Differentiation of Pathogenic from Nonpathogenic Entamoeba ...

5 downloads 0 Views 1MB Size Report
classification of fewer than 10 amoebae within a few hours. The differentiation of 48 isolates into pathogenic and nonpathogenic strains by using this method ...

JOURNAL

OF

CLINICAL MICROBIOLOGY, Feb. 1991, p. 250-255

Vol. 29, No. 2

0095-1137/91/020250-06$02.00/0

Differentiation of Pathogenic from Nonpathogenic Entamoeba histolytica by Restriction Fragment Analysis of a Single Gene Amplified In Vitro EGBERT TANNICH* AND GERD D. BURCHARD Bernhard Nocht Institute for Tropical Medicine, 2000 Hamburg 36, Federal Republic of Germany Received 4 September 1990/Accepted 21 November 1990

We previously reported the identification of homologous cDNA clones derived from a pathogenic isolate and a nonpathogenic isolate of Entamoeba histolytica, which had been designated cEh-Pl and cEh-NP1, respectively. Sequence analysis of both clones had revealed 10% nucleic acid substitutions, which were dispersed over the entire sequence. This genetic difference had been found to be conserved between all four pathogenic and all five nonpathogenic laboratory strains of E. histolytica tested. On the basis of nucleic acid substitutions, we have now developed a sensitive assay to distinguish pathogenic from nonpathogenic forms of E. histolytica by using fresh clinical isolates. Comparing the sequence of cEh-Pl and cEh-NPI, we identified a 482-bp segment that contained identical 5' and 3' ends but differed in internal cleavage sites for restriction endonucleases. By using oligonucleotide primers corresponding to the 5' and 3' ends of this segment, the corresponding gene was amplified by the polymerase chain reaction. Endonuclease digestion of the amplified DNA yielded restriction fragments that are characteristic for pathogenic and nonpathogenic forms. This assay allows the detection and classification of fewer than 10 amoebae within a few hours. The differentiation of 48 isolates into pathogenic and nonpathogenic strains by using this method corresponded to the clinical status of the infected individuals and to the classification obtained by isoenzyme determination. The results further support the concept that pathogenic and nonpathogenic strains of E. histolytica constitute distinct subspecies.

Entamoeba histolytica is an enteric protozoan parasite that infests half a billion people worldwide. Ten percent of infected individuals develop disease such as hemorrhagic colitis or extraintestinal abscesses, leading to about 70,000 deaths each year (25). The numerical difference between the occurrence of infection and expression of morbidity is based on the existence of pathogenic and nonpathogenic strains of E. histolytica. Although there is disagreement about the nature of pathogenicity, strain-specific differences have been shown by biological assays, isoenzyme analysis, monoclonal antibodies, and DNA probes (9, 13, 20, 21). All current methods of classifying E. histolytica have certain disadvantages and are not useful for a rapid and sensitive distinction between pathogenic and nonpathogenic forms. Such a distinction is of considerable medical importance because it aids in the decision of whether to treat an infected individual (15, 19). We recently reported on genomic DNA differences between pathogenic and nonpathogenic E. histolytica (27). On the basis of these differences, we have now developed a rapid and reliable assay to distinguish both forms. By using the polymerase chain reaction (PCR) and subsequent restriction fragment analysis, this assay allows the detection and classification of fewer than 10 amoebae within a few hours.

transferred to TYSGM-9 monophasic medium (4) containing bacteria. E. histolytica was defined as pathogenic if (i) it originated from patients with symptoms indicative of invasive amebiasis, (ii) the sera of these patients contained antibodies specific for E. histolytica, and (iii) the E. histolytica isolates had one of the hexokinase isoenzyme patterns which had been shown to be characteristic for pathogenic forms. Isolates were defined as nonpathogenic if (i) they originated from healthy subjects, (ii) the subjects had no detectable antibodies against E. histolytica, and (iii) the isolates had one of the hexokinase isoenzyme patterns which were shown to be characteristic for nonpathogenic forms. ELISA. The enzyme-linked immunosorbent assay (ELISA) for the detection of antiamoeba antibodies was performed as previously described (10). In brief, a cell lysate was made from E. histolytica isolated from a patient with an amoebic liver abscess. The amoebae (108) were rinsed three times in cold phosphate-buffered saline (PBS). The pellet was resuspended in 1 ml of distilled water, frozen and thawed five times, and subsequently treated by ultrasound 10 times for 30 s and stored at 4°C overnight. It was then centrifuged at 30,000 x g for 30 min, and the supernatant was stored at -70°C until used as antigen. ELISA was performed in microtiter plates (24). Results were expressed as multiples of normal activity up to a maximum of 100 (8). Isoenzyme determination. The isoenzymes of hexokinase (EC 2.7.1.1) were examined as previously described (16). In brief, whole-cell lysates of the trophozoites were applied to thin-layer starch gel electrophoresis. The relative mobility of the hexokinase isoenzymes was determined by the localization of the specific enzymatic activity by using formazan development. Slow-migrating hexokinase bands were assigned to nonpathogenic forms, and fast-migrating bands

MATERIALS AND METHODS E. histolytica strains. The pathogenic E. histolytica strain SAW755 and the nonpathogenic strain SAW 760 were obtained from P. Sargeaunt (London, England) and propagated xenically in TYI-S-33 medium (5). Clinical isolates of E. histolytica from microscopically positive stool samples were cultured in Dobell-Laidlaw medium (6) and subsequently *

Corresponding author. 250

VOL. 29, 1991

PATHOGENIC AND NONPATHOGENIC E. HISTOLYTICA

251

TABLE 1. Subjects and corresponding E. histolytica isolates studied

Characterization of: Case no.

E. histolytica isolates

Infected individuals

Recent travel

Symptoms

history' 1 2 3 4 S 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 a b

Ghana China

Indonesia Ghana Guinea India

Nicaragua Nepal India Ecuador Sierra Leone Africa Dominican Republic Nigeria India Mexico Sicily Indonesia Tanzania India

Brazil Mexico India Colombia Africa Indonesia Ghana Africa

Ivory Coast Worldwide India Brazil India India India

Asymptomatic Asymptomatic Chronic diarrhea Asymptomatic Asymptomatic Asymptomatic Diarrhea Asymptomatic Asymptomatic Diarrhea Asymptomatic Asymptomatic Asymptomatic Asymptomatic Diarrhea Asymptomatic Asymptomatic Asymptomatic Meteorism Bloody diarrhea Asymptomatic Asymptomatic Liver abscess Bloody diarrhea Abdominal discomfort Asymptomatic Bloody diarrhea Asymptomatic Asymptomatic Diarrhea Asymptomatic Asymptomatic Asymptomatic Bloody diarrhea Asymptomatic Asymptomatic Asymptomatic Asymptomatic Asymptomatic Asymptomatic Liver abscess Asymptomatic Asymptomatic Asymptomatic Asymptomatic Asymptomatic Bloody diarrhea Asymptomatic

No history of travels outside of Europe. Neg, No antibodies detected; ND, not determined. ELISA units

Antiamoebic anti-

Hexokinase

bodieSb

mobility

Neg Neg ELISA, 49 U Neg ND Neg ELISA, 28 U Neg Neg ELISA, >100 U Neg Neg Neg Neg ELISA, 10 U Neg Neg Neg Neg ELISA, 44 U ND Neg ND ELISA, >100 U Neg Neg ND ND Neg ND Neg Neg Neg ND Neg Neg Neg ND Neg Neg ELISA, 44 U Neg ND Neg Neg Neg ELISA, 50 U Neg

Slow Slow Fast Slow Slow Slow

Fast Slow

Slow Fast Slow

Slow Slow Slow

Fast Slow Slow

Slow Slow Fast Slow Slow Fast Fast Slow Slow Fast Slow Slow Fast Slow Slow Slow Fast Slow Slow Slow Slow Slow Slow

Fast Slow Slow Slow Slow Slow

Fast Slow

DNA pattern

Nonpathogenic Nonpathogenic Pathogenic Nonpathogenic Nonpathogenic Nonpathogenic Pathogenic Nonpathogenic Nonpathogenic Nonpathogenic Nonpathogenic Nonpathogenic Nonpathogenic Nonpathogenic Pathogenic Nonpathogenic Nonpathogenic Nonpathogenic Nonpathogenic Pathogenic Nonpathogenic Nonpathogenic Pathogenic Pathogenic Nonpathogenic Nonpathogenic Pathogenic Nonpathogenic Nonpathogenic Pathogenic Nonpathogenic Nonpathogenic Nonpathogenic Pathogenic Nonpathogenic Nonpathogenic Nonpathogenic Nonpathogenic Nonpathogenic Nonpathogenic Pathogenic Nonpathogenic Nonpathogenic Nonpathogenic Nonpathogenic Nonpathogenic Pathogenic Nonpathogenic

-,

are as

defined in reference 8.

assigned to pathogenic forms of E. histolytica (Table 1). Preparation of E. histolytica genomic DNA. Cells were harvested in late logarithmic phase by chilling on ice for 10 min and low-speed centrifugation at 4°C for 5 min. Nuclei were obtained from washed cell pellets by lysis in 1% Nonidet P-40 and centrifugation at 500 x g at 4°C for 5 min. The nuclear pellet was resuspended, and DNA was released by treatment with proteinase K (1 mg/ml) in a buffer containing 100 mM NaCl, 10 mM Tris, 10 mM EDTA, and 0.5% N-laurosylsarcosine at 60°C for 2 h. The DNA was extracted were

twice with phenol-chloroform, 1:1 (vol/vol), and once with chloroform and was precipitated with ethanol. Preparation of E. histolytica cell lysate for PCR. Cells were harvested as described above, washed in a large volume of PBS, and centrifuged at 300 x g at 4°C for 5 min. The cell pellet was resuspended in a small volume of PBS (up to 1 ml), transferred to a 1.5-ml tube, and boiled for 10 min. Amplification procedures. Two oligonucleotide primers, P1-S17 and P1-AS20, were synthesized on an Applied Biosystems DNA synthesizer. The sequences of the primers were derived from two regions of the previously isolated

252

J. CLIN. MICROBIOL.

TANNICH AND BURCHARD

cDNA clone cEh-P1 (22). These two regions were found to be conserved in all nine E. histolytica isolates tested. P1-S17 (5'-GCAACTAGTGTTAGTTA) is a 17-mer oligonucleotide derived from the sense strand, whereas P1-AS20 (5'-CCTC CAAGATATGTTTTAAC) is a 20-mer oligonucleotide from the antisense strand of cEh-P1. Both sequences are flanking a 482-bp fragment of cEh-P1. The amplification reactions were performed with the thermostable DNA polymerase of Thermus aquaticus (Taq; Cetus Corp.) as previously described (18). Briefly, 2.5 U of Taq polymerase was used in a 100-,u reaction volume with 10 mM Tris (pH 8.3), 50 mM KCl, 1.5 mM MgCl, 200 ,uM deoxynucleotide triphosphates (Cetus Corp.), each oligonucleotide primer at 1.0 ,uM, 0.01% gelatin, different amounts of whole-cell lysate or purified genomic DNA as indicated. Samples were overlaid with 100 ,ul of mineral oil to prevent evaporation in 0.6-ml tubes (Sarstedt) and amplified for 25 to 35 cycles in an automated thermal cycler (Perkin-ElmerCetus). Each cycle consisted of 1.5 min of denaturation at 94°C, 2.0 min of annealing at 42°C, and 1.5 to 3.0 min of extension at 72°C. The final extension step continued for an additional 5 min. Restriction fragment analysis of amplified DNA. After PCR, 10 to 20 ,u of the amplified DNA was digested with the restriction endonucleases AccI, TaqI, and XmnI under conditions recommended by the supplier (Boehringer Mannheim). Digested DNA was separated on 3% NuSieve-1% SeaKem (FMC Corp.) agarose gels and visualized by ethidium bromide staining.

RESULTS Amplification of a 482-bp genomic DNA fragment of E. histolytica by PCR. We made use of genomic sequence information derived from the previously described cDNA clones cEh-P1 and cEh-NP1, which were shown to be specific for pathogenic and nonpathogenic isolates of E. histolytica, respectively. In cEh-P1 and cEh-NP1 we identified similar segments of 482 bp that contained identical sequences at the 5' and 3' ends but differed in internal cleavage sites for restriction endonucleases (Fig. 1). According to the conserved flanking regions of the 482-bp fragments, oligonucleotide primers were constructed and designated P1-S17 and P1-AS20. These primers and purified genomic DNA either from the pathogenic isolate SAW755 or from the nonpathogenic isolate SAW760 were used in the PCR. Analysis of the amplified material by electrophoresis in ethidium bromide-containing agarose gels revealed that only a single genomic fragment was amplified, that there was no detectable difference in size between the fragments amplified from the DNA of pathogenic and nonpathogenic amoebae, and that the size of the amplification product (482 bp) was consistent with the size expected from the cloned gene (Fig. 2). There was no loss of specificity when boiled cell lysates were used instead of purified DNA. To determine the sensitivity of the assay, serial dilutions of cells were tested. After 35 PCR cycles, amplified DNA of fewer than 10 amoebae was detectable (Fig. 3). There was no amplification of any fragment when purified human DNA, bacterial DNA, or DNA from Entamoeba invadens (Entamoeba species found in reptiles) was used in this assay. Differentiation between pathogenic and nonpathogenic E. histolytica by restriction fragment analysis. The amplified DNA was subjected to endonuclease digestion. Within the

cEh-P1 clh-NPI

I----P1-817-----I 11111111111111111 I1 11111 11111 Hilll1111111111 III ----- GCAACTAGTGTTAGTTACACCATTAAATCTGGTTTAACTAAAGGAAAGTTAG

----- GCAACTAGTGTTAGTTATACTATTAAGTCTGGATTAACTAAAGGAAAATTAG

AACGAGTTGAAGACAATGTTTATGACTATACACCATTCTTTGGAATAGAAGAAAATG

111 1111111 !11111111111111111111111111111

AACAAGTTGAAGAAAATGTTTATGATTATACACCAAACTTTGGAGCAGATGAAAATG

TaqI ATACATTTGTTTTAAATATTGATTGTGTTGTTAATGGAGAAAAAGTACATATCGAAC

li1 11111111 IIIIIIIIIIIII IIIIIIIIIIIIII 11111111 li1

ATACTTTTGTTTTGAATATTGATTGTATCGTTAATGGAGAAAAGGTACATATTGAAC

AAGAAGGAACATTTGAATTAGATCCACATCAAGTAGAATATGAAGTTTATAAAGATG

li1 II111111111

li1ii11111111111 1111111111111111111

AAGACGGAACATTTGAACTAGACCCACATCAAGTAGAGTATGAAGTTTATAAAGATG

TTCAAACAAGAGATATGGCACAAGCTCTTAATATTATTCAGAATAAAACTGCTAATG

11 11111 11111111 11111111111111 1111111111111111 11111

TTAAAACAAAAGATATGGAACAAGCTCTTAATACTATTCAGAATAAAACTTCTAATT

1--Imn--

ATACAGGAAGGGCTTCATTCTTTGGAATTGGAACATACAATGATGGATCAATGCAAT

1111 11 1 111 IIIII1111111111111 11 11111111 111111111 ATACTGGTACGTCTACATTCTTTGGAATTGGAAATTATGATGATGGAACAATGCAAT |AcCI|

CAATGTTAGTAGAAAAAGGTAAATTGATAGTTCCAAAATCTGGATATTATACATTGT

11111111111111111111111111111 111II 1111111111111111

CAATGTTAGTAGAAAAAGGTAAACTGATAGTTCCAACATCAGGATATTATACATTGT TTATGAAAGCAGATGATTTAGGAAGATTGTTATTGAATATTACTGGAGAGTATGAAC

11 111 111 1111111111111111111111111A11111

1111111

TTATGAAAGCAGATGATTTAGGAAGGTTGTTGTTAAATGTTAATGGAGAGTATGAAC

11111111 11111111111111111111 rTGGAG- - - - - - - - - - - - - - - - - - - - - - - - - - -

AATTATTAAATGTTAAAACATATCTTGGAGG--------------

I.-----P1-A820.------I

FIG. 1. Comparison of nucleic acid sequences derived from the cDNA clones cEh-Pl and cEh-NP1. Identical residues are indicated by vertical dashes. Shown are the homologous 482-bp fragments of both clones selected for in vitro amplification. Oligonucleotide primers (P1-S17 and P1-AS20) used for PCR are indicated as well as the restriction sites selected for sequence-specific fragmentation.

482-bp DNA fragment, the sequence differences between cEh-P1 and cEh-NP1 were predicted to lead to recognition sites for the restriction endonucleases XmnI, TaqI, and AccI that were specific for pathogenic and nonpathogenic E. histolytica (Fig. 1). When the amplified DNA of the pathogenic strain SAW755 was digested with XmnI and TaqI, two fragments each were detected (291 and 191 bp for XmnI and 321 and 161 bp for TaqI), whereas the DNA derived from the nonpathogenic strain SAW760 was not cleaved by these enzymes. In contrast, the amplified DNA of SAW760 was cleaved into two fragments by AccI (292 and 190 bp), but there was no fragmentation of the amplified DNA from SAW755 (Fig. 4). Thus, the fragmentation patterns obtained corresponded to those predicted from the sequence analysis of cEh-Pl and cEh-NP1 and are suitable to distinguish the pathogenic strain SAW755 from the nonpathogenic strain SAW760. Correlation of restriction fragment analysis with the clinical status of 48 infected individuals. E. histolytica isolates were derived from 48 individuals who had acquired the infection in various parts of the world. Thirteen had never been outside Europe; they are male homosexuals. Twelve of the 48 infected persons had clinical symptoms compatible with invasive amebiasis, whereas the remaining 36 were apparently healthy, so-called asymptomatic carriers. For the determination of antiamoeba antibodies, an ELISA was used. Serum samples from 39 persons, among them 8 patients with clinical symptoms, were available. All of these were serologically positive, but none of the asymptomatic carriers tested was positive.

VOL. 29, 1991

PATHOGENIC AND NONPATHOGENIC E. HISTOLYTICA

p

np

Xmnl p

np

TaqI np

p

253

AccI np

p

1350 1080-870 -600

310 280 --270

230190

70-

-

FIG. 4. Differentiation of E. histolytica strains by PCR and subsequent restriction fragment analysis. Whole-cell lysates of the pathogenic strain SAW755 (p) and the nonpathogenic strain SAW760 (np) were subjected to the DNA amplification procedure. Aliquots of the amplified material were digested with the restriction endonuclease XmnI, TaqI, or Accl as indicated. The digested DNAs were separated on an ethidium bromide-stained agarose gel. Size markers (in base pairs) are indicated.

120

FIG. 2. Detection of a 482-bp genomic DNA fragment from E. histolytica. One nanogram of purified genomic DNA prepared from the pathogenic strain SAW755 (p) and the nonpathogenic strain SAW760 (np) was subjected to PCR. Ten percent of the amplified material was applied to an ethidium bromide-stained agarose gel. Numbers refer to the length of fragments (in base pairs) deduced from size markers (+X174 DNA digested with the restriction enzyme HaeIII).

All 48 E. histolytica isolates were characterized by hexokinase isoenzyme determinations. All isolates from patients with symptoms showed a pathogenic pattern, and all from asymptomatic carriers showed a nonpathogenic one.

As summarized in Table 2, these data correlated well with the results obtained by PCR and subsequent restriction fragment analysis: all 36 isolates from asymptomatic carriers had the same restriction pattern as that seen with the nonpathogenic reference strain SAW760, and 11 of 12 isolates from patients with symptoms revealed the same pattern as that obtained with the pathogenic strain SAW755 (Fig. 4 ). In one case, DNA analysis did not correlate to clinical data and isoenzyme determinations (case no. 10). The isolate was derived from a European patient returning from Nepal with chronic diarrhea; she was positive for antiamoeba antibodies. DISCUSSION

0

§

O 0 LO

0 O

0

0

O UZ

0 -r

0

0

LO 9e

600---

The results presented here support the view that two genetically distinct subspecies of E. histolytica infect humans. We recently reported on two cDNA clones representing coding genomic sequences that allow the distinction between pathogenic and nonpathogenic forms (22). Initially,

310275230--

TABLE 2. Genetic analyses compared to standard isoenzyme determinations in the differentiation between pathogenic and nonpathogenic E. histolytica

O

13501080--

870--

190No. of E. histolytica isolates as characterized by:

Presence of symptoms of invasive amebiasis

FIG. 3. Sensitivity of E. histolytica DNA detection. A serial dilution of E. histolytica cell lysate (10 to 10,000 cells) was used for in vitro DNA amplification, and 10% of the reaction mixtures was subsequently loaded onto an ethidium bromide-stained agarose gel. The number of cells used for each assay and the size markers (in base pairs) are indicated.

Hexokinase isoenzyme pattern

(n )_

Present (12) Absent (36)

Restriction fragment pattern of amplified gene

Patho-

Non-

genic

pathogenic

Pathogenic

Nonpathogenic

12 0

0 36

11 0

1 36

254

J. CLIN. MICROBIOL.

TANNICH AND BURCHARD

these clones were used to test several laboratory strains of E. histolytica. We now extend this analysis to a number of fresh clinical isolates and find a nearly complete correlation to the clinical status of the infected individuals and to other markers of pathogenicity. DNA analysis apparently failed in one case. Unfortunately, additional samples from the same patient were not available to repeat the assay and to eventually study the biological properties of the isolate more thoroughly (with regard to a possible mixed infection). We tend to believe that an erroneous switch of samples caused this failure. It seems noteworthy that our study included samples from 13 male homosexuals; all of these isolates exhibited a nonpathogenic isoenzyme pattern and a nonpathogenic DNA restriction fragment pattern. This finding supports previous reports on the prevalence of nonpathogenic E. histolytica in American and European homosexual men (1, 11, 14). Taken together, increasing evidence suggests that E. histolytica can be separated into two distinct subspecies, one of which is pathogenic to humans and the other of which is not. A rapid and sensitive diagnostic procedure which allows the distinction between the two forms would obviously be of considerable medical importance. So far, specialized laboratories use isoenzymes of the carbohydrate metabolism to approach the distinction between pathogenic and nonpathogenic isolates. However, this assay needs cell lysates of approximately 106 amoebae, which requires cultivation of the isolate for several days. In addition, it has been questioned whether the isoenzyme pattern of a particular strain is stable over time (15, 19). As an alternative, DNA probes have already been applied to the classification of E. histolytica. Garfinkel et al. isolated probes from tandemly repeated sequences, which are found in highly amplified circular DNA of amoebae. One of the probes selectively hybridized to the DNA of apparently pathogenic E. histolytica, whereas the other one was specific for isolates from asymptomatic carriers (9). However, this technique also depends on cultured amoebae and still needs radioactively labeled probes, which limits its use to specially equipped and licensed laboratories. In recent years, the PCR has been widely used as an in vitro method for detecting specific DNA from minute amounts of starting material (3, 7, 12, 17, 23). Here we present an application of this technique for the distinction between pathogenic and nonpathogenic E. histolytica. The assay does not require radioactivity. In principle, it could be performed within 1 day, because its high sensitivity makes cultivation unnecessary. As yet, we have not used a simple extract of feces as starting material for the PCR. Therefore, a short-term culture of the sample is still needed. We and others are currently working on procedures to amplify E. histolytica DNA directly out of stool specimens (18a). Combining the two technical approaches, a rapid and sensitive assay for the detection of E. histolytica and the identification of pathogenic forms in fecal samples may be developed. REFERENCES

1. Allason-Jones, E., A. Mindel, P. G. Sargeaunt, and P. Williams. 1986. Entamoeba histolytica as a commensal intestinal parasite in homosexual men. N. Engl. J. Med. 315:353-356. 2. Burg, J. L., C. M. Grover, P. Pouletty, and J. C. Boothroyd.

1989. Direct and sensitive detection of a pathogenic protozoan, Toxoplasma gondii, by polymerase chain reaction. J. Clin. Microbiol. 27:1787-1792. 3. Chehab, F. F., M. Doherty, S. Cai, Y. W. Kan, S. Cooper, and

4. 5. 6. 7.

8.

9.

E. M. Rubin. 1987. Detection of sickle cell anaemia and thalassaemia. Nature (London) 329:293-294. Diamond, L. S. 1982. A new liquid medium for xenic cultivation of Entamoeba histolytica and other lumen dwelling protozoa. J. Parasitol. 68:958-959. Diamond, L. S., D. R. Hariow, and C. C. Cunnick. 1978. A new medium for the axenic cultivation of Entamoeba histolytica and other Entamoeba. Trans. R. Soc. Trop. Med. Hyg. 72:431-432. Dobell, C., and P. P. Laidlaw. 1926. On the cultivation of Entamoeba histolytica and some other entozoic amoebae. Parasitology 18:283-318. Embury, S. H., S. J. Scarf, R. K. Saiki, M. A. Gholson, M. Golbus, N. A. Arnheim, and H. A. Erlich. 1987. Rapid prenatal diagnosis of sickle anemia by a new method of DNA analysis. N. Engl. J. Med. 316:656-661. Funke, M., P. Feigner, and R. Geister. 1981. Quantification of amebae specific antibodies as multiple of normal activity with a standardized enzyme immunoassay. Zentralbl. Bakteriol. Hyg. Mikrobiol. Abt. 1 Orig. A 251:126-133. Garfinkel, L. I., M. Giladi, M. Huber, C. Gitler, D. Mirelman, M. Revel, and S. Rozenblatt. 1989. DNA probes specific for Entamoeba histolytica possessing pathogenic and nonpathogenic zymodemes. Infect. Immun. 57:926-931.

10. Knobloch, J., and E. Mannweiler. 1983. Development and persistence of antibodies to Entamoeba histolytica in patients with amebic liver abscess. Analysis of 216 cases. Am. J. Trop. Med. Hyg. 32:727-732. 11. Laughon, B. E., D. A. Druckman, A. Vernon, T. C. Quinn, B. F. Polk, J. F. Modin, R. H. Yolken, and J. G. Bartlett. 1988. Prevalence of enteric pathogens in homosexual men with and without acquired immunodeficiency syndrome. Gastroenterology 94:984-993. 12. Lench, N., P. Stanier, and R. Williamson. 1988. Simple noninvasive method to obtain DNA for gene analysis. Lancet i:13561358. 13. Mattern, C. F. T., D. B. Keister, and P. A. Caspar. 1978. Experimental amebiasis. III. A rapid in vitro assay for virulence of Entamoeba histolytica. Am. J. Trop. Med. Hyg. 27:882887. 14. Matthews, H. M., D. M. Moss, G. R. Healy, and D. Mildvan. 1986. Entamoeba histolytica isolated from homosexual men. J. Infect. Dis. 153:793-795. 15. Mirelman, D. 1987. Effect of culture conditions and bacterial associates on the zymodemes of Entamoeba histolytica. Parasitol. Today 3:37-40. 16. Mirelman, D., R. Bracha, A. Wexler, and A. Chayen. 1986. Changes in isoenzyme patterns of a cloned culture of nonpathogenic Entamoeba histolytica during axenization. Infect. Immun. 54:827-832. 17. Ou, C.-Y., S. Kwok, and S. W. Mitchell. 1988. DNA amplification for direct detection of HIV-1 in DNA of peripheral blood mononuclear cells. Science 239:295-297. 18. Saiki, R. K., D. H. Gelfand, S. Stoffel, S. J. Scharf, R. Higuchi, G. T. Horn, K. B. Mullis, and H. A. Erlich. 1988. Primer directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 230:487-491. 18a.Samuelson, J. Personal communication. 19. Sargeaunt, P. G. 1987. The reliability of Entamoeba histolytica zymodemes in clinical diagnosis. Parasitol. Today 3:40-43. 20. Sargeaunt, P. G., J. E. Williams, and J. D. Green. 1978. The differentiation of invasive and non-invasive Entamoeba histolytica isolates by isoenzyme electrophoresis. Trans. R. Soc. Trop. Med. Hyg. 72:519-521. 21. Strachan, W. D., W. M. Spice, P. L. Chiodini, A. H. Moody, and J. P. Ackers. 1988. Immunological differentiation of pathogenic and nonpathogenic isolates of Entamoeba histolytica. Lancet

ii:561-562. 22. Tannich, E., R. D. Horstmann, J. Knobloch, and H. H. Arnold. 1989. Genomic DNA differences between pathogenic and non-

VOL. 29, 1991

PATHOGENIC AND NONPATHOGENIC E. HISTOLYTICA

pathogenic Entamoeba histolytica. Proc. Natl. Acad. Sci. USA 86:5118-5122. 23. Ulrich, P. P., R. A. Bhat, B. Seto, D. Mack, J. Sninsky, and G. N. Vyas. 1989. Enzymatic amplification of Hepatitis B virus DNA in serum compared with infectivity testing in chimpanzees. J. Infect. Dis. 160:37-43.

255

24. Voller, A., A. Bartlett, and D. E. Bidwell. 1976. Enzyme immunoassays for parasitic diseases. Trans. R. Soc. Trop. Med. Hyg. 70:98-106. 25. Walsh, J. A. 1986. Problems in recognition and diagnosis of amebiasis. Estimates of the global magnitude of morbidity and mortality. Rev. Infect. Dis. 8:228-238.

Suggest Documents