Diphtheria toxin fused to human interleukin-3 is toxic to blasts ... - Nature

Leukemia (2000) 14, 576–585  2000 Macmillan Publishers Ltd All rights reserved 0887-6924/00 $15.00 www.nature.com/leu

Diphtheria toxin fused to human interleukin-3 is toxic to blasts from patients with myeloid leukemias AE Frankel1, JA McCubrey2, MS Miller1, S Delatte3, J Ramage1, M Kiser1, GL Kucera1, RL Alexander1, M Beran4, EP Tagge3, RJ Kreitman5 and DE Hogge6 1

Department of Cancer Biology, Wake Forest University School of Medicine, Winston-Salem, NC; 2Department of Microbiology, East Carolina University, Greenville, NC; 3Departments of Surgery, Medical University of South Carolina, Charleston, SC; 4Department of Medicine, MD Anderson Cancer Center, Houston, TX; 5Laboratory of Molecular Biology, National Cancer Institute, NIH, Bethesda, MD; and 6Terry Fox Laboratory, BC Cancer Agency, Vancouver, BC, Canada

Leukemic blasts from patients with acute phase chronic myeloid leukemic and refractory acute myeloid leukemia are highly resistant to a number of cytotoxic drugs. To overcome multi-drug resistance, we engineered a diphtheria fusion protein by fusing human interleukin-3 (IL3) to a truncated form of diphtheria toxin (DT) with a (G4S)2 linker (L), expressed and purified the recombinant protein, and tested the cytotoxicity of the DTLIL3 molecule on human leukemias and normal progenitors. The DTLIL3 construct was more cytotoxic to interleukin-3 receptor (IL3R) bearing human myeloid leukemia cell lines than receptor-negative cell lines based on assays of cytotoxicity using thymidine incorporation, growth in semi-solid medium and induction of apoptosis. Exposure of mononuclear cells to 680 pM DTLIL3 for 48 h in culture reduced the number of cells capable of forming colonies in semi-solid medium (colony-forming units leukemia) ⭓10-fold in 4/11 (36%) patients with myeloid acute phase chronic myeloid leukemia (CML) and 3/9 (33%) patients with acute myeloid leukemia (AML). Normal myeloid progenitors (colony-forming unit granulocyte– macrophage) from five different donors treated and assayed under identical conditions showed intermediate sensitivity with three- to five-fold reductions in colonies. The sensitivity to DTLIL3 of leukemic progenitors from a number of acute phase CML patients suggests that this agent could have therapeutic potential for some patients with this disease. Leukemia (2000) 14, 576–585. Keywords: diphtheria fusion toxin; interleukin-3; acute myeloid leukemia; chronic myeloid leukemia

Introduction Both the natural history of acute phase CML and relapsed or refractory AML is characterized by short survival (median of around 6 months) and resistance to cytotoxic chemotherapy.1,2 Chemotherapy-resistant blasts are a frequent cause of treatment failure in these patients.3 In many cases, the blasts exhibit a multi-drug resistance phenotype. New reagents with unique mechanisms of action that can selectively modify the apoptotic threshold of malignant blasts are needed. One such class of leukemia therapeutics is targeted toxin molecules. These drugs consist of myeloid leukemia-directed ligands covalently linked to protein synthesis inactivating peptide toxins. We previously selected human granulocyte– macrophage colony-stimulating factor (GM-CSF) as the ligand and fused the peptide to a truncated form of diphtheria toxin (DT) containing amino acids 1–388 of DT to produce a fusion protein, DTGM.4 DTGM reduced leukemic progenitor colony formation ⭓1 log in 85% of AML patients, 71% of juvenile myelomonocytic leukemia (JMML) patients and 60% of adult

Correspondence: AE Frankel, Hanes 4046, Wake Forest University School of Medicine, Med Center Blvd, Winston-Salem, NC 27157, USA; Fax: 336 716 0255 Received 18 November 1999; accepted 16 December 1999

chronic myelomonocytic leukemia (CMML) patients.5,6 We have scaled up production of DTGM under good manufacturing practice (GMP)7 and are currently performing a phase I dose-escalation clinical study for patients with relapsed or refractory AML. However, because DTGM was ineffective against acute phase CML patient blasts and 15% of AML patient blasts, we sought an additional ligand for targeting. Interleukin-3 (IL3) is a cytokine which supports the proliferation and terminal differentiation of multipotential and committed myeloid and lymphoid progenitors,8 but does not act on the most primitive hematopoietic stem cells.9 The IL3 receptor (IL3R) has been demonstrated by 125I-labeled IL3 binding to be present on human myeloid leukemic cells.10 Further, acute phase CML blasts proliferate in response to exogenous IL3.11,12 In fact, CML progenitors have been reported to overexpress both IL3 and IL3R, yielding an autocrine loop stimulation of proliferation.13 This also occurs in certain autocrine transformed mouse leukemia cell lines.14 The IL3R is composed of ␣ and ␤ subunits.15 The binding of IL3 to its receptor causes rapid internalization of the ligand– receptor complex.16 Thus, based on the expression of its receptor on blasts from patients with acute phase CML and AML and its rapid receptor-mediated endocytosis on receptor coupling, we chose to fuse IL3 to the catalytic and translocation domains of diphtheria toxin (DT). The goal of the present study was to synthesize an IL3-diphtheria toxin fusion molecule, purify and characterize the molecule chemically, and evaluate the toxicity of the fusion protein towards leukemia cell lines and progenitors from normal individuals as well as patients with either acute phase CML or AML. Materials and methods

Plasmid construction Primers and the polymerase chain reaction (PCR) were used to introduce NdeI and HindIII restriction sites at the ends of the IL3 gene so that the target IL3 could then be directly ligated into a previously constructed expression vector pRKDTGM encoding both diphtheria toxin (DT) and GM-CSF (GM). The GM was released from the expression vector by enzymatic digestion with NdeI plus HindIII and the new NdeI/HindIII IL3 fragment was ligated into the construct in its place. The IL3 DNA insert with NdeI and HindIII restriction sites at the ends was synthesized by PCR from a pUC18 plasmid containing mature human IL-3 cDNA (Catalog No. BBG14, Research Diagnostics, Minneapolis, MN, USA). An IL3 DNA insert with a (Gly4Ser)2 linker was prepared. Amplification was performed using the Perkin Elmer GeneAmp PCR Reagent Kit (Perkin Elmer Cetus, Norwalk, CT, USA). The

DTLIL3 is toxic to blasts from patients with myeloid leukemias AE Frankel et al

primer for the 5⬘ end was 5⬘-GCAGTCGACCATATGGGCGGAGGCGGAAGTGGAGGAGGAGGCAGCGCTCC-CAT GACCCAGACA-3⬘. The primer for the 3⬘ end was 5⬘GCAGTCGCAAAGC-TTCTAAAAGATCGCTAGCGACAA-3⬘. The IL3 DNA was amplified according to the manufacturer’s instructions in 10 mM Tris-HCl (pH 8.3)/2.5 mM MgCl2/50 mM KCl reaction mixture containing 200 ␮M of each of the four nucleotide triphosphates, 1 ␮g/ml of each primer, and 3 units of TaqGold DNA polymerase (Perkin-Elmer Cetus). After an initial denaturation step for 5 min at 94°C, the 40 ng of pUC18-IL3 was amplified by 40 cycles of denaturation at 94°C for 1 min, annealing at 50°C for 1 min, and extension at 72°C for 1 min followed by an extended extension at 74°C for 7 min. PCR product was then subcloned in the pCR-TOPO vector following the instructions of the manufacturer (TOPO TA Cloning, Version D, InVitrogen, Carlsbad, CA, USA). Plasmid DNA was isolated from stationary culture using the Wizard Plus SV Miniprep DNA Purification System (Promega, Madison, WI, USA) following the manufacturer’s instructions and sequenced using the M13 universal forward and reverse primers to confirm correct sequence for the IL3 construct. Both the IL3 vector and the pRKDTGM plasmid17 DNAs were digested with NdeI and HindIII. The 0.4 kb IL3 DNA fragment and 3.7 kb pRKDT DNA fragment were isolated from 0.7% low melting point GTG NuSieve agarose gels (FMC Corporation, Rockland, ME, USA) using the QiaQuick PCR Purification kit (Qiagen, Valencia, CA, USA) following the manufacturer’s instructions. The vector fragment was dephosphorylated with shrimp alkaline phosphatase (Boehringer Mannheim, Indianapolis, IN, USA), heat inactivated and ligated to the IL3 insert using T4 DNA ligase polymerase (Promega). A Qiagen Maxi-Prep of pRKDTLIL3 (containing a (G4S)2 linker between DT388 and IL3) was prepared and the plasmid sequenced with an Applied Biosystems Prism Dye Terminator Dideoxy cycle-sequencing kit and automated sequencer (Applied Biosystems, Foster City, CA, USA). The plasmid encoded a methionine followed by the first 388 amino acid residues of diphtheria toxin followed by the HisMet and a (G4S)2 linker followed by IL3.

Expression and purification of DTLIL3 Competent E. coli BLR (␭DE3) (Novagen, Milkwaukee, WI, USA) were transformed with 1.5 ␮l of pRKDTLIL3 (containing the (G4S)2 linker) as previously described.7 Colonies from 20 100 mm LB ampicillin plates were pooled and added to 3 of superbroth containing 0.8 mM MgSO4 and 0.25% dextrose and shaken in two 6 l Fernbach flasks at 37°C. When the culture reached an OD650 of 0.6 (2.5 h), 1 mM IPTG (Sigma, St Louis, MO, USA) was added. Two hours later, the cells were harvested by centrifugation, resuspended in 480 ml TES (100 mM Tris pH 8, 1 mM EDTA, 50 mM NaCl) containing 125 mg lysozyme, homogenized with a tissuemizer (IKA Works, Wilmington, NC, USA), incubated 45 min at room temperature, and pelleted. The inclusion bodies were washed four times with TES + 2.5% Triton X-100, and four times with TES alone. The inclusion bodies were then dissolved in 12 ml of 7 M guanidine HCl/100 mM Tris pH 8/1 mM EDTA containing 120 mg dithioerythritol, homogenized and incubated 4 h at room temperature, and pelleted. The supernatant (80 mg total protein) was added dropwise to a stirring 4°C 1200 ml 0.5 M L-arginine/1 mM EDTA/0.1 M Tris pH 8/664 mg oxidized glutathione solution and refolding continued at 4°C for 48 h.

Refolded protein was dialyzed at 4°C against 20 mM Tris pH7.4/1 mM EDTA, filter-sterilized and the 1450 ml loaded on an AKTA FPLC 5 ml HiTrap Q column in Buffer A (20 mM Tris pH 7.4, 1 mM EDTA). Protein was washed with 0.05 parts Buffer B (Buffer A + 1 M NaCl) and 0.95 parts Buffer A, and eluted with 0.13 parts Buffer B and 0.87 parts Buffer A. The eluant was diluted five-fold with Buffer A and loaded and washed on a 1 ml HiTrap Q column. Protein was eluted with 0.5 parts Buffer B and 0.5 parts Buffer A and sent to a Superloop. From the Superloop, the protein was loaded on Hi Prep 16/60 Sephacryl S-200 column and eluted in PBS. The monomer peak fractions were pooled, filter sterilized and stored at −80°C.

577

Characterization of DTLIL3 Protein was quantitated by the Coomassie Plus assay as per recommendations of the supplier (Pierce, Rockford, IL, USA). Aliquots of DTLIL3 and prestained Rainbow molecular weight standards (Amersham, Chicago, IL, USA), human IL3 (Propertech, Rocky Hill, NJ, USA) and DTGM were run on a reducing 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and either stained with Coomassie Blue R-250 (Sigma Chemical) or transferred to nitrocellulose, blocked with 10% non-fat dry milk, 0.1% sodium azide, 0.1% bovine serum albumin (BSA) in phosphate-buffered saline (PBS), washed with PBS with 0.05% Tween 20 and PBS, reacted with a 1:200 rat anti-human IL3 antibody (PharMingen, San Diego, CA, USA) or 1:200 mouse anti-diphtheria fragment A, rewashed, incubated with horseradish peroxidase-conjugated goat anti-rat Ig 1:5000 (Jackson ImmunoResearch Lab, West Grove, PA, USA) or horseradish peroxidase-conjugated goat anti-mouse Ig 1:2000, washed again, and developed with ECL reagent (Amersham, Arlington Heights, IL, USA) and exposed to X-ray film as per manufacturer’s instructions. Gels and blots were scanned on a Hewlett Packard ScanJet 6100C (Hewlett Packard, Palo Alto, CA, USA). To measure the enzymatic activity of DTLIL3, the ADP ribosylation assay modified from Collier and Kandel18 by Hwang and colleagues19 was employed.18,19 Varying amounts of transferrin-CRM10720 or DTLIL3 in 480 ␮l DTEB buffer consisting of 0.2% BSA, 40 mM DTT, 1 mM EDTA, and 50 mM Tris pH 8.0 were mixed with 10 ␮l 14C-NAD (NEN-DuPont, NEC743, 588 Ci/mmol, 10 ␮Ci/ml) and 10 ␮l wheat germ extract (Promega, L418A). Samples were incubated at 37°C for 30 min, and protein precipitated for 15 min with 4°C 0.5 ml 12% TCA. Samples were centrifuged at 25 000 g in a microfuge, washed with 1 ml 6% TCA, and dissolved in 0.3 ml 0.1 M NaOH. Samples were then added to scintillation vials with 0.2 ml 1 N HCL. Three ml scintillation fluid was added (Ecolite, ICN), and samples were counted in a Beckman LS1800 liquid scintillation counter (Beckman Instruments, Palo Alto, CA, USA). Molarity of diphtheria fragment A containing molecules vs acid precipitable c.p.m. was plotted. Free thiols were determined by the use of Ellman’s reagent and spectrophotometry as described.21 Two-dimensional PAGE with isoelectric focusing was carried out using pH 3.5–10, pH 4–6 and pH 5–7 ampholines by Wallin’s modification of the O’Farrell method.22 HPLC of DTLIL3 on a TSK3000 column with PBS at 1 ml/min was performed along with protein standards BSA and ovalbumin. Optical density at 280 nm was monitored. Reverse phase HPLC using a C4 Vydak column with a 0– Leukemia


578

70% acetonitrile in 0.05% trifluoroacetic acid mobile phase was performed with DTLIL3. Absorbance at 215 nm was measured. DTLIL3 (100 ␮g) was ethanol precipitated and analyzed by Edmond degradation and HPLC. The sequence of the N-terminal 14 amino acids was determined. Tryptic peptide mapping of DTLIL3 was performed by the method of Matsudaira.23 Tandem mass spectroscopy was performed on a Quattro II triple quadrupole mass spectrometer running MassLynx software after reverse phase HPLC as described above.

Cell lines The hematopoietic growth factor-dependent human leukemia cell lines TF1, and the TF1 derivatives TF1/Bcl2, TF1⌬MEK+LNL6, TF1⌬MEK+Bcl2 were obtained from Dr J McCubrey and grown in RPMI 1640 medium with 10% fetal bovine serum (FBS), 1 mM sodium pyruvate (GIBCO-BRL, Grand Island, NY, USA), 0.1 mM non-essential amino acids (GIBCO), 2 mM L-glutamine (GIBCO), 50 U/ml penicillin-G (GIBCO), 50 ␮g/ml streptomycin sulfate (GIBCO), and 50 ng/ml human GM-CSF (Immunex, Seattle, WA, USA). OCIAML and AML193 cells were obtained from the American Type Culture Collection (Rockville, MD, USA). Both cell lines were grown in Iscove’s modified Dulbecco’s medium with 25 mM Hepes and 10% FBS supplemented with 50 ng/ml GMCSF. M07e cells were obtained from Dr D Hogge and grown in Dulbecco’s MEM with 10% FBS, 10% 5637 conditioned medium, 50 ␮M 2-mercaptoethanol, and 5 ng/ml human IL-3. HL60, K562, and CEM human leukemia cells, P815 murine mastocytoma, and TK6 human lymphoblastoid lines were obtained from the American Type Culture Collection and maintained on RPMI 1640 medium plus glutamine with 10% FBS and penicillin/streptomycin. The properties of the cell lines and their sources are described in Table 1.

Cell line sensitivity to DTLIL3 molecule For thymidine incorporation inhibition assays, 5 × 104 cells were incubated in 100 ␮l RPMI 1640/15% FBS/ penicillin/streptomycin/glutamine in Costar 96-well flat-bot-

Table 1

Properties of assayed human cell lines

Cell line

Leukemia

Description

Growth Ref. factor dependence

M07e TF1 TF1/Bcl2

Acute myeloid leukemia Erythroleukemia TF1 with Bcl2 transgene

+ + +

HL60 CEM AML193 K562 P815 TK6 OCI-AML TF1/⌬MEK+LNL6 TF1/⌬MEK+Bcl2

Acute myeloid leukemia T lymphoblastic leukemia Acute monocytic leukemia Chronic myeloid leukemia Murine mastocytoma Human lymphoblastoid Human myeloid leukemia TF1 with ⌬MEK transgene TF1 with ⌬MEK/Bcl2 transgenes

− − + − − − + + +

45 46 Present study 47 48 49 50 51 52 53 54 54

tomed plates. Twelve different concentrations of DTLIL3 were added to each column in 50 ␮l media, and the cells maintained at 37°C/5% CO2 for 48 h. Then, 1 ␮Ci3H-thymidine (NEN DuPont, Boston, MA, USA) in 50 ␮l medium was added to each well, and incubation continued for an additional 18 h at 37°C/5% CO2. Cells were then harvested by a Skatron Cell Harvestor (Skatron Instruments, Lier, Norway) on to glass fiber mats and 3H c.p.m. were counted in an LKB liquid scintillation counter gated for 3H. The calculated IC50s were the concentrations of toxin which inhibited thymidine incorporation by 50% compared to control wells. To evaluate inhibition of colony formation as another measure of cell kill, 2 × 104 AML cell lines were incubated with different concentrations of DTLIL3 (0–400 nM) in 150 ␮l of RPMI 1640 medium plus 15% FBS supplemented with 50 ng/ml G-CSF (Amgen, Thousand Oaks, CA, USA) in 96well flat-bottomed Costar plates. After 48 h, 50 and 100 ␮l samples from each well were mixed with 1 ml methylcellulose medium (Methocult H4434, StemCell Technologies, Vancouver, BC, Canada) containing FBS, stem cell factor, GMCSF, IL-3 and erythropoietin and poured into 35-mm gridded petri dishes (Nunc, Naperville, IL, USA). Dishes were placed in humidified chambers at 37°C/5% CO2 for 14 days, after which colonies containing greater than 20 cells were counted. Both the concentrations of toxin reducing colony formation by 50% (IC50) and the maximal log cell kill compared with controls were calculated as previously described.4 For assays of apoptosis induction, aliquots of 1 × 106 cells were incubated in 24-well Costar plates at 37°C/5% CO2 for 48 h in media with different concentrations of DTLIL3. Cells were then washed in PBS and resuspended in 100 ␮l staining solution (containing Annexin-V fluorescein and propidium iodide in HEPES buffer, Annexin-V-FLOUS Staining Kit; Boerhinger-Mannheim). Following incubation at room temperature for 15 min, cells were analyzed by flow cytometry as previously described.24 Cells were also examined by phase contrast microscopy to assess morphologic changes of apoptosis (nuclear condensation and fragmentation and cytosolic membrane blebbing). In selected experiments, apoptotic induction of internucleosomal fragmentation of genomic DNA was determined. 1 × 107 cells (4 × 105/ml) were grown in the indicated conditions for 1 day. The cells were pelleted by centrifugation, resuspended in 500 ␮l of lysis buffer (20 mM TrisHCl, pH 7.4, 10 mM EDTA, 0.2% Triton X-100) and placed on ice for 10 min. The lysate was then centrifuged for 10 min at 16 000 g, and the pellet discarded. Twenty ␮l of 4 mg/ml protease K (Sigma) was added to the supernatant and the mixture was incubated overnight at room temperature. The solution was phenol extracted twice followed by chloroform extraction once. The aqueous phase was saved each time. The nucleic acids were ethanol precipitated and subsequently resuspended in water. The concentration of the nucleic acids was determined and 40 ␮g was treated with 10 ␮l of 0.25 mg/ml RNase A (Sigma) for 5–10 min. The remaining DNA was electrophoresed in an agarose gel with 1 × TBE (0.09 Tris borate, 0.002 M EDTA) running buffer and visualized with ethidium bromide. In other experiments, cells were treated in 24-well Costar plates with 50 nM DTLIL3 for 0, 6, 12, 24, 48 and 60 h periods. Cell samples were reacted with 6 ␮g/ml Hoeschst 33342 (Aldrich, Milwaukee, WI, USA) and apoptotic cells quantified using fluorescence microscopy. A total of at least 200 cells were counted, and the data calculated as percent apoptotic cells.


579

Acute phase CML, AML and normal marrow cells With the approval of the respective Institutional Review Boards and after obtaining informed patient or parental consent, heparinized blood samples were obtained from 20 patients with myeloid acute phase CML and 17 patients with AML. Heparinized marrow aspirates were also obtained from five allogeneic bone marrow donors. Blood and marrow cells were diluted 1:1 with RPMI 1640 medium and layered over 0.3 vol of Ficoll–Hypaque (1.070 g/ml; Pharmacia, Piscataway, NJ, USA). After density gradient centrifugation at 1000 g for 30 min, light density cells (⬍1.077 g/ml) were diluted three-fold with RPMI 1640 and centrifuged again at 1300 r.p.m. for 10 min. Cells were then usually cryopreserved in 50% FBS with 10% dimethylsulfoxide. Upon thawing, cells were suspended in RPMI 1640 medium with 15% FBS and 2 mM L-glutamine, 50 U/ml penicillin G, 50 ␮g/ml streptomycin sulfate with 1 mg/ml DNAse I (Sigma Chemicals). The DNAse reduces cell clumping with DNA released from necrotic cells.

Leukemic and normal progenitor cell sensitivity To evaluate inhibition of colony formation, aliquots of 1 or 2 × 105 acute phase CML, AML and normal marrow light density cells were incubated with different concentrations of DTLIL3 (0–400 nM) in 150 ␮l of RPMI 1640 medium plus 15% FBS supplemented with 50 ng/ml G-CSF (Amgen) in 96-well flat-bottomed Costar plates at 37°C/5% CO2 in air. After 48 h, 50 and 100 ␮l aliquots were plated in Methocult as described above for cell lines. Colonies were counted at 14–21 days. Results We designed an IL3R-directed fusion toxin for potential therapy of acute phase CML and AML. Our choice was based on the presence of IL3R on leukemic progenitors10–13 and on the biological potency for murine leukemic cells for similar diphtheria fusion molecules with murine IL3.25,26 Because of concern that steric hindrance from the diphtheria toxin might reduce the binding of the IL3 moiety to its receptor as was reported with murine IL3,26 we synthesized a linker form of diphtheria IL3 fusion protein. The construct consisted of the first 388 amino acids of diphtheria toxin including both the catalytic and translocation domains fused via a His-Met-(Gly4 Ser)2-linker to human IL3. The bacterial expression plasmid was successfully prepared and sequence confirmed and the construct is shown in Figure 1.

Preparation of recombinant diphtheria IL3 toxin Three liter fermentations were done using BR(DE3) E. coli transformed with pRKDTLIL3 DNA. The inclusion body yield for DTLIL3 was 79 mg protein. The refolded protein (pI of 6) was dialyzed against a low salt pH 7.4 buffer and bound to an anion exchange matrix (HiTrap Q) and eluted with a higher salt buffer (0.13 M NaCl once and 0.5 M NaCl for the concentrating chromatography step. Approximately 1.5 mg of recombinant protein was recovered from the columns from the starting 79 mg protein for a yield of 2%. All the bioactive, properly folded protein was in this fraction. Unbound and lower salt elution material (0–0.05 M NaCl) was not biologically active.

Figure 1 Construction of pRKDTLIL3 bacterial expression plasmid. The BBG14 plasmid is a pUC18 plasmid with synthetic IL3 cDNA cloned between the HindIII and EcoRI sites in the polylinker. A PCR reaction was performed with the 5⬘-oligonucleotide: 5⬘GCAGTCGACCATATGGGCGGAGGCGGAAGTGGAGGAGGAGGC AGCGCTCCCATGACCCAGACA-3⬘ and the 3⬘-oligonucleotide: 5⬘GCAGTCGCAAAGCTTCTAAAAGATCGCTAGCGACAA-3⬘. The PCR product was subcloned in the pCR-TOPO vector, restricted with NdeI and HindIII and ligated to the Ndel–HindIII restricted, alkaline phosphatase treated pRKDTGM 3.7 kb DNA fragment. Ligated DNA transformants were used to make plasmid preparations and these were sequenced and the pRKDTLIL3 plasmids isolated.

Similarly, higher salt elution protein was not biologically active and consisted of DT fragments (30–40 kDa Mr) with a pI of 5. A S200 column was then run in PBS at 0.5 ml/min. Monomeric DTLIL3 was recovered (0.45 mg/3) separate from approximately equal amounts of dimer and aggregate. Again, all the bioactivity was in the monomeric peak. Thus, the final yield of ⬎80% pure DTLIL3 was 0.6% of the starting denatured protein. Endotoxin levels were minimized by extensive Triton X-100 washes of the inclusion bodies and by separating on anion exchange and size exclusion chromatographic matrices.

Characterization of DTLIL3 Reducing SDS-PAGE showed that the recombinant molecule was ⬎80% pure. The recombinant protein had an apparent molecular weight of 58 kDa (Figure 2a). Immunoblots with anti-DTA and anti-huIL3 revealed reactivity of a major protein species of the anticipated molecular weight (Figure 2b and c). There are minor species of 50–55 kDa which react with antiDTA but not anti-huIL3. They constitute between 10 and 20% of the product. ADP-ribosylating activity was found in DTLIL3. Compared to the enzymatic activity of CRM107 (a form of diphtheria toxin with the single point mutation S525F in the receptor binding domain and a fully active enzymatic domain), DTLIL3 was equally active. DTLIL3 lacked free thiols based on reaction with Ellman’s reagent. The control ricin toxin A chain had the expected two free thiols/molecule (one internal and one external) and the diphtheria fusion molecule had ⭐0.24 free thiols/molecule. Two-dimensional SDS-PAGE Leukemia


580

Figure 2 10% SDS-PAGE of DTLIL3. (a) Commassie stained. (b) Anti-IL3 immunoblot. (c) Anti-DTA immunoblot. Molecular weight standards were run on each gel and replaced by arrows at the left of each gel.

with isoelectric focusing revealed an approximately 58 kDa protein with a pI of 6 and ⬎80% purity by densitometry. HPLC of DTLIL3 on a TSK3000 column with PBS revealed a single dominant peak with a retention time of 7.7 min whereas BSA (67 kDa) and ovalbumin (43 kDa) gave retention times of 7.5 and 8.3 min, respectively. This data was consistent with the predicted MW of DTLIL3 of 58 kDa. Reverse phase HPLC was performed using a C4 Vydak column with a 0–70% acetonitrile in 0.05% trifluoroacetic acid mobile phase. A single peak was observed at 49.4 min (49.5 min for DTGM). DTLIL3 (100 ␮g) was ethanol precipitated and analyzed by Edmond degradation and HPLC (run No. 258, Wake Forest Protein Analysis Core Lab). The N-terminal 14 amino acids of DTLIL3 matched those of DT and DTGM. Tryptic peptide mapping of DTLIL3 showed a unique peptide pattern, different than DTGM. Tandem mass spectroscopy was performed on a Quattro II triple quadrupole mass spectrometer running MassLynx software and revealed a determined MW of 58 320 daltons vs a calculated MW for DTLIL3 based on complete DNA sequencing of the plasmid and intact disulfide bonds of 58 321 daltons.

Figure 3 DTLIL3 cell cytotoxicity. Cell were incubated for 24 h with fusion protein and then pulsed for 18 h with 3H-thymidine, and then harvested on glass fiber mats and counted. (䊏) TF1/Bcl2; (왖) CEM.

Cytotoxicity of DTLIL3 to leukemic cell lines Toxicity of DTLIL3 for leukemic cell lines was assessed by measuring inhibition of cell proliferation using 3H-thymidine incorporation. The IC50 was calculated as the concentration of fusion protein inhibiting thymidine incorporation by 50% compared to control. Representative cell cytotoxicity curves with 24 h incubations in DTLIL3 are shown in Figure 3. A panel of 12 cell lines was incubated for 48 h with the fusion toxin and the results are described in Table 2. Receptor positive cell lines were sensitive to drug with IC50s of 1–28 pM whereas proliferation of the receptor negative cell lines was not impaired at concentrations exceeding 1400 pM. The low receptor density HL60 cell line showed intermediate sensitivity (IC50 = 119 pM). Co-incubation with human IL3 (1500 ng/ml) blocked toxicity to TF1/Bcl2 cells by 120-fold Leukemia

(Figure 4). The IC50 for TF1/Bcl2 without blocking IL3 was 1 pM and with IL3 was 162 pM. Inhibition of colony formation by DTLIL3 for the TF1/Bcl2 IL3 receptor positive cell line and the CEM IL3 receptor negative cell line was measured. The results are shown in Figure 5. The IC50 for TF1/Bcl2 cells was 14 pM and at 1000 pM over 3 logs cell kill was observed. This is the maximal log cell kill detectable with this assay. In contrast, no inhibition of colony formation by CEM cells was seen even when incubated with 20 000 pM DTLIL3. AML193 cells were incubated with 2 ng/ml IL3 and with or without 624 pMDTLIL3 for 1, 2, 3 or 4 days and apoptosis measured by morphology under phase contrast microscopy and flow cytometry after staining with annexin V-FITC and propidium iodide. Apoptosis measured by flow cytometry in


Table 2 toxins

581

Sensitivity of leukemia cell lines to diphtheria IL3 fusion

Cell line M07e TF1/⌬MEK+Bcl2 TF1/Bcl2 TF1/⌬MEK+LNL6 TF1 OCI-AML AML193 HL60 K562 P815 TK6 CEM

DTLIL3a IC50 (pM) 1 2 4 14 17 23 28 119 ⬎1400 ⬎1400 ⬎1400 ⬎1400

a Assay performed at least two different times with duplicate samples at each of 12 fusion toxin concentrations. Results are the mean.

Figure 5 DTLIL3 inhibition of colony formation in semi-solid medium. Cells were exposed to fusion protein at different concentrations for 48 h and then aliquoted in 0.3% agarose. Colonies with ⬎20 cells counted on day 7. (䊏) CEM; (䊉) TF1/Bcl2.

progenitor cell samples, there was ⭓1 log cell kill at 680 pM with IC50s of 7–27 pM (Figure 7 and Table 3), and 3/9 AML patient progenitor cell samples had ⭓1 log cell kill at 680 pM with IC50s of 3–68 pM. Because colony growth on many samples was limited to 10–200 colonies/105 cells, the maximal log cell kill may be an underestimate. This assay detected only the reduction in colony growth seen in 35 mm dishes so that the range varied from 1 to 3 logs.

Normal progenitor sensitivity Five normal marrow light density mononuclear cell preparations were incubated with DTLIL3 for 48 h and then assayed for CFU-GM. The IC50 was 81–675 pM with 0.5 log cell kill at 680 pM (Figure 7 and Table 3).

Figure 4 DTLIL3 cell cytotoxicity for TF1/Bcl2 cells with 24 h incubation with (䊏) and without (왖) excess blocking human IL3.

the absence of fusion toxin was 10% for each day, while apoptosis in the presence of toxin rose to 30% on day 1, 31% on day 2, 40% on day 3 and 60% on day 4. Morphologic changes and nuclear DNA fragmentation associated with apoptosis were clearly demonstrated after 48 h in the presence of fusion protein (Figure 6). The experiment was performed twice. TF1 cells incubated with 50 ng/ml human GM-CSF and 5 nM DTLIL3 for 0, 6, 12, 24, 48 and 60 h and evaluated for apoptotic nuclear bodies by Hoeschst staining showed 11%, 10%, 10%, 12%, 31%, 47%, and 68% apoptosis, respectively. Control TF1 cells showed 10% apoptosis over the same time period.

Leukemic progenitor sensitivity Colony growth was observed under our semi-solid culture conditions for 11/20 myeloid acute phase CML samples and 9/17 AML samples. For 4/11 myeloid acute phase CML patient

Discussion Drug-resistant myeloid blasts frequently show overexpression of membrane-dependent drug transporters (P-glycoprotein and lung resistance protein)27,28 and drug metabolizing enzymes (glutathione S-transferase ␲).29 Fusion toxins bypass these drug resistance pathways due to their distinct molecular shape and mechanism of action. We have previously demonstrated the cytotoxic potency of the DTGM fusion toxin both for multi-drug resistant cell lines and fresh patient leukemic progenitors.4,5 DTLIL3 may be particularly useful in acute phase CML where the majority of patients present with disease refractory to cytotoxic drugs that target cell proliferation or DNA. The yield of DTLIL3 was low and reflects the lack of optimization of refolding. Nevertheless, the purity of final product, ⬎80%, suggests the purification method is good. The contaminant appears to be proteolytically cleaved DTLIL3 with smaller 45 kDa Mr material that is immunoreactive with antiDTA but not anti-IL3. Use of newer expression vectors and use of affinity tags may yield improved yields and purity. In fact, preliminary results with a pET21 construct have given three-fold higher yields and ⬎90% purity after Ni2+ affinity chromatography (unpublished results). We have generated Leukemia


582

Figure 6 DTLIL3 apoptosis induction in AML193 cells. Cells were incubated for 48 h with or without 2 ng/ml IL3 and with or without 621 pM DTLIL3. Panels a and b are phase contrast micrographs (100×; arrows indicate apoptotic bodies in panel b). Panel c is an agarose gel electrophoresis with ethidium bromide staining of chromosomal DNA. (a) IL3 alone. (b) IL3 + DTLIL3. (c) Lane 1, media alone; lane 2, IL3 alone; lanes 3 and 4, IL3 + DTLIL3. n = 2.

Figure 7 DTLIL3 inhibition of colony formation in semi-solid medium. Cells exposed to fusion protein at different concentrations for 48 h and then aliquoted in Methocult H4434. Mean values with number of patients given in parentheses. (䊉) CFU-GM (5); (䊏) acute phase CML (4).

adequate quantities (2.5 mg) of DTLIL3 for further in vitro and in vivo testing. Diphtheria fusion protein directed to the mouse IL3R has been developed by two laboratories.25,26 In both cases, selective toxicity to receptor positive murine leukemic blasts was seen. Less damage to normal murine progenitors was observed, and adoptive transfer experiments indicated the Leukemia

absence of IL3 receptors on at least a subset of repopulating progenitor cells.25 Our study with a diphtheria fusion protein targeting the human IL3R has given similar results so far in the ex vivo targeting of human IL3R-bearing cells. DTLIL3 cytotoxicity was mediated by IL3R binding based both on blocking with human IL3 and selective toxicity to IL3R-positive leukemic cell lines. Toxicity was measured by inhibition of cell proliferation, dye exclusion, colony formation and by the induction of apoptosis. The delay in apoptosis to 48–60 h corresponds with the time required for toxin internalization, translocation and EF2 inactivation.30 Mutation of the p53 gene and loss of its function is frequently observed in acute phase CML.31 Mutant p53 cells have poor apoptosis induction by conventional cytotoxic drugs.32 In our study, p53-deficient cell lines (including TF1)33 were readily killed by DTLIL3 suggesting the fusion toxin bypasses this mechanism of drug resistance. Toxicity of DTLIL3 to fresh leukemic progenitors as well as cell lines is encouraging, since some targeted toxins have been much less effective on patient samples than cell lines.34,35 However, a number of our patient samples were relatively resistant to DTLIL3 suggesting that expression of the IL-3R on leukemic progenitors is variable. It is interesting to hypothesize that the sensitivity of some patient samples to the toxin may reflect the presence of an IL3-IL3R autocrine loop in these cells as has been previously described.13 The reduced but measurable sensitivity of CFU-GM to DTLIL3 suggests the resistance of CFU-GM to DTGM is not a general resistance to diphtheria toxin-mediated cell damage. Specific attributes such as altered GM-CSF receptor physiology on normal vs malignant cells may account for the DTGM selectivity.36 Since earlier normal myeloid progenitors (LTC-IC) are less likely to require IL3 and express IL3 recep-


Table 3 Sensitivity of normal and leukemic progenitors to DTLIL3 fusion protein

Patients

Assay

Colonies (No./105 cells)

IC50 (pM)

Log cell kill at 680 pM

Normals 1 2 3 4 5

CFU-GM CFU-GM CFU-GM CFU-GM CFU-GM

20 89 39 22 107

675 81 81 81 675

0.5 0.6 0.5 0.6 0.5

Myeloid acute CML 6 7 8 9 10 11 12 13 14 15 16

CFU-L CFU-L CFU-L CFU-L CFU-L CFU-L CFU-L CFU-L CFU-L CFU-L CFU-L

630 1138 350 67 23 32 805 945 1890 840 490

7 9 12 27 2160 756 405 1080 ⬎6750 ⬎6750 6750

1.5 1 1 1 0.5 0.4 0.4 0 0 0 0

AML 17 18 19 20 21 22 23 24 25

CFU-L CFU-L CFU-L CFU-L CFU-L CFU-L CFU-L CFU-L CFU-L

40 36 66 23 30 86 58 133 15

3 3 68 270 270 81 810 34 41

1.5 1.0 1.0 0.5 0.4 0.4 0.3 0.7 0.6

trial with 73 refractory cutaneous T cell lymphoma patients.44 At 9 and 18 ␮g/kg/day given by intravenous infusion over 15 min for 5 days for two to eight courses, 10% of patients had complete remissions and 20% of patients had partial remissions lasting 3–12+ months. The AML fusion toxin, DTGM, is currently in a phase I dose escalation study. Fourteen relapsed AML patients have been treated at 1, 2, 3, or 4 ␮g/kg/day for 5 days by 15 min intravenous infusion with side-effects limited to rare fever, transaminasemia and hypotension ameliorated by steroid prophylaxis. Thus, there is a growing clinical experience in leukemia and lymphoma patients with related molecules. DTLIL3 has the advantage of minimal IL3R expression on monocytes/macrophages. In the absence of effective strategies for the treatment of acute phase CML and patients with refractory AML, the experiments in this study suggest the need for further preclinical development of DTLIL3 as a possible new therapeutic agent for this group of poor prognosis patients. DTLIL3 may be used clinically either as a purging agent for autologous stem cell or bone marrow transplants or for systemic treatment of chemotherapyresistant AML or blast crisis CML.

583

Acknowledgements This work was supported in part by Leukemia Society of America Grant No. 6114–98 (to AF), NIH Grants No. R01CA76178 (to AF), R01CA54116 (to ET), R01CA51025 (to JM) and grants from the National Cancer Institutes of Canada (NCIC) to DH with funds from the Terry Fox Run.

References tors, they may show greater resistance to DTLIL3.9 We are currently evaluating this hypothesis. An in vitro therapeutic index reported by Ghielmini and others, can be calculated by comparison of the IC50 of DTLIL3 on sensitive leukemic CFC with that of normal CFU-GM.37–39 In these studies, we observed an in vitro index of 4–12, where values greater than 1 would suggest selective toxicity towards malignant progenitors. In comparison, when conventional chemotherapeutic agents including doxorubicin, melphalan and cytarabine have been tested in similar assays,37–39 the indices obtained were ⬍5. It will be interesting to observe whether or not the relative toxicity of DTLIL3 against normal and leukemic targets will be similar when more primitive progenitors that can be detected in long-term stromal co-cultures or immunudeficient mice are studied. DTLIL3 may also target non-hematopoietic tissues possessing high affinity IL3R.40–42 In vivo toxicology studies in animals with cross-reactive receptors will be necessary to address potential non-hematopoietic toxicities. Synergy with cytotoxic chemotherapy is likely to be observed with DTLIL3 as has been documented with DTGM.24,43 Preliminary results suggest similar DTLIL3 synergy with cytarabine as was seen with DTGM (Frankel, unpublished observations). Applications of such biologicals with conventional chemotherapy should permit reductions in dose and toxicities of each agent and improved efficacy for the combination. DTLIL3 may be a clinically useful reagent. The related diphtheria fusion protein, DAB389 IL2, has completed a phase II

1 Kantarjian HM, Keating MJ, Talpaz M. Chronic myelogenous leukemia in blast crisis. Am J Med 1987; 83: 445–454. 2 Keating MJ, Kantarjian H, Smith TL, Estey E, Walters R, Andersson B, Beran M, McCredie KB, Freireich EJ. Response to salvage therapy and survival after relapse in acute myelgenous leukemia. J Clin Oncol 1989; 7: 1071–1080. 3 List AF. Role of multidrug resistance and its pharmacological modulation in acute myeloid leukemia. Leukemia 1996; 10: 937–942. 4 Frankel AE, Hall PD, Burbage C, Vesely J, Willingham MC, Bhalla K, Kreitman RJ. Modulation of the apoptotic response of human myeloid leukemia cells to a diphtheria toxin granulocyte–macrophage colony-stimulating factor fusion protein. Blood 1997; 90: 3654–3661. 5 Hogge DE, Willman CL, Kreitman RJ, Berger M, Hall PD, Kopecky KJ, McLain C, Tagge EP, Eaves CJ, Frankel AE. Malignant progenitors from patients with acute myelogenous leukemia are sensitive to a diphtheria toxin–granulocyte–macrophage colony-stimulating factor fusion protein. Blood 1998; 92: 589–595. 6 Frankel AE, Lilly M, Kreitman RJ, Hogge D, Beran M, Freedman MH, Emanuel PD, McLain C, Hall PD, Tagge EP, Berger M, Eaves C. Diphtheria toxin fused to granulocyte–macrophage colony-stimulating factor is toxic to blasts from patients with juvenile myelomonocytic leukemia and chronic myelomonocytic leukemia. Blood 1998; 92: 4279–4286. 7 Frankel AE, Ramage J, Latimer A, Feely T, Delatte S, Hall PD, Tagge EP, Kreitman RJ, Willingham MC. High-level expression and purification of the recombinant diphtheria fusion toxin DTGM for phase I clinical trials. Protein Expression Purification 1999; 16: 190–201. 8 Suda T, Suda J, Ogawa M, Ihle JN. Permissive role of interleukin 3 (IL-3) in proliferation and differentiation of multipotential hematopoietic progenitors in culture. J Cell Physiol 1985; 124: 182– 190. 9 Ogata H, Taniguchi S, Inaba M, Sugawara M, Ohta Y, Inaba K, Leukemia


584 10

11

12

13 14

15 16

17

18 19 20 21 22

23 24

25

26

27 28

29

Leukemia

Mori J, Ikehara S. Separation of hematopoietic stem cells into two populations and their characterization. Blood 1992; 80: 91–95. Park LS, Waldron PE, Friend D, Sassenfeld HM, Price V, Anderson D, Cosman D, Andrews RG, Bernstein ID, Urdal DL. Interleukin-3, GM-CSF, and G-CSF receptor expression on cell lines and primary leukemia cells: receptor heterogeneity and relationship to growth factor responsiveness. Blood 1989; 74: 56–65. Miyauchi J, Kelleher CA, Wong GG, Yang YY, Clark SC, Minkin S, Minden MD, McCulloch EA. The effects of combinations of the recombinant growth factors GM-CSF, G-CSF, IL-3, and CSF-1 on leukemic blast cells in suspension culture. Leukemia 1988; 2: 382–387. Ailles LE, Gerhard B, Hogge DE. Detection and characterization of primitive malignant and normal progenitors in patients with acute myelogenous leukemia using long-term coculture with supportive feeder alyers and cytokines. Blood 1997; 90: 2555–2564. Jian X, Lopez A, Holyoake T, Eaves A, Eaves C. Autocrine production and action of IL-3 and G-CSF in chronic myeloid leukemia. Proc Natl Acad Sci USA 1999; 96: 12804–12809. Steelman LS, Algate PA, Blalock WL, Wang XY, Prevost KD, Hoyle PE, McCubrey JA. Oncogenic effects of overexpression of the interleukin-3 receptor on hematopoietic cells. Leukemia 1996; 10: 528–542. Hara T, Miyajima A. Two distinct functional high affinity receptors for mouse interleukin-3 (IL-3). EMBO J 1992; 11: 1875–1884. Nicola NA, Peterson L, Hilton DJ, Metcalf D. Cellular processing of murine colony-stimulating factor (Multi-CSF, GM-CSF, G-CSF) receptors by normal hematopoietic cells and cell lines. Growth Factors 1988; 1: 41–49. Kreitman RJ, Pastan I. Recombinant toxins containing human granulocyte–macrophage colony-stimulating factor and either Pseudomonas exotoxin or diphtheria toxin kill gastrointestinal cancer and leukemia cells. Blood 1997; 90: 252–259. Collier RJ, Kandel J. Structure and activity of diphtheria toxin. J Biol Chem 1971; 246: 1496–1503. Hwang J, FitzGerald DJ, Adhya S, Pastan I. Functional domains of Pseudomonas exotoxin identified by deletion analysis of the gene expressed in E. coli. Cell 1987; 48: 129–136. Greenfield L, Johnson VG, Youle RJ. Mutations in diphtheria toxin separate binding from entry and amplify immunotoxin selectivity. Science 1987; 238: 536–539. Ellman GL. Tissue sulfhydryl groups. Arch Biochem Biophys 1959; 82: 70–75. Wallin R, Culp EN, Coleman DB, Goodman SR. A structural model of human erythrocyte band 2.1: alignment of chemical and functional domains. Proc Natl Acad Sci USA 1984; 81: 4095– 4099. Matsudaira P. A Practical Guide to Protein and Peptide Purification for Microsequencing. Academic: San Diego, CA, 1993. Kim CN, Bhalla K, Kreitman RJ, Willingham MC, Hall P, Tagge EP, Jia T, Frankel AE. Diphtheria toxin fused to granulocyte– macrophage colony-stimulating factor and Ara-C exert synergistic toxicity against human AML HL-60 cells. Leukemia Res 1999; 23: 527–538. Chan CH, Blazar BR, Greenfield L, Kreitman RJ, Vallera DA. Reactivity of murine cytokine fusion toxin, diphtheria toxin390 murine interleukin-3 (DT390-mIL-3), with bone marrow progenitor cells. Blood 1996; 88: 1445–1456. Liger D, vanderSpek JC, Gaillard C, Cansier C, Murphy JR, Leboulch P, Gillet D. Characterization and receptor specific toxicity of two diphtheria toxin-related interleukin-3 fusion proteins, DAB389-mIL3 and DAB389-(Gly4Ser)2-mIL-3. FEBS Lett 1997; 406: 157–161. Gsur A, Zochbauer S, Gotzl M, Kyrle PA, Lechner K, Pirker R. MDR1 RNA expression as a prognostic factor in acute myeloid leukemia: an update. Leuk Lymphoma 1993; 12: 91–94. List AF, Spier C, Grogan T, Johnson C, Roe D, Greer J, Wolff S, Broxterman H, Scheffer G, Scheper R, Dalton W. Overexpression of the major vault transporter protein lung-resistance protein predicts treatment outcome in acute myeloid leukemia. Blood 1996; 87: 2464–2469. Russo D, Marie JP, Zhou DC, Faussat AM, Melli C, Damiani D, Michelutti A, Michieli M, Fanin R, Baccarani M. Evaluation of the clinical relevance of the anionic glutathione-S-transferase (GST pi)

30 31

32

33

34

35

36

37

38

39 40 41 42 43 44 45

46

47 48

and multidrug resistance (mdr-1) gene coexpression in leukemias and lymphomas. Leuk Lymphoma 1994; 15: 453–468. Falnes PO, Olsnes S. Modulatiion of the intracellular stability and toxicity of diphtheria toxin through degradation by the N-end rule pathway. EMBO J 1998; 17: 615–625. Mashal R, Shtalrid M, Talpaz M, Kantarjian H, Smith L, Beran M, Cork A, Trujillo J, Gutterman J, Deisseroth A. Rearrangement and expression of p53 in the chronic phase and blast crisis of chronic myelogenous leukemia. Blood 1990; 75: 180–189. McCurrach ME, Connor TM, Knudson CM, Korsmeyer SJ, Lowe SW. Bax-deficiency promotes drug resistance and oncogenic transformation by attenuating p53-dependent apoptosis. Proc Natl Acad Sci USA 1997; 94: 2345–2349. Orashima M, Teoh G, Chauhan D, Ogata A, Shirahama S, Chiharu KK, Matsuzaki M, Matsushima H, Akiyama M, Yuza Y, Maekawa K, Anderson K. MDM2 protein overexpression inhibits apoptosis of TF-1 granulocyte–macrophage colony-stimulating factordependent acute myeloblastic leukemia cells. Blood 1998; 92: 959–967. Hertler A, Schlossman D, Borowitz M, Blythman H, Casellas P, Frankel AE. An anti-CD5 immunotoxin for chronic lymphocytic leukemia: enhancement of cytotoxicity with human serum albumin-monensin. Int J Cancer 1989; 43: 215–219. Kreitman RJ, Chaudhary VK, Waldmann T, Willingham MC, FitzGerald DJ, Pastan I. The recombinant immunotoxin anti-Tac (Fv)Pseudomonas exotoxin 40 is cytotoxic toward peripheral blood malignant cells from patients with adult T-cell leukemia. Proc Natl Acad Sci USA 1990; 87: 8291–8295. Cannistra SA, Koenigsmann M, DiCarlo J, Groshek P, Griffin JD. Differentiation associated expression of two functionally distinct classes of granulocyte–macrophage colony-stimulating factor receptor by human myeloid cells. J Biol Chem 1990; 265: 12656–12563. Ghielmini M, Colli E, Bosshard G, Pennella G, Geroni C, Torri V, D’Incalci M, Cavalli F, Sessa C. Hematotoxicity on human bone marrow- and umbilical cord blood-derived progenitor cells and in vitro therapeutic index of methoxymorpholinyldoxorubicin and its metabolites. Cancer Chemother Pharmacol 1998; 42: 235–240. Ghielmini M, Bosshard G, Capolongo L, Geroni MC, Pesenti E, Torri V, D’Incalci M, Cavalli F, Sessa C. Estimate of the haematological toxicity of minor groove alkylators using tests on human cord blood cells. Br J Cancer 1997; 75: 878–883. Leglise MC, de Tailly PD, Vignot JL, Le Bot MA, Le Roux AM, Riche C. A cellular model for drug interactions on hematopoiesis. Cell Biol Toxicol 1996; 12: 39–53. Morikawa Y, Tohya K, Hara T, Kitamura T, Miyajima A. Expression of IL3 receptor in testis. Biochem Biophys Res Commun 1996; 226: 107–112. Korpelainen EI, Gamble JR, Vadas MA, Lopez AF. IL3 receptor expression, regulation and function in cells of the vasculature. Immunol Cell Biol 1996; 74: 1–17. Tabira T, Chui DH, Fan JP, Shirabe T, Konishi Y. Interleukin-3 and interleukin-3 receptors in the brain. Ann NY Acad Sci 1998; 840: 107–116. Frankel AE, Hall PD, McLain C, Safa AR, Tagge EP, Kreitman RJ. Cell-specific modulation of drug resistance in acute myeloid leukemic blasts by targeted toxins. Bioconj Chem 1998; 9: 490–496. Kreitman RJ. IBC’s International Conference on novel therapeutic proteins for oncology (drug discovery and development). Exp Opin Invest Drugs 1998; 7: 1–8. Hendrie PC, Miyazawa K, Yang YC, Langefeld CD, Broxmeyer HE. Mast cell growth factor (c-kit ligand) enhances cytokine stimulation of proliferation of the human factor-dependent cell line, M07e. Exp Hematol 1991; 19: 1031–1037. Kitamura T, Tange T, Terasawa T, Chiba S, Kuwaki T, Miyagawa K, Piao YF, Miyazono K, Urabe A, Takaku F. Establishment and characterization of a unique human line that proliferates dependently on GM-CSF, IL-3 or erythropoietin. J Cell Physiol 1989; 140: 323–334. Dalton WT, Ahearn M, McCredie KB, Freireich EJ, Stass SA, Trujillo JM. HL-60 cell line was derived from a patient with FAB-M2 and not FAB-M3. Blood 1988; 71: 242–247. Uzman BG, Foley GE, Farber S, Lazarus H. Morphologic variations in human leukemic lymphoblasts (CCRF-CEM) after long


49

50 51 52

term culture and exposure to chemotherapeutic agents. Cancer 1966; 19: 1725–1742. Lange B, Valtieri M, Santoli D, Caracciolo D, Mavilio F, Gemperlein I, Griffin C, Emanuel B, Finan J, Nowell P, Rovera G. Growth factor requirements of childhood acute leukemia: establishment of GM-CSF-dependent cell lines. Blood 1987; 70: 192–199. Klein E, Ben-Bassat H, Neumann H, Ralph P, Zeuthen J, Polliack A, Vanky F. Properties of the K562 cell line, derived from a patient with chronic myeloid leukemia. Int J Cancer 1976; 18: 421–431. Ralph P, Nakoinz I. Phagocytosis and cytolysis by a macrophage tumour and its cloned cell line. Nature 1975; 257: 393–394. Liber HL, Thilly WG. Mutation assay at the thymidine kinase locus in diploid human lymphoblasts. Mutat Res 1982; 94: 467–485.

53 Isogai C, Murate T, Tamiya-Koizumi K, Yoshida S, Ito T, Nagai H, Kinoshita T, Kagami Y, Hotta T, Hamaguchi M, Saito H. Analysis of bax protein in sphringosine-induced apoptosis in the human leukemic cell line TF1 and its bcl-2 transfectants. Exp Hematol 1998; 26: 1118–1125. 54 McCubrey JA, Steelman LS, Hoyle PE, Blalock WL, WeinsteinOppenheimer C, Franklin RA, Cherwinski H, Bosch E, McMahon M. Differential abilities of activated Raf oncoproteins to abrogate cytokine dependency, prevent apoptosis and induce autocrine growth factor synthesis in human hematopoietic cells. Leukemia 1998; 12: 1903–1929.

585

Leukemia