proposed to allow the production of single stranded DNA template. (2, 3). Methods called for a desequilibrated concentration ratio between the two primers or for ...
k.) 1991 Oxford University Press
Nucleic Acids Research, Vol. 19, No. 17 4783
Direct sequencing by thermal asymmetric PCR Georges-Raoul Mazars, Caroline Moyret, Philippe Jeanteur and Charles-Guy Theillet* CNRS UA 1191, Laboratoire de Biochimie, Val d'Aurelle-Centre Paul Lamarque, 34094 Montpellier Cedex 2, France Submitted December 12, 1990 Direct sequencing on PCR products (1) has proven powerful, however, problems have been encountered and these have been attributed to the strong tendency of the template to reanneal. In order to obviated this, asymmetric PCR protocols have been proposed to allow the production of single stranded DNA template (2, 3). Methods called for a desequilibrated concentration ratio between the two primers or for a two-step amplification procedure. Both methods do, however, have their shortfalls. The first methods is based on a large number of cycles, which is a potential source of incorporating errors, moreover it often has been the case that only one strand can easily be sequenced. The second method calling for two physically separated steps may generate product contaminations. Here we propose a method combining advantages of both symmetric and asymmetric PCR. It is based on a thermal asymmetry between the Tm of both primers. Annealing temperature of each primer is calculated with the formula: 69.3 + 0.41 (%GC) -650/L (L = primer length). PCR primers were designed in order to obtain a difference in Tm of at least 10°C.In the first step double-stranded material is produced during 20-25 cycles (to minimize the yield of spurious products) using the lower Tm. During the second step single-stranded DNA is generated using the higher Tm (Figure 1). Doing so, one primer is dropped out and linear amplification is obtained. The final quantity of single-stranded product is comparable with the one produced bv Gyllensten's method (2). We applied thermal asmmetry to several sequences which, in our hands, were difficult to sequence both from double-stranded DNA or with the Gyllensten asymmetric PCR products (Figure 2). These PCR fragments comprised: (i) exons 7 and 8 of the P53 gene; (ii) exon 1 of HRAS. This latter sequence is particulary G-C rich and as part of another study primer A was synthesized with a 40 bases long G-C stretch (in order to make a G-C clamp). In conclusion, thermal asymmetric PCR allows sequencing of both strands with the same efficiency, high reproducibility and reduced risk of contamination.
55'C
25 cycles 640C
10 cycles
Figure 1: Schematic representation of thermal asymmetric PCR. PCR reaction were set up as follows: 10 mM Tris-HCI pH 8.3; 50 mM KCl; 2 mM MgC12; 0.01 % gelatin w/v; 100 itmole dNTPs, 50 ng of genomic DNA, 1U Taq polymerase, 20 pmoles of each primer: P53 primer Al cttagtacctgaagggtgaaatattc; (Tml = 60°C), P53 primer Bi gtagtggtaatctactgggacggaacagc (Tm = 690C), P53 primer A2 taatctactgggacgga (Tm = 50°C); P53 primer B2 cccaagacttagtacctgaagggtg (Tm = 64°C); final reaction volume is 25 1I. Cycling conditions were for 25 cycles: 92°C (30 s); Tml (30 s); 72°C (90 s), followed by 10 cycles: 92°C (30 s); Tm2 (30 s); 720C (90 s). PCR products were purified by ultrafiltration on Centricon 30 to remove dNTPs. Sequenase (USB) is used according to the manufacturer's directions.
GATC >
3'
GATC 3'
.
...
> 5
*-m
REFERENCES 1. Saiki,R.K. et al. (1988) Science 239, 487-491. 2. Gyllensten,U.B. and Erlich,H.A. (1988) Proc. Natl. Acad. Sci. USA 85, 7652-7656. 3. Wilson,R.K., Chen,C. and Hood,L. (1990) Biotechniques 8,184-189. 4. Buchman,V.L. et al. (1988) Gene 70, 245-252.
*
To whom correspondence should be addressed
plus STRAND Figure 2: Sequence of both strands from from 5' to 3' end and B from 3' to 5'.
minuiis
exon
STRAND
7 to 8 (4). A shows sequence
