This material is protected by U.S. Copyright law. Unauthorized reproduction is prohibited. For reprints contact:
[email protected]
Original A rticle DNA Methylation Is Required for Silencing of Ant4, an Adenine Nucleotide Translocase Selectively Expressed in Mouse Embryonic Stem Cells and Germ Cells Nemanja RodiĆ,a Masahiro Oka,a Takashi Hamazaki,a Matthew R. Murawski,a Marda Jorgensen,b Danielle M. Maatouk,c James L. Resnick,c En Li,d Naohiro Teradaa,b a
Department of Pathology, bShands Cancer Center, cDepartment of Molecular Genetics and Microbiology, University of Florida College of Medicine, Gainesville, Florida, USA; dCardiovascular Research Center, Massachusetts General Hospital, Harvard Medical School, Charlestown, Massachusetts, USA Key Words. Embryonic stem cell • DNA methylation • Differentiation • Germ cell Adenine nucleotide translocase • Gene repression
Abstract The capacity for cellular differentiation is governed not only by the repertoire of available transcription factors but by the accessibility of cis-regulatory elements. Studying changes in epigenetic modifications during stem cell differentiation will help us understand how cells maintain or lose differentiation potential. We investigated changes in DNA methylation during the transition of pluripotent embryonic stem cells (ESCs) into differentiated cell types. Using a methylation-sensitive restriction fingerprinting method, we identified a novel adenine nucleotide (ADP/ATP) translocase gene, Ant4, that was selectively hypomethylated and expressed in undifferentiated mouse ESCs. In contrast to other pluripotent stem cell–specific genes such as Oct-4 and Nanog, the Ant4 gene was readily derepressed in differentiated cells after 5-aza-2'-deoxycyti-
dine treatment. Moreover, expression of de novo DNA methyltransferases Dnmt3a and Dnmt3b was essential for repression and DNA methylation of the Ant4 gene during ESC differentiation. Although the deduced amino acid sequence of Ant4 is highly homologous to the previously identified Ant isoforms, the expression of Ant4 was uniquely restricted to developing gametes in adult mice, and its promoter hypomethylation was observed only in testis. Additionally, Ant4 was expressed in primordial germ cells. These data indicate that Ant4 is a pluripotent stem cell– and germ cell–specific isoform of adenine nucleotide translocase in mouse and that DNA methylation plays a primary role in its transcriptional silencing in somatic cells. Stem Cells 2005;23:1314–1323
Introduction
fashion. For instance, repetitive and parasitic elements tend to be hypermethylated, whereas CpG island–associated promoters are usually hypomethylated [1]. The complex process of DNA methylation has been proven essential for normal development [2], X-chromosome inactivation [3], imprinting [4],
DNA methylation, or the addition of a methyl group to the 5'position of cytosine within the CpG dinucleotide, is a heritable modification that contributes to gene silencing. Most CpG sites in mammalian cells are methylated in a nonrandom
Correspondence: Naohiro Terada, M.D., Ph.D., Department of Pathology, University of Florida College of Medicine, 1600 SW Archer Road, Gainesville, Florida 32610, USA. Telephone: 352-392-2696; Fax: 352-392-6249; e-mail:
[email protected] Received March 16, 2005; accepted for publication May 10, 2005; first published online in Stem Cells EXPRESS July 28, 2005. ©AlphaMed Press 1066-5099/2005/$12.00/0 doi: 10.1634/stemcells.2005-0119
Stem Cells 2005;23:1314–1323 www.StemCells.com
Rodić, Oka, Hamazaki et al. and the suppression of parasitic DNA sequences [5]. Although DNA methylation is a modification that promotes genomic integrity and ensures proper temporal and spatial gene expression during development, it also associates with malignancy when aberrantly controlled. Both hypermethylation and hypomethylation have been attributed to cancer development [6, 7]. DNA methylation is proposed to prevent the binding of transcription factors and recruit repressor complexes that induce the formation of inactive chromatin complexes [8]. For example, it was recently shown that methylation of a CpG dinucleotide within the glial fibrillary acidic protein promoter prevents STAT3 binding [9]. In another instance, DNA methylation–mediated gene silencing is dependent on the presence of methyl-CpG binding protein, MeCP2, which forms a complex with histone deacetylases and a repressor protein, mSin3A, to repress transcription in a methylation-dependent manner [10]. It is still unclear in most cases, however, whether DNA methylation is a causal event in gene silencing or, rather, a consequence of gene silencing. It is becoming increasingly clear that epigenetic modifications play a critical role in the regulation of gene expression in many cellular processes [8, 11]. Studying changes in epigenetic modifications during stem cell differentiation will help us understand how cells maintain or lose differentiation potential. In the present study, we attempted to identify differentially methylated loci that are hypomethylated in undifferentiated embryonic stem cells (ESCs) and become hypermethylated after differentiation. Murine ESCs are originally derived from the inner cell mass of a developing blastocyst and have the ability to differentiate into all cell types of an adult animal [12]. Pluripotency of ESCs can be maintained in vitro when the cells are cultured in a serum-containing medium supplemented with leukemia inhibitory factor (LIF) [13]. When LIF is removed from the medium, the ESCs begin to differentiate in vitro into all three embryonic germ layers. This in vitro ESC differentiation system serves as an excellent model to study the regulation of gene expression required for stem cell self-renewal and pluripotency [14–16]. Recent studies on molecules involved in epigenetic modifications have revealed a unique expression pattern of DNA methyltransferases [17], histone deacetylases [18], and methyl-binding proteins [19] in ESCs. ESCs also have a differential genome-wide DNA methylation pattern compared with their descendant differentiated cells [20, 21]. However, exact genomic loci of such differentially methylated regions remain unknown. Using methylation-sensitive restriction fingerprinting (MSRF), we identified a novel gene encoding an adenine nucleotide (ADP/ATP) translocase homologue that is specifically expressed in undifferentiated ESCs and germ cells. Furthermore, we show that DNA methylation, but not the availability of transcription factors, is the dominant factor restricting the gene’s expression.
1315
Materials and Methods In Vitro ESC Differentiation Mouse ESC lines R1, J1, Dnmt3a-null, Dnmt3b-null, and Dnmt3a-Dnmt3b double-null ESCs [22] were maintained on gelatin-coated tissue culture dishes in Dulbecco’s modified Eagle’s medium optimized for ESCs (Invitrogen, Carlsbad, CA, http:// www.invitrogen.com) containing 1,000 U/ml recombinant mouse LIF (ESGRO; Chemicon, Temecula, CA, http://www.chemicon. com), 10% knockout serum replacement (Invitrogen), 1% fetal calf serum (Atlanta Biologicals, Lawrenceville, GA, http://www. atlantabio.com), 20 mM HEPES (Invitrogen), 300 μM monothioglycerol (Sigma-Aldrich, St. Louis, http://www.sigmaaldrich. com), 100 U/ml penicillin, 100 μg/ml streptomycin (Invitrogen), and 2 mM L-glutamine (Invitrogen). In vitro ESC differentiation was induced in an Iscove’s modified Dulbecco’s medium (Invitrogen) containing 20% fetal calf serum, 2 mM L-glutamine, 100 U/ml penicillin, 100 μg/ml streptomycin, and 300 μM monothioglycerol. The embryoid body (EB) formation was induced in a hanging drop containing approximately 2,000 cells in differentiation medium for 2 days as described previously [23].
MSRF MSRF was performed according to the original method established by Huang et al. [24]. Briefly, ESCs and EBs were harvested by gentle cell scraping followed by a 5-minute centrifugation in a bench-top centrifuge. Genomic DNA was extracted using Wizard Genomic DNA Purification Kit (Promega, Madison, WI, http:// www.promega.com). Extracted DNA was digested with a methylation-insensitive restriction enzyme (MseI) either by itself or in combination with a methylation-sensitive restriction enzyme, BstUI, at 10 U per 1 μg of DNA for each enzyme. Digestion with BstUI was performed for 2 hours at 60°C, followed by overnight incubation with MseI at 37°C. The polymerase chain reaction (PCR) was performed in 20-μl reaction mixtures containing 2 μl of digested DNA (50–100 ng), 0.4 μM of primers, 1.25 U of HotMasterTaq DNA polymerase (Eppendorf, Hamburg, Germany), 200 μM deoxynucleotide triphosphates, 1 mCi/μl [α-32P] dCTP (3,000 Ci/mmol, Amersham, Piscataway, NJ), and 2 μl of ×10 reaction buffer. The primers used in this study were Bs-1 (5'-AGCGGCCGCG), Bs-2 (5'-GCCCCCGCGA), Bs-3 (5'-CGGGGCGCGA), and Bs-4 (5'ACCCCACCCG). The PCR reaction consisted of an initial denaturing step for 5 minutes at 94°C and 30 cycles of the following: 2 minutes at 94°C, 1 minute at 40°C, and 2 minutes at 72°C. A final step at 72°C was 8 minutes. After PCR amplification, 5 μl of each sample was mixed with 1 μl of ×6 loading dye solution. Each sample was then separated in a 4.5% nondenaturing polyacrylamide gel. All reactions were run as duplicates to account for loading error. Wet gels were laid on 3M-filter paper, wrapped with plastic wrap, and exposed to Kodak X-OMAT LS film (Kodak, New Haven, CT, http://www.kodak.com) for 24–48 hours at −80°C.
1316
Cloning and Sequencing DNA segments of interest were excised from polyacrylamide gels using a sterile scalpel. DNA was eluted by incubation of gel fragments in 50 μl of sterile deionized water for 10 minutes at 100°C. Eluted DNA was reamplified by the identical primers and PCR conditions as used in the MSRF method. Reamplified DNA fragments were excised from the gel, ligated into a TA-cloning vector using pCRII-Topo Cloning Kit (Invitrogen), and sequenced. To determine the identity of resulting DNA sequences, searches were performed against the following mouse genomic databases: http://www.ensambl.org, http:// genome.ucsc.edu, and http://www.ncbi.nlm.nih.gov/genome/ seq/MmBlast.html. All of the recombinant DNA experiments here and below were performed under the National Institutes of Health guidelines.
Bisulfite Sequencing and Combined Bisulfite Restriction Analysis DNA was extracted from ESCs, EBs, and adult tissues using the DNA Wizard Genomic DNA Purification Kit (Promega). Mouse testes were decapsulated, and seminiferous tubules were collected for analysis. A bisulfite reaction was performed using EZ DNA Methylation Kit (Zymo Research, Orange, CA, http://www.zymoresearch.com). Up to 2 μg of genomic DNA was used for conversion with the bisulfite reagent. Approximately 80 ng of bisulfite-converted DNA was used as a template for each PCR analysis. Primers used for Ant4 combined bisulfite restriction analysis (COBRA) and for bisulfite sequencing were 5'-TTGTTGTGTATTGATTGAGTATG and 5'-ACACTAAAAAAAACTAAAAAACC (40 cycles). Primers used for bisulfite sequencing were 5'-AAGGTGTGTGTTATTATTGTTTGATGT and 5'-TACCCCTCATCTATCATATTCCCTA; 5'-TTGAGGAGGAGT TA ATA AGT TTAGGG and 5'-CCAAAAAACACACTCTAACCAAATAC; 5'- GTAGGTA A AT TA AT TGTGGAT TA A ATAGTA and 5'-TACACAACAACTTTTACAAAAAAAC; 5'-AGTTGTTGTGTATTGATTGAGTATG and 5'-TCTTTAAAAACTACTTCTTAAAAAATTC; and 5'-TTTTTAAGAAGTAGTTTTTAAAGAAGG and 5'-AAACAATCCAACATACCCTTATAAC. PCR fragments were cloned into pCRII-TOPO cloning vector (Invitrogen), and individual clones were sequenced.
Reverse Transcription–Polymerase Chain Reaction Total RNA was isolated from ESCs and EBs using RNAqueous kit (Ambion, Austin, TX, http://www.ambion.com). Two micrograms of RNA was used as a template for reverse transcription (RT) reactions using SuperScript Synthesis for First Strand Synthesis Kit (Invitrogen). Sequences of forward and reverse primer pairs were as follows: Ant4 (5'-TGGAGCAACATCCTTGTGTG, 5'-AGAAATGGGGTTTCCTTTGG), Oct-4 (5'-TGGAGACTTTGCAGCCTGAG, 5'-TGAATGCAT-
DNA Methylation–Dependent Repression of Ant4 GGGAGAGCCCA), Nanog (5'-AGGGTCTGCTACTGAGATGCTCTG, 5'-CAACCACTGGTTTTTCTGCCACCG), Ttr (5'-CTCACCACAGATGAGAAG, 5'-CCGTGAGTCTCTCAATTC), Fgf-5 (5'-AAAGTCAATGGCTCCCACGAA, 5'CTTCAGTCTGTACTTCACTGG), β-actin (5'-TTCCTTCTTGGGTATGGA AT, 5'-GAGCAATGATCTTGATCTTC), Gapdh (5'-CCCTTCATTGACCTCACTACATGG, 5'-CCTGCTTCACCACCTTCTTGATGTC), and Hprt (5'-GCTGGTGAAAAGGACCTCT, 5'-CACAGG ACTAGAACACCTGC).
Northern Blotting Northern blotting was performed using multiple premade blots (Clontech, Palo Alto, CA, http://www.clontech.com). Briefly, the membrane was preincubated with 5 ml of ExpressHyb Hybridization Solution at 68°C for 1 hour. Seventy-five nanograms of the full-length Ant4 or β-actin cDNA fragment was radio-labeled with [α-32 P] dCTP nucleotides. Ant1 and Ant2 probes were PCR-amplified using the following primers: Ant1 (5'-GGCGCTACTTTGCTGGTAAC, 5'-GCAATCTTCCTCCAGCAGTC), Ant2 (5'-CAGCTGGATGATTGCACAGT, 5'-CAAGCCCAGAGAATCTGTCC). Unincorporated nucleotides were removed using ProbeQuant G-50 Micro Column (Amersham Biosciences, Piscataway, NJ, http://www.amersham.com). Heat-denatured and briefly chilled probe (~20 ng/ml) was added to the hybridization solution. The membrane was incubated with gentle shaking for 24 hours at 68°C and washed twice for half an hour per wash in ×2 standard saline citrate (SSC)/0.05% SDS at room temperature and twice in ×0.1 SSC/0.1% SDS at 50°C. The membrane was wrapped with plastic wrap and exposed to X-OMAT Kodak film at −80°C for 18–24 hours.
Immunohistochemistry Rabbit polyclonal antibodies were raised against mouse Ant4 peptide (1-MSNESSKKQSSKK ALFD-17) and purified through an affinity column using the same peptide (Sigma Genosys, The Woodlands, TX, http://www.sigma-genosys. com/index.asp). Mouse ovary, testis, and liver were harvested from 3-month-old BALB/c mice and immediately frozen into optimal cutting temperature blocks (Tissue-Tek, Torrance, CA, http://www.sakura.com). Frozen sections were cut at 5 μm, air-dried for 2 hours, and then fixed in acetone for 10 minutes before being rehydrated and blocked for endogenous peroxidase activity. After a serum-blocking step, affinity-purified rabbit polyclonal anti-Ant4 antibodies were applied at 2 μg/ml and incubated overnight at 4°C. Staining was achieved using the EnVision+ HRP kit (DakoCytomation, Glostrup, Denmark, http://www.dakocytomation.com) following the manufacturer’s directions. Positive signal was detected with DAB+ (DakoCytomation), and slides were counterstained using Light Green SF Yellowish (Sigma-Aldrich).
Rodić, Oka, Hamazaki et al.
Primordial Germ Cell Preparation Primordial germ cells (PGCs) were obtained from timed matings of B6C3F1 mice purchased from Jackson Laboratory (Bar Harbor, ME, http://www.jax.org). Noon of the day on which a mating plug was first observed was taken to be 0.5 days post coitus (dpc). PGCs were immunomagnetically purified using anti-SSEA1 antibody from isolated urogenital ridges as described [25]. Genital ridges at 12.5 dpc were sex-separated by visual inspection for testis cords. The immunodepleted fraction refers to cells not retained on the magnetic column.
1317
the other mouse adenine nucleotide translocase (Ant) proteins previously identified (70.1% and 69.1% overall amino acid identity to Ant1 and Ant2 isoform, respectively) (Fig. 2A). The MF1-associated
Results Identification of a CpG-Rich DNA Sequence That Undergoes De Novo DNA Methylation During ESC Differentiation We investigated changes in DNA methylation during the transition of ESCs into differentiated cell types using an MSRF method. Mouse ESCs were differentiated in a culture medium without LIF using a hanging drop method. DNA was extracted from undifferentiated ESCs (day 0) and differentiated EBs (days 5 and 10). The DNA was then digested by a combination of methylation-sensitive (BstUI) and insensitive (MseI) restriction enzymes and amplified by PCR using CpG-rich 10-mer primers (Fig. 1A). Using a combination of four different CpG-rich primers, we identified a total of eight bands that exhibited differential methylation patterns during ESC differentiation (data not shown). The bands were excised from the gels, and their DNA sequences were determined. Database searches revealed that one of these methylated fragments (methylated fragment 1, MF1 in Figs. 1B, 1C) mapped to the exon 1/intron 1 boundary of a previously uncharacterized gene (RIKEN cDNA 1700034J06). The other seven DNA fragments were localized outside of any CpG islands and were derived from various genomic regions. Because the MF1 DNA fragment mapped to a genomic region that partially overlapped with a CpG island, we decided to further analyze the associated gene. The associated gene on mouse chromosome 13 did not contain a classic TATA box sequence at its 5'-flanking region. Because TATA-less genes are often associated with multiple transcriptional initiation sites, we performed a 5'RACE (rapid amplification of cDNA ends) reaction using cDNA isolated from undifferentiated ESCs. 5'RACE identified five different transcriptional initiation sites, four of which were previously reported in Expressed Sequence Tag (EST) databases (data not shown). Because there are multiple transcriptional initiation sites, nucleotide positions are marked relative to the translation initiation site (+1) throughout the manuscript. The major transcript initiated at −60 bp, whereas the longest transcript initiated 304 bp upstream of the translation initiation site. The MF1-associated gene was predicted to encode a 320-aminoacid protein and shared high amino acid sequence homology with
Figure 1. Identification of differentially methylated CpG-rich fragment in ES cells and EBs. (A): MSRF. Genomic DNA was prepared from undifferentiated ES cells and differentiating EBs (days 5 and 10). DNA was digested either by MseI alone or MseI and BstUI and subjected to PCR amplification using CpG-rich 10-mer primers in the presence of radiolabeled dCTP. Amplified DNA fragments were separated in 4.5% polyacrylamide gels. In MseI/BstUI double-digested samples, the intensity of a band indicated by arrowhead (MF1) increased after ES cell differentiation. (B): Nucleotide sequence of methylated fragment 1 (MF1). The DNA band was cloned into a PCR cloning vector and sequenced. Bold letters indicate primers used, whereas BstUI sites are underlined. MF1 corresponds to the exon 1/intron 1 boundary region of a previously uncharacterized gene on mouse chromosome 13; black solid boxes represent exons predicted by Expressed Sequence Tag and Ensemble mouse genome databases. The translation initiation site is marked as +1. The arrow represents the major transcription initiation site (−60 bp). Abbreviations: EB, embryoid body; ESC, embryonic stem cell; MseI, methylation-insensitive restriction enzyme; MSRF, methylation-sensitive restriction fingerprinting; PCR, polymerase chain reaction.
1318
gene also contained three tandem repeats of a domain of approximately 100 residues, each domain containing two transmembrane regions, a characteristic shared by all members of the Ant family [26]. Because another isoform of Ant, ANT3, has been reported in human [27], we tentatively named the present gene adenine nucleotide translocase 4 (Ant4). All known mammalian Ant isoforms (unlike plant adenine nucleotide translocases) lack an N-terminal mitochondrial localization sequence, yet they localize to mitochondria [28]. In agreement with this observation, Ant4 also does not contain a classic mitochondrial localization sequence. However, it did localize to mitochondria when N-terminal FLAG-tagged Ant4 was expressed in NIH3T3 fibroblast cells (data not shown). The human orthologue of ANT4 is located on chromosome 4q28.1, and its deduced amino acid sequence shares 85.9% overall amino acid identity with mouse Ant4 (Fig. 2B). In addition, the genomic architecture with six exons is conserved between mouse and human (data not shown). It is notable that the human genome contains at least seven ANT pseudogenes on the X chromosome; however, in contrast to ANT4, such pseudogenes do not reveal conserved exon/intron architecture or translatable coding regions [29].
DNA Methylation–Dependent Repression of Ant4
Ant4 Promoter Locus Undergoes De Novo DNA Methylation After ESC Differentiation To determine DNA methylation patterns across the Ant4 promoter locus during ESC differentiation, genomic DNAs from ESCs or day-10 EBs were treated with bisulfite and subjected to sequence analysis. We analyzed the Ant4 promoter region that encompasses a total of 47 CpG dinucleotides, from 516 bp upstream of the translation initiation site to the 3'-end of exon 1. Sequencing of individual bisulfite-converted genomic DNAs revealed that the Ant4 promoter and associated CpG island region were mostly unmethylated in undifferentiated ESCs (Fig. 3). In contrast, EBs at day 10 showed significant hypermethylation around the Ant4 promoter region, indicating that after ESC differentiation, the Ant4 promoter undergoes de novo DNA methylation. The further upstream region (>1 kb) of the Ant4 promoter outside of the CpG island revealed hypermethylation regardless of the differentiation status of ESCs (Fig. 3). Ant4 promoter methylation was confirmed by the quantitative method of COBRA [30]. The frequency of methylation at a specific CpG site overlapping an HhaI restriction site (−169 bp) was evaluated by the COBRA assay. In agreement with the bisulfite sequencing data, we detected low levels of DNA methylation in ESCs and high methylation levels (~75%) in EBs at day 10.
Ant4 mRNA Expression Is Downregulated After ESC Differentiation We then examined Ant4 mRNA expression levels in ESCs and EBs using semiquantitative RT-PCR. Ant4 mRNA was easily detectable in undifferentiated ESCs, whereas the relative abundance of Ant4 mRNA decreased after ESC differentiation (Fig. 4A). β-Actin expression was relatively unchanged during ESC differentiation. We then used the DNA demethylating agent 5-aza-2'deoxycytidine (5-aza-dC) to study the effect of demethylation on transcription of the Ant4 gene. 5-aza-dC induces DNA demethylation in cells by depleting DNA methyltransferases through its covalent and irreversible binding to the enzymes. Notably, the Ant4 gene was readily derepressed by the addition of 5-aza-dC to differentiated EBs (day 10) (Fig. 4B). In contrast, expression of Oct-4 and Nanog, transcription factors selectively expressed in pluripotent ESCs and primordial germ cells, was not affected. Ant4 (but not Oct-4 or Nanog) was similarly derepressed by addition of 5-aza-dC in NIH3T3 cells and an immortalized endoderm precursor cell line (OBAT, unpublished data).
DNA Methylation of Ant4 Gene During ESC Differentiation Requires Dnmt3 Figure 2. Ant4 encodes a novel isoform of adenine nucleotide translocase. (A): Deduced amino acid sequence of the mouse Ant4 gene is aligned with previously identified mouse Ant proteins (Ant1 and Ant2). (B): Deduced amino acid sequence of the mouse Ant4 gene is aligned with ANT4 human orthologue.
DNA methyltransferase 3a and 3b (Dnmt3a and Dnmt3b) has been proposed to play a primary role in de novo methylation during murine embryonic development [31]. To investigate the role of the Dnmt3 in the establishment of DNA methylation of the Ant4
Rodić, Oka, Hamazaki et al. promoter during ESC differentiation, we used ESCs homozygously deleted for both the Dnmt3a and Dnmt3b genes. Dnmt3aDnmt3b double-null ESCs (earlier passage cell lines) were subjected to the same differentiation protocol as parental (wild-type) J1 ESCs. Of interest, Ant4 expression was not suppressed but rather increased in differentiated double-null cells (Fig. 5A). In contrast, the pluripotent ESC marker Oct-4 was downregulated, whereas the primitive ectoderm marker fibroblast growth factor,
Figure 3. Ant4 promoter region undergoes DNA methylation during ES cell differentiation. Summary of Ant4 methylation levels in ES cells and EBs (day 10) is illustrated. For each primer pair, up to 14 clones were sequenced after bisulfite treatment of either ES cells or EBs (day 10) to determine the rate of DNA methylation. Closed circles represent methylated CpG, whereas open circles represent unmethylated CpG. The y-axis of the graph represents percent methylation for each CpG residue. Diagram at the bottom represents relative position of CpG residues within the 5'-end regulatory region of Ant4 gene. Nucleotide positions are marked relative to the translation initiation site (+1). Arrow represents a major transcription start site (−60 bp), black rectangle represents the first exon, and vertical lines mark the location of individual CpG residues. Abbreviations: EB, embryoid body; ESC, embryonic stem cell.
1319
Fgf-5, and endoderm marker transthyretin, Ttr, were upregulated after ESC differentiation. These results indicate that Dnmt3aDnmt3b double-null ESCs proceed with a normal differentiation pattern. COBRA assays confirmed that there was an absence of DNA methylation at the Ant4 promoter region (−169 bp) in the double knockout ESCs (Fig. 5B). These results indicate that functional Dnmt3 is required for repression of the Ant4 gene during ESC differentiation. In addition, we examined which member of the Dnmt3 gene family, Dnmt3a or Dnmt3b, played a predominant role in Ant4 methylation using ESCs deleting either gene. As shown in Figure 5C, downregulation of Ant4 expression was incomplete when Dnmt3a-null ESCs or Dnmt3b-null ESCs were differentiated. Furthermore, both Dnmt3a-null ESCs and Dnmt3b-null ESCs demonstrated virtually no DNA methylation on the CpG site assayed by COBRA. These data indicated that both Dnmt3a and Dnmt3b are required for DNA methylation and repression of Ant4.
Figure 4. Ant4 is repressed during ES cell differentiation. (A): Total RNA was extracted from undifferentiated ES cells and differentiating EBs at days 5 and 10. RNA expression levels of Ant4 and β-actin were evaluated by semiquantitative RT-PCR analysis using various cycles of DNA amplification (20 to 30 cycles). (B): Ant4 derepression by 5-aza-dC. EBs were treated with various concentrations (0–10 μM) of 5-aza-dC for 48 hours from day 8 and harvested at day 10. RNA expression levels of Ant4, Oct-4, Nanog, and β-actin genes were examined by RT-PCR. Abbreviations: 5-aza-dC, 5-aza-2'-deoxycytidine; EB, embryoid body; ESC, embryonic stem cell; RT-PCR, reverse transcription–polymerase chain reaction.
1320
DNA Methylation–Dependent Repression of Ant4
Hypomethylation of the Ant4 Promoter and Ant4 Expression Are Restricted to Testicular Germ Cells To determine if Ant4 is specifically expressed in ESCs, we initially used a Basic Local Alignment Search Tool (BLAST) search against EST databases. We used full-length Ant4 cDNA as a query sequence and found a total of eight cDNA clones (with scores of >200 bits). All clones identified were from testis. We then investigated expression patterns of Ant4 in adult mouse organs using Northern blot analysis. Ant4 mRNA was found specifically in testes, at the predicted approximately 1.6-kb transcript size, but was
Figure 5. Dnmt3 is required for Ant4 repression during ESC differentiation. (A): Expression of the Ant4 gene in WT ES cells and Dnmt3a-Dnmt3b double-null ESCs. WT J1 ES cells and Dnmt3aDnmt3b double-null ESCs (Dnmt3a −/−, Dnmt3b −/−) were differentiated as described above. RNA expression was evaluated using RT-PCR as described above. Oct-4, Ttr, and Fgf-5 are markers for undifferentiated ESCs, early visceral endoderm, and early ectoderm, respectively. (B): Ant4 promoter DNA methylation determined by COBRA assay. DNA was extracted from WT ESCs and Dnmt3a-Dnmt3b-null ESCs (Dnmt3a −/−, Dnmt3b −/−) and treated with bisulfite. The Ant4 promoter region was amplified and subjected to overnight digestion with HhaI restriction enzyme, which cuts GCGC sites at −169 bp. DNA methylation of the CpG protects the site from bisulfite conversion; thus, the polymerase chain reaction fragments are digested by HhaI only when the template genomic DNA is methylated at the site. The digested DNA samples were separated in 4.5% polyacrylamide gels and visualized using a SyBr-green dye. (C): Expression of the Ant4 gene and Ant4 promoter methylation in Dnmt3a-null ESCs and Dnmt3b-null ESCs. Dnmt3a-null ESCs (Dnmt3a −/−) and Dnmt3b-null ESCs (Dnmt3b−/−) were differentiated, and Ant4 expression and DNA methylation of the Ant4 promoter were examined as described above. Abbreviations: COBRA, combined bisulfite restriction analysis; EB, embryoid body; ESC, embryonic stem cell; RT-PCR, reverse transcription–polymerase chain reaction; WT, wild-type.
Figure 6. Ant4 expression and promoter DNA methylation in adult organs. (A): Northern blot analysis of Ant4 mRNA expression in various organs from adult mice (8 weeks old). The blot was hybridized to specific cDNA probes for Ant4, Ant1, Ant2, and β-actin. (B): Immunohistochemical analysis of Ant4 expression in testis, ovary, and liver. Mouse ovary, testis, and liver were harvested from 3-month-old mice, and frozen sections were stained with affinity-purified rabbit polyclonal anti-Ant4 antibodies and visualized using horse radish peroxidase (brown). Slides were counterstained using Light Green SF Yellowish. (C): Bisulfite analysis of the Ant4 promoter in various organs from adult mice (8 weeks old). DNA samples were extracted from the indicated mice organs and subjected to bisulfite conversion. Seven to eight individual clones were sequenced for each sample. Nucleotide positions are marked relative to the translation initiation site. Arrow represents a major transcription start site (−60 bp). (D): Ant4 mRNA is expressed in purified primordial germ cells. Primordial germ cells were obtained from E11.5 and 12.5-dpc genital ridges and purified using anti-SSEA1 magnetic beads. The immunodepleted fraction (dep) refers to cells not retained on the magnetic column. Individual samples were subjected to reverse transcription–polymerase chain reaction analysis.
Rodić, Oka, Hamazaki et al. undetectable in any other organs examined in Figure 6A. There was no detectable Ant4 mRNA expression in stomach, small intestine, skeletal muscle, ovary, thymus, uterus, or placenta (data not shown). In contrast, the previously identified Ant isoforms, Ant1 and Ant2, were expressed in many non-germ cell organs at various levels but were low or undetectable in testes. We then examined which cells within testis express the Ant4 protein using specific antibodies raised against mouse Ant4 (Fig. 6B). Results obtained from immunohistochemical analyses confirmed the presence of Ant4 protein within testicular tissue. The strong cytoplasmic staining of spermatagonia, spermatocytes, and spermatids within the seminiferous tubules, coupled with the lack of signal in interstitial, capillary, and capsular cells, suggests testicular germ cell–specific expression of Ant4. Of interest, it seems that mature sperm is absent for Ant4 expression. Although Northern blot analyses using whole ovaries did not detect any Ant4 gene expression (described above), immunohistochemical analyses revealed that Ant4 protein is selectively expressed in the cytoplasm of oocytes (Fig. 6B, middle panels). In contrast, staining performed on liver sections was negative. These data indicate that Ant4 is specifically expressed in developing gametes in testis and ovary. Similar data were obtained using in situ RNA hybridization with riboprobes against Ant4 transcript (data not shown). Further, we determined DNA methylation levels across the Ant4 promoter region in adult mice organs. Only testis showed hypomethylation of the Ant4 promoter, whereas other tissues examined were hypermethylated (Fig. 6C). Additionally, Ant4 was expressed in purified primordial germ cells, obtained from E11.5 and 12.5-dpc genital ridges when they were purified using anti-SSEA1 magnetic beads (Fig. 6D). The data indicate that Ant4 is expressed in premeiotic fetal germ cells as well.
Discussion We have identified a novel isoform of the adenine nucleotide translocase genes, Ant4, by screening differential DNA methylation patterns in ESCs and EBs. Selective expression status of Ant4 in undifferentiated ESCs, primordial germ cells, and developing gametes in adult testis and ovary indicates that Ant4 is a pluripotent cell-specific isoform of the adenine nucleotide translocase family in mouse. This contrasts with the previously identified isoforms of mouse Ant, Ant1 and Ant2, which are predominately expressed in somatic cells. BLAST analysis revealed the human orthologue (ANT4), which shares a high homology in deduced amino acid sequence with mouse Ant4. Moreover, the mouse Ant4 and human ANT4 genes have a conserved genomic architecture. While we were preparing this manuscript, Dolce et al. [32] reported this human orthologue as AAC4 (ADP/ATP carrier protein 4), which they identified by screening human genome databases for homology to AAC1 (ANT1). Their study demonstrated that AAC4 actively exchanges ADP for ATP by an electrogenic antiport mechanism. Although AAC4 expression was highest in testis among
1321
human tissues, as we showed here with mouse Ant4, their real-time PCR analysis indicated that AAC4 was expressed in other somatic organs, including liver and brain. This is in contrast to the pattern of Ant4 expression in mice demonstrated by Northern blotting and immunohistochemical analyses in the present study, which is highly restricted to developing gametes among adult tissues. Ant exchanges mitochondrial ATP for cytosolic ADP and therefore plays a pivotal role in cellular metabolism in eukaryotic cells. It is intriguing that germ cell–specific isoforms also exist in other proteins involved in mitochondrial energy metabolism. Developing spermatocytes are known to express testis-specific isoforms of pyruvate dehydrogenase complex E1α subunit, Pdha-2 [33], testis-specific cytochrome c, Cyt cT, [34], and subunit VIb of cytochrome c oxidase [35]. Interestingly, Cyt cT–null mice exhibit early testicular atrophy and apoptosis [34]. Ant has been implicated in the mitochondrial permeability transition, which is a common feature of apoptosis. It is possible that this germ cell–specific isoform of Ant, probably interacting with other germ cell–specific mitochondrial membrane proteins, could also be critical for germ cell development and maintenance. Further, a recent study indicates that an antiapoptotic protein, Bcl2, supports ESC survival and maintenance in harsh culture conditions such as serum deprivation [36], implying that antiapoptotic mechanisms of the mitochondrial membrane play a role in ESC self-renewal. We are now generating Ant4-null ESCs and knockout mice, which will elucidate the in vivo function of the protein in spermatogenesis and ESC maintenance. The present data indicate that de novo DNA methylation, mediated by Dnmt3a and Dnmt3b, plays a pivotal role in gene repression of Ant4 during ESC differentiation. In adult organs, as well as during in vitro ESC differentiation, Ant4 expression levels inversely correlated with the DNA methylation status of the gene. Further, Ant4 was readily derepressed by addition of the demethylating agent 5-aza-dC. In contrast, Oct-4 and Nanog, genes specifically expressed in pluripotent stem cells and primordial germ cells, were not derepressed by 5-aza-dC. This implies that transcription factors involved in Ant4 gene expression are present and active in differentiated EBs and that DNA methylation may play a primary role in the suppression of the Ant4 gene in somatic cells. We confirmed derepression of Ant4, but not Oct-4 or Nanog, by addition of 5-aza-dC into two other somatic cell lines. Further, this hypothesis was supported by the fact that functional deletion of Dnmt3a and Dnmt3b led to failure of gene suppression of Ant4, but not Oct-4, during ESC differentiation. Taken together, these data suggest that DNA methylation is required for the transcriptional repression of the Ant4 gene. The present data also indicate that both members of the Dnmt3 gene family are required for complete repression of the Ant4 gene. At the particular CpG site that we investigated by COBRA, DNA methylation was hardly detected in single-knockout EBs within 10 days of differentiation. Dnmt3a and Dnmt3b may induce DNA methylation cooperatively at some CpG sites.
1322
Undifferentiated ESCs are known to be transcriptionally permissive for expression of some germ line cell–specific genes [37]. This might be due to a conserved mode of transcriptional regulation between ESCs and germ cells or simply reflect the fact that ESCs are derived from largely unmethylated preimplantation embryos (i.e., blastocyst). Recent reports demonstrated that DNA methylation is involved in the transcriptional regulation of several germ cell–specific genes, including pgk2 [38], pdha-2 [39], the MAGE gene family [40], and Tact1/Actl7b [41]. Because Ant4 is expressed exclusively in the testes of the adult mouse, the regulation of Ant4 transcription may be closely related to that of other germ cell–specific genes. Of interest, the promoter region of Ant4 contains the Coup-Tf binding element at −586 bp, which has been implicated in selective silencing of the c-Mos proto-oncogene in somatic cells [42, 43]. In addition, the Ant4 promoter has multiple elements that potentially bind to
References 1
Robertson AK, Geiman TM, Sankpal UT et al. Effects of chromatin structure on the enzymatic and DNA binding functions of DNA methyltransferases DNMT1 and Dnmt3a in vitro. Biochem Biophys Res Commun 2004;322:110–118.
2
Li E, Bestor TH, Jaenisch R. Targeted mutation of the DNA methyltransferase gene results in embryonic lethality. Cell 1992;69:915–926.
3
Panning B, Jaenisch R. RNA and the epigenetic regulation of X chromosome inactivation. Cell 1998;93:305–308.
4
Li E, Beard C, Jaenisch R. Role for DNA methylation in genomic imprinting. Nature 1993;366:362–365.
5
Walsh CP, Chaillet JR, Bestor TH. Transcription of IAP endogenous retroviruses is constrained by cytosine methylation. Nat Genet 1998;20:116– 117.
6
Jones PA, Laird PW. Cancer epigenetics comes of age. Nat Genet 1999;21:163–167.
7
Baylin SB, Esteller M, Rountree MR et al. Aberrant patterns of DNA methylation, chromatin formation and gene expression in cancer. Hum Mol Genet 2001;10:687–692.
8 9
Bird AP, Wolffe AP. Methylation-induced repression: belts, braces, and chromatin. Cell 1999;99:451–454. Takizawa T, Nakashima K, Namihira M et al. DNA methylation is a critical cell-intrinsic determinant of astrocyte differentiation in the fetal brain. Dev Cell 2001;1:749–758.
10 Nan X, Ng HH, Johnson CA et al. Transcriptional repression by the methyl-CpG-binding protein MeCP2 involves a histone deacetylase complex. Nature 1998;393:386–389. 11 Grewal SI, Moazed D. Heterochromatin and epigenetic control of gene expression. Science 2003;301:798–802. 12 Evans MJ, Kaufman MH. Establishment in culture of pluripotential cells from mouse embryos. Nature 1981;292:154–156. 13 Smith AG, Heath JK, Donaldson DD et al. Inhibition of pluripotential embryonic stem cell differentiation by purified polypeptides. Nature 1988;336:688–690. 14 Chambers I, Colby D, Robertson M et al. Functional expression cloning
DNA Methylation–Dependent Repression of Ant4 Sox/Sry factors, which have also been implicated in early cell fate specification in development and germ cell–specific transcription [44, 45]. By elucidating the role of DNA methylation in gene regulation of pluripotent cells, we may uncover common gene regulatory pathways underlying the transition between pluripotent stem/germ cells and somatic cells.
Acknowledgments The authors thank Drs. Thomas Yang, Paul Oh, Jorg Bungert, Keith Robertson, and Michael Rutenberg for helpful discussions and critical reading of the manuscript. This work was supported in part by National Institutes of Health grants DK59699 and RR17001 (to N.T.).
Disclosures N.T. owns stock in RegenMed, Inc.
of Nanog, a pluripotency sustaining factor in embryonic stem cells. Cell 2003;113:643–655. 15 Mitsui K, Tokuzawa Y, Itoh H et al. The homeoprotein Nanog is required for maintenance of pluripotency in mouse epiblast and ESCs. Cell 2003;113:631–642. 16 Niwa H, Miyazaki J, Smith AG. Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ESCs. Nat Genet 2000;24:372–376. 17 Okano M, Xie S, Li E. Cloning and characterization of a family of novel mammalian DNA (cytosine-5) methyltransferases. Nat Genet 1998;19:219–220. 18 Lee JH, Hart SRL, Skalnik DG. Histone deacetylase activity is required for embryonic stem cell differentiation. Genesis 2004;38:32–38. 19 Huntriss J, Hinkins M, Oliver B et al. Expression of mRNAs for DNA methyltransferases and methyl-CpG-binding proteins in the human female germ line, preimplantation embryos, and embryonic stem cells. Mol Reprod Dev 2004;67:323–336. 20 Kremenskoy M, Kremenska Y, Ohgane J et al. Genome-wide analysis of DNA methylation status of CpG islands in embryoid bodies, teratomas, and fetuses. Biochem Biophys Res Commun 2003;311:884–890. 21 Shiota K, Kogo Y, Ohgane J et al. Epigenetic marks by DNA methylation specific to stem, germ and somatic cells in mice. Genes Cells 2002;7:961– 969. 22 Chen T, Ueda Y, Dodge JE et al. Establishment and maintenance of genomic methylation patterns in mouse embryonic stem cells by Dnmt3a and Dnmt3b. Mol Cell Biol 2003;23:5594–5605. 23 Hamazaki T, Iiboshi Y, Oka M et al. Hepatic maturation in differentiating embryonic stem cells in vitro. FEBS Lett 2001;497:15–19. 24 Huang TH, Laux DE, Hamlin BC et al. Identification of DNA methylation markers for human breast carcinomas using the methylation-sensitive restriction fingerprinting technique. Cancer Res 1997;57:1030–1034. 25 Pesce M, De Felici M. Purification of mouse primordial germ cells by MiniMACS magnetic separation system. Dev Biol 1995;170:722–725. 26 Belzacq AS, Vieira HL, Kroemer G et al. The adenine nucleotide translocator in apoptosis. Biochimie 2002;84:167–176.
Rodić, Oka, Hamazaki et al. 27 Slim R, Levilliers J, Ludecke HJ et al. A human pseudoautosomal gene encodes the ANT3 ADP/ATP translocase and escapes X-inactivation. Genomics 1993;16:26–33. 28 Mozo T, Fischer K, Flugge UI et al. The N-terminal extension of the ADP/ ATP translocator is not involved in targeting to plant mitochondria in vivo. Plant J 1995;7:1015–1020. 29 Chen ST, Chang CD, Huebner K et al. A human ADP/ATP translocase gene has seven pseudogenes and localizes to chromosome X. Somat Cell Mol Genet 1990;16:143–149. 30 Xiong Z, Laird PW. COBRA: a sensitive and quantitative DNA methylation assay. Nucleic Acids Res 1997;25:2532–2534. 31 Okano M, Bell DW, Haber DA et al. DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development. Cell 1999;99:247–257.
1323 rides serum and feeder cell requirements for mouse embryonic stem cell self-renewal. Proc Natl Acad Sci U S A 2005;102:3312–3317. 37 Geijsen N, Horoschak M, Kim K et al. Derivation of embryonic germ cells and male gametes from embryonic stem cells. Nature 2004;427:148–154. 38 Zhang LP, Stroud JC, Walter CA et al. A gene-specific promoter in transgenic mice directs testis-specific demethylation prior to transcriptional activation In vivo. Biol Reprod 1998;59:284–292. 39 Iannello RC, Gould JA, Young JC et al. Methylation-dependent silencing of the testis-specific Pdha-2 basal promoter occurs through selective targeting of an activating transcription factor/cAMP-responsive elementbinding site. J Biol Chem 2000;275:19603–19608. 40 De Smet C, Lurquin C, Lethe B et al. DNA methylation is the primary silencing mechanism for a set of germ line- and tumor-specific genes with a CpG-rich promoter. Mol Cell Biol 1999;19:7327–7335.
32 Dolce V, Scarcia P, Iacopetta D et al. A fourth ADP/ATP carrier isoform in man: identification, bacterial expression, functional characterization and tissue distribution. FEBS Lett 2005;579:633–637.
41 Hisano M, Ohta H, Nishimune Y et al. Methylation of CpG dinucleotides in the open reading frame of a testicular germ cell-specific intronless gene, Tact1/Actl7b, represses its expression in somatic cells. Nucleic Acids Res 2003;31:4797–4804.
33 Brown RM, Dahl HH, Brown GK. Pyruvate dehydrogenase E1 alpha subunit genes in the mouse: mapping and comparison with human homologs. Somat Cell Mol Genet 1990;16:487–492.
42 Xu W, Cooper GM. Identification of a candidate c-mos repressor that restricts transcription of germ cell-specific genes. Mol Cell Biol 1995;15:5369–5375.
34 Narisawa S, Hecht NB, Goldberg E et al. Testis-specific cytochrome cnull mice produce functional sperm but undergo early testicular atrophy. Mol Cell Biol 2002;22:5554–5562.
43 Lin HB, Jurk M, Gulick T et al. Identification of COUP-TF as a transcriptional repressor of the c-mos proto-oncogene. J Biol Chem 1999;274:36796–36800.
35 Huttemann M, Jaradat S, Grossman LI. Cytochrome c oxidase of mammals contains a testes-specific isoform of subunit VIb–the counterpart to testes-specific cytochrome c? Mol Reprod Dev 2003;66:8–16.
44 Tchenio T, Casella JF, Heidmann T. Members of the SRY family regulate the human LINE retrotransposons. Nucleic Acids Res 2000;28:411–415.
36 Yamane T, Dylla SJ, Muijtjens M et al. Enforced Bcl-2 expression over
45 Clarkson MJ, Harley VR. Sex with two SOX on: SRY and SOX9 in testis development. Trends Endocrinol Metab 2002;13:106–111.
