Al - RNA EXTRACTED FROM STIMULA I hi) I Ii-:rERoPi IlLS iRn'

28S IL-1B IL-6 IL-8 IL-l8 IFN-y TGF-/34



0.05 0.02 0.02 0.02 0.02 0.02 0.02

Log dilutions

C's



I0 8-22 10--l-10-1 26-32 10 - '-iO - 21-36 10 I_b-s 14-28 10-I_lU 20-32 l0-10 14-33 10 - 1-10-1 20-36

R2C



0.9937 0.992 0.993 0.9869 0.9891 0.9948 0.989

Slope

2.8636 2.9016 3.5572 3.1761 3.8568 3.6084 3.1335

'Rn, change in the reporter dye. 5C threshold cycle level, the c ycle at which the change in the reporter dye levels detected passes the AR. C R 2 . coefficient of regression.

threshold. In this work, the threshold values of the change in the reporter dye are given in Table 2 for all reactions described. To generate standard curves for the cytokine and 28S rRNAspecific reactions, total RNA, extracted from control and appropriately stimulated heterophils, was serially diluted (10-10) in sterile RNase-free water. Each RT-PCR experiment contained triplicate no-template controls and test samples and a log dilution series of standard RNA. Each experiment was performed in triplicate, with replicates performed on different days. Regression analysis of the mean values of six replicate RT-PCRs for the log 10 diluted RNA was used to generate standard curves.

Statistical analysis The anticoagulated blood from 50 chickens was pooled, and the heterophils were isolated from each treatment group as described. The RT-PCR assay was conducted three times over a 2-month period with pooled heterophils (heterophils pooled from 50 chickens for each preparation). At least three replicates were conducted for each assay with the heterophils from each pool of chickens. The data from these three repeated experiments were pooled for presentation and statistical analysis. The mean and standard error of the mean (SEM) were calculated for each of the treatment groups. Differences between the nonstimulated heterophils and the phagocytic stimuli-activated heterophils were determined by analysis of variance (ANOVA). Significant differences were further separated using Duncan's multiple range test. The data obtained using heterophils stimulated with the nonopsonized and opsonized SE were compared with nonstimulated control hetcrophils.

that four replicate standard curves were highly reproducible, as shown by the R 2 values shown in Table 2. There was a linear relationship between the amount of input RNA and the C, values for the various reactions (Table 2). The increase in cycles per log 10 decrease in input RNA for each specific reaction, as calculated from the slope of the respective regression line, is given in Table 2. To account for the variation in sampling and RNA preparations, the C, values for cytokine-specific product for each sample were standardized using the C, value for 28S rRNA product for the same sample from the reaction run simultaneously. To normalize RNA levels between samples within an experiment, the mean C value for 28S rRNA-specific product was calculated by pooling values from all samples in that experiment. Tube-to-tube variations in 28S rRNA C 1 values about the experimental mean were calculated. Using slopes of the respective cytokine and 28S rRNA log 0) dilution series regression lines, the difference in input total RNA. as represented by the 28S rRNA. was then used to adjust cytokine-specific C, values. Standardization does not dramatically alter the distribution of the results as a whole. The adjusted cytokinc-specific C, values for the nonactivated heterophils for each of the cytokines were: IL-1, 15.41 ± 0.48; IL-6, 13.94 0.25; IL-8. 11.64 1.1; IL-18, 15.97 ± 0.72; IFN-y, 12.08 ± 0.54; and transforming growth factor-4 (TGF)34), 6.72 ± 0.82. The effect of receptor-mediated phagocytosis on the expression of each cytokine mRNA was compared with these control adjusted cytokine-specific C, values by calculating the fold change in cytokine mRNA as described below. It is obvious that these cytokine mRNAs are constitutively expressed in the nonacti vated hcterophils.

Proinflaininutory cytok ines RESUL'I'S Phagocytosis was greatly increased by opsonilation of SE with either complement or IgG (Fig. I). Phagocytosis mediated by FcR occurred more rapidly than that mediated by CR (FcR>CR>PRR), By 120 mm. all bacteria were similarly phagocytized (data not shown). For the TaqMan experiments, replicate experiments on different days were highly repeatable. Regression analysis showed

Receptor-mediated phagocytosi s of both the nonopsonized SE and lgG-opsonized SE induced a significant upregulation of expression of the proinflammatory cytokines. IL-1 (3-64old), IL-6 (Il-fold), and IL-8 (12-fold) when compared with the nonstimulated control heterophils (Fig. 2). In contrast. NCS-opsonized SE induced a 7-fold downregulation of IL-113 mRNA expression, but a 13-fold and 10-fold increase in mRNA expression for I[.-6 and IL-8. respectively, was measured in the heterophils from day-old chickens.

CYTOKINE GENE EXPRESSION IN AVIAN HETEROPHILS



323

Receptor-Mediated Phagocytosis 100

(a)

(I) 0 C.) 0

a-

C

80 60 40 20 0 SE



NCS OpSE



IgG OpSE

Phagocytic agonists FIG. 1. Phagocytosis of nonopsonized SE (SE) and opsonized SE (NCS OpSE or lgG OpSE) by chicken heterophils after 60 min incubation. Different lower case letters indicate significant difference (p < 0.01). % Phagocytosis, percentage of heterophils that contain at least one bacterium.

Th I/Th2 cytokines Expression of mRNA of two ThI cytokines, IL-18 and IFN-y, was dramatically downregulated following the receptormediated phagocytosis of all three phagocytic stimuli when compared with the nonstimulated control heterophils (Fig. 3). Nonopsonized SE (4-fold), NCS-opsonized SE (7-fold), and JgG-opsonized SE (4-fold) all induced a significant upregulation in the expression of mRNA for the anti-inflammatory cytokine, TGF-4, compared with the nonstimulated resting heterophils (Fig. 3).

DISCUSSION The current study demonstrates that avian heterophils are capable of rapid changes in cytokine gene expression after receptor-mediated phagocytosis. As we have shown previously, the lipopolysaccharide (LPS) on nonopsonized SE, 29> Ig on lgG-opsonized SE,31'32t and complement components on NCSopsonized SE 12530 all interact with receptors on the surface of the heterophils. These results provide additional insights into how heterophils can respond to different phagocytic stimuli and how, by controlling cytokine gene expression, they can function in regulating inflammatory and subsequent acquired immune responses. The production of cytokines by heterophils suggests that these cells may be able to play a significant role in orchestrating not only proinflammatory or anti-inflammatory activities but also immunoregulatory actions. As heterophils represent the first cell type encountering and interacting with an inflammatory or etiologic agent, the ability to synthesize and release an array of cytokines provides evidence for their role in both immunoregulation and pathophysiology of disease.

The real-time quantitative RT-PCR results from the present studies demonstrate for the first time that chicken heterophils can be induced via receptor-mediated phagocytosis to express increased levels of cytokine mRNA. The cytokine mRNA appears to be differentially expressed depending on the receptor activated during phagocytosis. However, it should be pointed out that quantitative RT-PCR does not necessarily equate to bioactive protein. For example, to date only IFN-y and IL-6 mRNA levels have been shown to correlate with protein levels. 33 Only a limited number of reliable bioassays for chicken cytokines are available (IFN-y, type I JFN, IL-1f3, IL-2, IL-6, and IL-18) and even fewer for monoclonal antibodies (mAbs) (IL-2, IFN-y, type I IFN). However, the bioassays for IFNs do not differentiate among each other without the availability of neutralizing antibodies. The bioassay for IL-1/3 is nonspecific in that it also measures IL-2. Lastly, we have not been able to effectively measure IL-18. Therefore, real-time quantitative PCR is the most highly sensitive method available to reliably quantify a wide variety of avian cytokines, particularly in the absence of suitable bioassays for most of them.133351 Resolution of infections in young immature avian hosts is initiated through phagocytosis and intracellular killing by heterophils and macrophages that are recruited to the site of infection. 339 ' Phagocytosis is facilitated by opsonins (Fig. 1). Opsonins, such as complement components and acute-phase proteins, are induced early after infection,' 40 with antibodies produced later. These elements of innate antibacterial responses are induced, in part, by proinfiammatory cytokines. 4 For example, in poultry, invasion of avian cells by paratyphoid salmonellae stimulates a strong inflammatory response characterized by increased expression and release of the proinflammatory cytokine IL-6 33 and a massive infiltration of heterophils to the site. 131A21 Based on the results from the present studies, the in-

324

KOGUT ET AL. IL-1

8



a

1 o t

4

LL

-6 -8

J

a 1

IL-6 16 a)

14

C

10 0 Uz

E2 0

IL-8 16 14 a)

o 12

C

.c 10 0 32 8 0 Uz

E

2 [I]

SE

NCSOpSE

IgGOpSE

FIG. 2. Quantitation of proinflammatory cytokines (1L-1, IL-6. and IL-8) induced following receptor-mediated phagocytosis of nonopsonized SE and opsonized SE (NCS OpSE or lgG OpSE) by heterophils from day-old chickens expressed as fold change in cytokine mRNA levels, compared with those from age-matched control heterophils. Error bars show SEM from triplicate samples from four separate TaqMan experiments. Different lower case letters indicate significant difference (p < 0.01).

CYTOKINE GENE EXPRESSION IN AVIAN HETEROPHILS



325

IL-18 0 -2 w -4 IM

0

-8

0 U-

< -10 z E 12 -14 -16

IFN-Y 0 -2 -4 -6 o -8

LO

-10

4 -12 Z E -14 -16 -18

TGF-p 4 8

7

0 0 U4 z

IX 2 0

SE

NCSOpSE

IgGOpSE

FIG. 3. Quantitation of Thl/Th2 cytokines (IL-]8. JFN-y, and TGF-4) induced following receptor-mediated phagocytosis of nonopsonized SE and opsonized SE (NCS OpSE or IgG OpSE) by heterophils from day-old chickens expressed as fold change in cytokine mRNA levels, compared with those from age-matched control heterophils. Error bars show SEM from triplicate samples from four separate TaqMan experiments. Different lower case letters indicate significant difference (p < 0.01).

326



filtrating heterophils could also be a further source of IL-6 after activation of cell surface receptors. The niRNAs encoding the proinflammatory cytokines IL- 1/3. IL-6. and IL-8 were upregulated following PRR-mediated and FcR-mediated phagocytosis by heterophils. These findings are consistent with the fact that receptor activation of PMNs induces transcriptional signals that subsequently mediate host responses!9 These results further demonstrate that as the first cells to a site of infection or inflammation, heterophils are capable of producing inflammatory mediators following activation. The fact that heterophils can serve as sources of cytokincs suggests that these cells contribute to (I) the generation of conditions necessary for the recruitment and activation of other innate immune cells, (2) the expression of innate effector molecules that mediate the inflammatory response, and (3) the development of a protective immunogenic response. 43-441 Our data reveal that chicken heterophils also express IL-8 after receptor-mediated phagocytosis. All three phagocytic stimuli used here induced an upregulation of IL-8 mRNA in the chicken heterophils. The observation that heterophils, activated by receptor-mediated phagocytosis, are able to generate a chemotactic cytokine to which they can respond implies that these cells can promote their own recruitment to sites of inflammation. 1-leterophils play a vital role in early protection against SE infections in the chicken by rapidly migrating to the site of bacterial invasion. (39A2.45) This heterophil influx was due to neither host-generated arachidonic acid metabolites nor bacterial LIPS .(42) Further experiments demonstrated that a host-derived IL-8-like cytokine was responsible for the recruitment of heterophils to the site of SE infection. 39 The outcome of the present experiments indicates that heterophils could be a major autocrine source of this IL-8-like cylokine. Both Th I-inducing cytokine mRNAs that were quantitated in the present experiments, IL-IS and IFN-y, were downregulated following receptor-mediated phagocytosis by the chicken heterophils. Our results suggest that this downregulation is the result of upregulation of mRNA expression for the anti-inflammatory cytokine TGF-/34. It is reasonable to assume that early receptor-mediated phagocytosis by avian heterophi Is induces the secretion of TGF-/3, which can then act in an autocrine or paracrine manner to inhibit the expression of the proinflanimatory (IL- 1/3) and Th I (IL- 18 and IFN-y) cytokines. In mammals, a somewhat similar mechanism has been described, where increased production of the anti-inflammatory cytokine, IL- 10. following the ligation of the FcR exclusively, inhibited the specific production of IL-I2. 46 At present. no avian ortholog of IL-10 has been identified, but TGF-[34 has been found to have similar biologic activity .47 In summary, the results presented here show that receptormediated phagocytosis of either nonopsonized or opsonized SE by avian helerophils induces a differential regulation of cytokine gene expression. Expression of the prointlammatory cytokines IL-6 and IL-8 was upregulated after exposure to nonopsonized or opsoniLed SE. However. mRNA expression for IL-18 and IFN-y was downregulated, whereas the expression of mRNA for the anti-inflammatory cytokine TGF-/34 was upregulated. Interestingly, IL-1/3 mRNA expression was significantly upregulated in helerophils that phagocytized either the nonopsonized SE via PRRs or IgG-opsonized SE phagocytized by FcR. In contrast. phagocytosis of serum-opsonized SE via

KOGIJT ET AL. CRs induced a downregulation of IL- 1/3 niRNA. These studies provide the first description of expression of proinflammatory cytokine genes in chicken heterophils. These results suggest that signaling interactions initiated by receptor recognition of the microbe surface differentially regulate the induction of inflammatory cytokines in avian heterophils.

REFERENCES I JANEWAY, CA.. and MLDZI-IITOV. R. (2002). Innate inimunc recognition. Annu. Rev. Immunol. 20, 197-216. 2. FEARON, D.T.. and LOCKSLEY. R.M. (1996). The instructive role of innate immunity in the acquired immune response. Science 272, 50-53. 3. MEDZHITOV. R., and JANEWAY. C.A. (1997). Innate immunity: impact on the adaptive immune response. Curr. Opin. Immunol. 9, 4-9. 4. ADEREM. A.. and UNDERIIILL. D.M. (1999). Mechanisms of phagocyiosis in macrophages. Annu. Rev. Immunol. 17, 593-623. 5. IJNDERHILL. D.M.. and OZINSKY. A. (20002). Phagocyiosis of microbes: complexity in action. Annu. Rev. Immunol. 20,825-952. 6. McI.EISH, K.R., KLEIN J.B.. COXON, P.Y.. HEAD. K.Z.. and WARD. R.A. (1998). Bacterial phagocyiosis activates extracellular signal-regulaied kinase and p38 mitogen-activaied protein kinase cascades in human neutrophils. J. Leukoc y ic Biol. 64, 835-844, 7. THOMAS. C.A.. Ll. Y.. KOI)AMA. T.. SUZUKI, H.. SILVERSTEIN, S.C.. and EL KOURY. J. (2000). Protection front grarn-negaiise infection by macrophage scavenger receptor-dependent phagocytosis. J. Exp. Med. 191, 147-156. 8. STAHL, I'D.. and EZEKOWITZ, R.A. (1998). The mannose receptor is a pattern recognition receptor involved in host defense. Curr. Opin. Inimunol, 10, 50-55. 9. KOBAYASHI. S.D., VOYICH.J.M.. BtJHL. CI.., STAHL. R.M.. and DeLEO. P.R. (2002). Global changes in gene expression by human polymorphonuclear leukocytes during receptor-mediated phagocytosis: cell fate is regulated at the level of gene expression. Proc. Nail. Acad. Set. USA 99, 6901-6906. 10. NAU, G.J.. RICHMOND. J.F.L .. SCHLESINGER, A., JENNINGS. E.G.. LANDER. ES .. and YOUNG. R.A. (2002). Human macrophage activation programs induced by bacterial pathogens. I'roc. Nail. Acad. Sci, USA 99, 1503-1508. II. HACIIICHA. M.. RATHANASWAMI, P., NACCHE, l'.H., and McCOI.L. S.R. (1998). Regulation of chemokine gene expression in human peripheral blood neuirophils phagocyiosing microbial patho g ens. J. Immunol. 160, 449-454. 12. POWELL, P.C. (1987). Immune mechanisms in infections of poultry. Vet. Immunol. Irumunopaihol. 15, 87-113. 13. HARMON. B.G. (1998), Asian heicrophils in inflammation and disease. Pouli. Set. 77, 972-977. 14. KOGUT, M.H.. LOWRY, V.K., MOYES, RB.. I3OWDEN. L..L., BOWI)EN, R., GENOVESE, K., and DeI.OACH, J.R. (1998). Lymphokine-augmented activation of avian heterophils. Pouli. Sci. 77,964-971. IS. McDONALD. PP., BALD. A., and CASSATELLA. M.A. (1997). Activation of the NE-KB pathway by intlaniinaiory stimuli in human neutrtiphils. Blood 89, 3421-3433. 16. CASSATELLA. M.A. (1995). The production of cytokines by polymoi-phonuclear neutrophils. Immunol. Today 16, 21-26. 17. SUBRAHMANYAM, Y.V.B.K.. YAMAGA, S., PRASHER, Y., LEE. H.H., HOE. N.I'., KLUGER. Y.. GERSTEIN. Vt, GOGEUN, ii)., NEWBURGER. P.E.. and WEISSMAN, S.M. (2001). RNA expression patterns change dramatically in human neutrophils exposed to bacteria. Blood 97, 2457-2468.

CYTOKINE'GENE EXPRESSION IN AVIAN HETEROPHILS 18. DIGBY, MR.. and LOWENTIIAL, J.W. (1995). Cloning and expression of the chicken IFN-y gene. J. Interferon Cytokine Res. 15, 939-945. 19. SCHNEIDER. K., PCEHLER, F., BAEURLE, D., ELVERS, S., STAHELI. P., KASPERS, B., and WEINING, K.C. (2000). eDNA cloning of biologically active chicken interleukin- l 8. J. Interferon Cytokinc Res. 20, 879-883. 20. WEINING, K.C.. SICK. C., KASPERS, B., and STAEHELI. P. (1998). A chicken homolog of mammalian interleukin-1 beta: eDNA cloning and purification of active recombinant protein. Fur, J. Biochem. 258, 994-1000. 21. SCHNEIDER K.. KLAAS, R., KASPERS. B.. and STAEHELI, P. (2001). Chicken interleukin-6 eDNA structure and biological properties. Fur, J. Biochem. 268, 4200-4206. 22. BEDARD, P.-A., ALCOWI'A, I)., SIMMONS, DL., LUK, K.-C., and ERIKSON. R.L. (1987). Constituitive expression of a gene encoding a pol y peptide homologous to biologically active human platelet protein in in Rotis sarcoma virus-transformed fibroblast. Proc. Nall. Acad. Sci. USA 84, 6715-6719. 23. SUGANO. S., STOECKLE, MY., and HANAFUSA. II. (1987). Transformation by Rous sarcoma virus induces a novel gene with homology to a mitogenic platelet protein. Cell 49, 321-328. 24. KAISER. P., WAIN. H.M.. and ROTLIWELL, L. (1998). Structure of the chicken interferon-y gene. and comparison to mammalian homologous. Gene 207, 25 . 32. 25. KAISER, P.S., HUGHES, S.. and BUMSI'EAI). N. (1999). The chicken 9E3/CEF4 CXC chemokine is the avian orthologue of IL-8 and maps to chicken chromosome 4 syntenic with genes flanking the mammalian chemokine cluster. Immunogenetics 49. 673684. 26. McDONALD, PP., FADOK, V.A., BRATTON, D.. and lIENSON. P.M. (1999). Transcriptional and translational regulation of inflammatory mediator production by endogenous 'I'GF- in macrophages that hase ingested apoptotic cells. J. Immunol. 163, 6164-6172. 27. KOGUT, M.H., McGRUDER, ED., HARGIS. B.M.. CORRIER. DL., and DeI.OACH. J.R. (1995). In vivo activation of heterophil function in chickens following injection with Salmonella antOntidis-immune lymphokines. J. Leukocyte Biol. 57, 56-62. 28. KOGUT, M.H., HOLTZAPPLE, C.. LOWRY, V.K., GENOVESE, K., and STANKER, L.H. (1998). Functional responses of neonatal chicken and turkey heterophils following stimulation by inflammatory agonists. Am, J. Vet. Res. 59, 1404-1408. 29. FARNELL, M., CRII'I'EN, T.L., HE, H., SWAGGERTY, CL., and KOGUT. M.II. (2003). Oxidative burst mediated by toll-like receptors (TLR) and 1713I4 on avian heterophils stimulated with bacterial toll agonists. Dcv. Comp. Immunol. 27, 423-429. 30. KOGL'T. M.H.. GENOVESE, K.J.. and LOWRY, V.K. (2001). Differential activation of signal transduction pathways mediating phagocytosis, oxidative burst, and degranulation by chicken heterophils in response to stimulation with opsonized Salmonella enter,oth.c . Inflammation 25, 7-15. 31. KOGUT,M.H..GFNOVESE.K.J., and NISBET,D.J.(200l).Sistnal transduction pathways activated by engaging imunoglohulin Fc receptors on chicken heterophils. Des. Comp. Immunol. 25, 639646. 32. KOGUT. M.H.. LOWRY. V.K.. and FARNELL, M. (2002). Selective pharmacological inhibitors reveal the role of Syk tyrosine kinasc. phospholipase C, phosphatidylinositol-3'-kinase, and p38 mitogen-activated protein kinase in Fe receptor-mediated signaling of chicken heterophil dcgranulation. Int. Immunopharmacol. 2, 963-973. 33. KAISER. P., ROTHWELL. L., GALYOV, FE.. BARROW. P.A., BURNSIDE, J.. and WIGLEY, P. (2000). Differential cytokine ex-



327

pression in avian cells in response to invasion by Salmonella typhuniuirum, Salmonella entertidi.s. and Salmonella gallina,-um. Mi crobiology 146, 3217-3226. 34. KAISER. P., ROTHWEI.L. L., VASICEK. I).. and HALA. K. (2002). A role for IL-IS in driving the onset of spontaneous alatoirnrnne thyroiditis? J. Immune]. 168, 4216-4220. 35. KAISER, M.H.. UNDERWOOD. (i., and DAVISON, F. (2003). Differential cytokine responses following Marek's disease virus infection in chicken genotypes differing in resistance to Marek's disease. J. Virol. 77, 762-768. 36. QUERESIII. M.A. (1998). Role of macrophages in avian health and disease. Poult. Sci, 77, 978-982. 37. QUERESHI, MA.. HEGGEN, CI.., and HUSSAIN, 1. (2000). Asian macrophage: effector functions in health and disease, Dcv. Comp. Iminunol. 24, 103-119. 38. KOGUT. NIH., McGRUDER, ED., HARGIS. B.M.. CORRIER. D.E., and DeLOACH. J.R. (1994). Characterization of the pattern of inflammatory cell influx in chicks following the intraperitoneal administration of live Salmonella enteritidi.s and Salmonella enteriodi.r-immune lymphokines. Poult. Set. 74, 8-17. 39. KOGUT. M.H. (2002). D y namics of it protective avian inflammatory response: the role of an IL-8-like cytokine in the recruitment of heterophils to the site of organ invasion by Salmonella m'?itp ritidi.s. Comp. Immunol, Microbiol. Infect. Dis. 25, 159-172. 40. XIE, H., RATH. NC ., HUFF, G.R., BALOG, J.M.. and HUFF. W.E. (2(8)1). Inflammation-induced changes in serum modulate chicken macrophage function. Vet. linmunol. Immunopathol. 80, 225-235. 41. HENDERSON. B., and WISON. M.(1996). Cytokine induction by bacteria: beyond lipopolysaccharide. Cytokine 8, 269-282. 42. TELLEZ, G.I., KOGUT, M.H., and HARGIS, B.M. (1993). Immunoprophylaxis of Salmonella enteritidi.s (SE) infection by lymphokines in Leghorn chickens. Avian Dis. 37, 1062-1070. 43. DINARELLO. C.A. (1997). Interleukin-l. Cytokinc Growth Factor Rev. 8, 253-265. 44. MEHRAD. B., and STANDIFORD T.J. (1999). Role of cytokines in pulmonary antimicrobial host defense. Immunol. Rev, 20, 15­27. 45. KOGUT, M.H., TELLEZ, G.I., McGRUDER. ED.. HARGIS. B.M., WILLIAMS. J.D., CORRIER. DL, and DeLOACH. J.R. (1994). l'Ieterophils are decisive components in the early responses of chickens to Salmonella ('nter,oth.c infections. Microbic]. Pathol, 16. 141-151. 46. SUTTERWALA, F.S.. NOEL, G.J., SALGAME. P.. and MOSSER. D.M. (1998). Reversal of proinflammatory responses by ligating the muacrophage Fey receptor type I. J. Exp. Med. 188, 217-222. 47. MIJKAMOTO, M.. and KODAMA, II. (2000). Regulation of early chicken thymocyte proliferation by transforming growth factor-n from thymic stromal cells and thymocytes. Vet. Imniunol, liiimunopathol. 77, 121-132.

Address reprint requests or correspondence to: Di. Michael H. Kogut USDA -A RS. SPARC 2881 F&B Road College Station, TX 77845 Tel: (979) 260-3772 Far: (979) 260-9332 E-mail: [email protected] Received 23 February, 2003/Accepted 7 April. 2003

Suggest Documents