DNA Replication and Repair

DNA Replication and Repair Objectives: I. Understand the Cell Cycle. A. What are the phases of the cell cycle? B. Describe what is occurring during the four phases of the cell cycle. C. Define the Restriction Point. D. Describe how the cell cycle is controlled. E. Define the terms 1. Cell-Division-Cycle Genes (cdc genes). 2. Cyclin-Dependent Protein Kinases (CDKs). a) What CDKs are present in mammalian cells? 3. Cyclins a) What cyclins are present in mammalian cells? F. Describe how the synthesis of the cyclins and the interaction between cyclin and CDK controls the cell cycle. II. Describe the overall process of DNA replication. A. Define the terms: 1. Semiconservative 2. Bidirectional a) Reading Direction versus Synthesis Direction. 3. Semidiscontinuous a) Okazaki Fragments B. Describe the functions of: 1. Origin of Replication 2. Initiation Factors 3. Single-Strand DNA Binding Protein 4. Helicase 5. Topoisomerase 6. Primase (DNA Directed RNA Polymerase) 7. DNA Polymerase (DNA Directed DNA Polymerase) III. Describe prokaryotic (E. coli) DNA replication in detail. A. Describe the Initiation Phase of Replication 1. Describe the DNA sequence at the Origin of Replication. 2. Describe the unwinding process; the opening of the replication forks. 3. Describe the functions of: a) DnaA b) HU c) DnaB (Helicase) d) DnaC e) PriA f) PriB g) PriC h) DnaG (Primase) i) DNA Directed DNA Polymerase III (DNA Polymerase III or Pol III) 1

©Kevin R. Siebenlist, 2017

IV.

(1) Describe the structure of Pol III and relate it to its function. (a) Polymerase activity (b) 3´→5´ Exonuclease Activity 4. Define the term Replisome B. Describe the Elongation Phase of Replication. 1. Describe the structure and function of DNA Directed DNA Polymerase I (DNA Polymerase I or Pol I) a) Polymerase activity b) 3´→5´ Exonuclease Activity c) 5´→3´ Exonuclease Activity 2. Describe the Function of DNA Ligase C. Describe the Termination Phase of Replication 1. Describe the Termination Region of the E. coli chromosome. 2. Describe the function of Tus Describe the differences and similarities between prokaryotic replication and eukaryotic replication. A. Initiation 1. Describe the functions of: a) Origin Recognition Complex b) Replicators c) Origin Recognition Complex (ORC) - {Orc1 - Orc6} d) Cdc 6 (1) Cell-division-cycle Protein 6 (2) Replication Activator Protein (RAP) e) Cdt1 - Replication Licensing Factor (RLF) f) MCM Complex (MiniChromosome Maintenance Proteins)- {Mcm2 - Mcm7} g) Pre-replicative Complex h) S-CDK complex i) Ddk (1) Ddk ⇒ DBf4-dependent-kinase (2) composed of Cdc7 and Dbf4 (3) Cdc7 is Cell-division-cycle Protein 7; it is a protein kinase j) Cdc45 k) Replication Factor A (RFA) {also known as Replication Protein A (RPA)} l) Replication Factor C (RFC) {also known as Replication Protein C (RPC)} m) Proliferating Cell Nuclear Antigen (PCNA) 2. Describe the functions of the eukaryotic DNA-Directed DNA Polymerases a) DNA-Directed DNA Polymerases α b) DNA-Directed DNA Polymerases β c) DNA-Directed DNA Polymerases γ d) DNA-Directed DNA Polymerases δ e) DNA-Directed DNA Polymerases ε B. Elongation 1. Describe the functions of: a) RNase H1 2


V.

b) Flap Endonuclease-1 (FEN1) c) Histone duplication C. Termination 1. Describe the functions of: a) Telomeres b) Telomerase - RNA-Directed DNA Polymerase (Reverse Transcriptase) DNA Damage and Repair A. Differentiate between DNA damage and a DNA mutation. B. Describe the molecular basis for the introduction of errors into genetic material. 1. During Replication 2. Deamination 3. Incorporation of Base Analogs 4. Base Alkylations 5. Intercalating Agents 6. Radiation C. Repair Mechanisms 1. Direct Repair 2. Base-Excision Repair 3. Nucleotide-Excision Repair 4. Mismatch Repair 5. Error-Prone Repair or SOS Response

uuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu The Cell Cycle Cell division in eukaryotes occurs in four well defined stages. Mitosis, cell division or cell doubling, occurs during the M phase. After mitosis the cell enters the G1 phase where proteins and precursors for the next cycle are synthesized. Alternatively, the cell, if terminally differentiated, leaves the M phase and enters the GØ (gee zero) phase and ceases to divide. During the S phase new DNA is synthesized; DNA Replication occurs. The cell synthesizes new proteins and organelles and approximately doubles in size during the G2 phase in preparation for entering the M phase. One of the most dramatic examples of regulation by protein phosphorylation is the control of the eukaryotic cell cycle. The process is controlled by CELL-DIVISION-CYCLE GENES (Cdc Genes), or better yet by the proteins coded for and synthesized from the Cdc Genes. One family of proteins coded for by the CELLDIVISION-CYCLE GENES are a group of protein kinases known as CYCLIN-DEPENDENT PROTEIN KINASES (CDK). Animal cells contain at least 8 CDK’s, CDK1 through CDK8. The activity of these individual kinases rises and falls as the cell progresses through the cycle. The oscillations in activity lead to cyclical changes in the phosphorylation of intracellular proteins that initiate or regulate the major events of the cell cycle. Cyclical changes in CDK activity are controlled by a complex array of enzymes and other proteins. One of the CDK regulators are proteins known as CYCLINS. There are at least 10 different cyclins, designated A, B, C,…, J. CYCLIN-DEPENDENT PROTEIN KINASES, as the name implies, are dependent on CYCLINS for their activity. Hence, the active protein kinases controlling the cell cycle are heterodimers composed of a regulatory subunit, a CYCLIN, and a catalytic subunit, a CYCLIN-DEPENDENT PROTEIN 3


KINASE. Cyclins were originally named, as such, because they undergo a cycle of synthesis and degradation in each cell cycle. Cellular CDK levels, by contrast, are relatively constant through out the cell cycle.

$ ( %$$ "%!

$ %!$$

$ #!% ( %$$

*)#!$ # (# %% $'%#'#! (

$ #!% ( %$$

$%#%! ! % !& %"$%%$!%$ %!"$ %!$$

Some of the best characterized cyclin-CDK complexes involved in the cell-cycle and the roles they play are listed below:

Complex

Cyclin

Cyclin-Dependent Function Protein Kinase

G1-CDK Complex

Cyclin D

CDK4 or CDK6

promotes passage through restriction point in late G1

G1/S-CDK Complex

Cyclin E

CDK2

commits the cell to DNA replication at the end of G1

S-CDK Complex

Cyclin A

CDK2

required for the initiation of DNA replication

M-CDK Complex

Cyclin B

CDK1

promotes the events of mitosis

4


CH2

CH2

OH

OH

160

15

15

160

+

Cyclin

Cyclin

In addition to the cyclic change in cyclin concentration (synthesis/degradation), the cyclin-dependent protein kinases are controlled by phosphorylation / dephosphorylation and by the interaction with specific protein inhibitors. Phosphorylation of Tyr15 on the cyclin-dependent protein kinases inhibits the activity of the kinase in the presence or absence of a cyclin. The removal of this phosphate partially activates the cyclin-dependent protein kinases in the presence of a cyclin, whereas phosphorylation of Tyr160 completely activates the cyclin-dependent protein kinases in the presence of the cyclin. There are numerous proteins in the cell that specifically inhibit one or more of the cyclin•cyclin-dependent protein kinase complexes. Many of these inhibitors are “check point” proteins. They detect whether the cell that is about to divide is in contact with other cells (contact inhibition), whether the genome is damaged or intact, whether replication is complete, and a variety of other things and they either inhibit the cyclin•cyclin-dependent protein kinase complexes absolutely (e.g., contact inhibition causes entry into GØ) or until all of the processes of the current phase of the cell cycle are complete. The inhibitors themselves, are inhibited or destroyed when everything is ready to proceed, with the inhibitors gone the cyclin•cyclin-dependent protein kinase complexes can phosphorylate their substrates and the cell cycle continues.

CH2

CH2

OH

OH

CH2

O P

160

15

O

Cyclin

160

Cyclin

Accessory Proteins

15

CH2

CH2

OH

OH

CH2

O O

O

P

O

O

O

5


Cyclins and/or cyclin-dependent protein kinases that cannot perform their function correctly because of some genetic abnormality are a second group of kinases that fall into the category of ONCOGENES. When abnormal they may not control the cell cycle properly and cell growth becomes out of control (cancer). The inhibitors of the cyclin / cyclin-dependent protein kinase complexes are often called TUMOR SUPPRESSORS or ANTI-ONCOGENES because under normal conditions they control the actions of the cyclin•cyclindependent protein kinase complexes. Replication - Overview According to Watson & Crick “The structure of DNA immediately suggests a method for DNA Replication”. Since the two strands of double helical DNA are complementary, the nucleotide sequence of one strand of DNA can act as a template for the synthesis of its complementary strand. In this way DNA replication produces two daughter DNA duplexes, each containing one parental strand and one newly synthesized daughter strand. This mode of replication is termed SEMICONSERVATIVE REPLICATION.

C G T A

DNA replication can be divided into three stages: Initiation, Elongation, and Termination. In Bacteria Replication Initiation occurs at the ORIGIN of REPLICATION (OriC). This is a specific sequence of bases that signals the starting point for replication. During initiation specific proteins interact with the DNA double helix at the major and/or minor groove and move along the DNA reading the sequence until the Origin of Replication is recognized. These factors bind to the origin and initiate the process of replication by unwinding a region of the DNA double helix.

Replication Fork

The proteins that identify and bind to the Origin of Replication are called INITIATION FACTORS and DNA 6


unwinding produces two REPLICATION FORKS. Once the initiation factors begin the unwinding of the DNA double helix a group of enzymes called Helicases enter the replication fork. DNA unwinding by the Helicases is an ATP driven event, they hydrolyze ATP to drive the unwinding of the double helix. As the DNA is unwound, proteins bind to the individual single strands of DNA preventing them from reforming the duplex molecule, from forming “hairpin” structures, or from degradation by cellular nucleases. These proteins are Single-Strand DNA Binding Proteins. Unwinding the DNA double helix introduces torsional stress into the molecule that is relieved by the Topoisomerases. DNA Polymerases are the enzymes that catalyze the formation of 3´→5´ phosphodiester bonds between the DNA molecule and deoxyribonucleoside triphosphates. The DNA Polymerases cannot synthesize DNA de novo. The specificity of these enzymes is such that they can only add deoxyribonucleotides to the 3´ hydroxyl end of an existing nucleic acid, to the 3´ end of an existing strand of DNA or RNA. Once a certain length of the duplex DNA has been unwound at the Origin of Replication, a DNA-Directed RNA Polymerase or Primase binds to the replication fork and synthesizes a short sequence, 5 to 15 bases, of RNA. This short piece of RNA serves as a primer and carries the free 3´ hydroxyl group required by the DNA Polymerase. After the Primase has synthesized the RNA primer the DNA-Directed DNA Polymerase binds at the replication fork. The binding of Primase, the synthesis of the RNA primer, and the binding of DNA Polymerase signals the end of the initiation phase of replication. During the Elongation Phase of Replication the daughter DNA strand is synthesized. Deoxyribonucleoside triphosphates diffuse into the replication fork and find their complementary partner (A=T, G≡C). When DNA Polymerase is certain that the correct base is in place it catalyzes the formation of the phosphodiester bond. The release of pyrophosphate (P2O7–4) from the deoxynucleoside triphosphate and the subsequent hydrolysis of P2O7–4 into two PO4–3 by Inorganic Pyrophosphatase drives the polymerization reaction to completion. The incoming nucleotides bind to the unwound DNA strand by hydrogen bonding to their complementary partners and by “stacking” with the bases of the nascent daughter strand. Elongation occurs in both directions leading away from the Origin of Replication. DNA replication is BIDIRECTIONAL. The parent strand of DNA is read in the 3´→5´ direction and the new daughter stand is synthesized in the 5´→3´ direction. Since the two template strands of DNA are antiparallel and since DNA is synthesized in the 5´→3´ direction, synthesis of the two new strands proceeds in opposite directions. DNA replication is a SEMIDISCONTINUOUS process. The LEADING STRAND is synthesized as one continuous piece of DNA starting at the Origin of Replication and proceeding away from the origin toward the end of the DNA molecule or toward the termination signal. The Leading Strand is synthesized in the same direction as replication fork movement. The LAGGING STRAND is synthesized discontinuously as short pieces that are subsequently joined to form one long DNA molecule. The LAGGING STRAND is synthesized in the direction opposite to replication fork movement, toward the origin of replication. After a certain number of bases (~1000 bases in E coli, ~50 to 200 bases in eukaryotes) have been unwound the Primase synthesizes an RNA primer on the LAGGING STRAND. DNA Polymerase adds deoxyribonucleotides to this primer in the direction back toward the Origin of Replication, but still in the 5´ → 3´ direction. DNA polymerase incorporates nucleotides into these short pieces until it encounters the RNA primer from a previous piece, at this point the DNA polymerase dissociates from the DNA. The RNA primer is removed and a DNA Polymerase fills the gap with DNA. This process leaves a “nick”, a gap of one phosphodiester 7


bond, between the two pieces of DNA. The “nick” is sealed, the two pieces are joined into one, by the enzyme DNA Ligase. The short pieces of DNA synthesized on the Lagging Strand are called OKAZAKI FRAGMENTS after the biochemist who worked out the details of Lagging Strand synthesis. Leading Strand

Lagging Strand

5´

5´

5´ 3´

3´ 5´

5´

5´

Lagging Strand

Leading Strand

Leading Strand

Lagging Strand

5´

5´

5´ 3´

3´ 5´

5´

5´

Lagging Strand

Leading Strand

Three additional points need to be made regarding the elongation process. First, it is very rapid. Bacterial DNA polymerases can incorporate over 1000 nucleotides per second. At this rate, in the absence of the Topoisomerases (swivelase and gyrase), the ends of a linear piece of DNA would have to rotate at 6000 revolutions per minute to relieve the torsional stress. Eukaryotic DNA polymerases are not as fast as bacterial. They incorporate from 200 to 700 nucleotides per second. Second, the DNA polymerases are very good at incorporating the correct nucleotide into the growing DNA strand. These enzymes incorporate in incorrect base about once every 105 polymerization steps; an error rate of 1/105. The fidelity is improved by a PROOF READING ACTIVITY present on the DNA Polymerases. This proof reading activity is a 3´→5´ Exonuclease activity present on most of the DNA Polymerases. After the polymerase has incorporated a nucleotide into the growing DNA strand it advances to the next base. This movement brings the 3´→5´ Exonuclease site over the base just incorporated. If this base is incorrect the exonuclease activity removes it and the DNA polymerase backs up and tries again. The exonuclease “proof reading” activity improves the fidelity of replication about 100 fold. The overall error rate during replication is about 1/107. After replication is complete, Repair Mechanisms check the new daughter strands of DNA and corrects any mistakes that the polymerases may have missed. Adding the repair mechanisms improves the overall fidelity of replication to 1 error for every 109 bases incorporated. Third - Why is the RNA primer necessary? Why can’t replication start with two deoxynucleotides joined by DNA Polymerase at the Origin of Replication? The answer to this question lies in the strength of hydrogen bonds. Hydrogen bonds are not very strong and they have a life-time of about 10 picoseconds, so the 8


binding of the first few nucleotides to the DNA template is weak and with so few nucleotides bound to the DNA template the “stacking” interaction does little to strengthen the association. This weak binding would translate into numerous errors at or around the Origin of Replication. With the proof reading function of the DNA polymerases, it would be difficult, it would take a long time for the DNA polymerase to replicate and leave the Origin of Replication. The Primase enzyme does not have a proof reading activity and errors made within the RNA primer do not matter since the primer is removed and destroyed. The presence of the RNA primer strengthens the binding of the first deoxyribonucleotides to the DNA template strand in two ways. Hydrogen bond strength is additive; the presence of the RNA primer strengthens the interaction between the first few deoxynucleotides and the DNA template. The binding to the template is also strengthened by the “stacking” interaction between the RNA primer and the incoming deoxyribonucleotides. The combination of numerous hydrogen bonds and “base stacking” assures that the first deoxynucleotides incorporated into the daughter DNA strand are the correct ones. Signals for TERMINATION depends upon the organism. Most bacteria have circular chromosomes. In this case there is a specific DNA region involved in termination. Eukaryotes have linear chromosomes. In eukaryotes the DNA polymerase and the replication apparatus just runs off the end of the DNA molecule. Running off of the end is okay for the leading DNA strand but it can result in problems for the lagging strand, as detailed below. Replication in Prokaryotes (E. coli) - The Details

In E. coli the ORIGIN of REPLICATION (ORIC) is a region 245 base pairs in length. Within ORIC there are 9 ©Kevin R. Siebenlist, 2017

three 13 base pair regions that are A/T rich - GATCTNTTNTTTT. These 13 base regions are called the DNA UNWINDING ELEMENT (DUE). Following these A/T rich regions there are five stretches (R1 – R5) containing the repeating sequence TT(T/A)TNCACA. The formation of the replication fork begins when five DnaA proteins bind ATP and then bind to the R1 – R5 sequences. Additional DnaA-ATP complexes bind to the I sequences (I1 - I3) and to the DnaA-ATP complexes already bound. The protein FIS binds to its site within the Origin of Replication as does the IHF protein. One additional protein, HU, is necessary for DnaA binding. The binding interactions between the DnaA molecules, the accessory proteins (FIS, IHF, & HU), and the DNA double helix, wrap the DNA duplex into a structure resembling a nucleosome. The torsional stress introduced into the DNA by this winding is not relieved by the Topoisomerases, rather it is used, along with the hydrolysis of the bound ATP, to unwind the DUE regions of the Origin of Replication. Unwinding of the DUE regions form the Replication Forks. DnaC bind ATP. A complex of 6 DnaB subunits interacts with 6 DnaC-ATP subunits and this complex enters the open replication fork. The DnaB subunits remain in the replication fork, the DnaC subunits leave. The six DnaB subunits form the Helicase enzyme. The DnaC hexamer functions to deliver the Helicase (DnaB) to the replication fork. DnaC acts as a “chaperone” to open and wrap the DnaB hexamer around one of the single strands of DNA. Hydrolysis of ATP bound to the DnaC subunits dissociate the DnaC from DnaB and lock the Helicase in place. Helicase (DnaB) along with Topoisomerase II unwind a larger region of the DNA double helix. Energy supplied by the hydrolysis of ATP is required for the unwinding process.

10


As the DNA is unwound Single-Strand DNA Binding Protein (SSB) binds tightly to the single stranded regions of DNA. SSB binding prevents reformation of the double helix, folding of the single stranded DNA into “hairpin” structures, or hydrolysis of the single strands by nucleases. SSB is a tetramer of identical subunits. It binds to a region of about 32 nucleotides in a cooperative manner. Binding the first SSB makes binding of subsequent SSB tetramers easier. Additional INITIATION FACTORS, PriA, PriB, and PriC, bind to the Helicase (DnaB). These additional proteins aid in the assembly of the PRIMOSOME. After these proteins bind to the replication fork the DNA Directed RNA Polymerase, the Primase enzyme (DnaG) binds. Binding of the Primase enzyme complex completes the assembly of the Primosome. PriB and PriC dissociate from the replication fork. The Primosome functions to unwind the parental DNA and synthesize the RNA primers. One RNA primer is synthesized on each of the Leading Strands. In bacteria one RNA primer is synthesized on the Lagging Strand about every 1000 bases.

E. coli contains at least five DNA-Directed DNA Polymerase enzymes; DNA Polymerase I, DNA Polymerase II, DNA Polymerase III, DNA Polymerase IV, and DNA Polymerase V. DNA Polymerase II, DNA Polymerase IV, and DNA Polymerase V function primarily in DNA REPAIR. DNA Polymerase III is the enzyme responsible for the synthesis of both the Leading and Lagging strands of 11


DNA. This enzyme is a large multisubunit complex. It contains 10 different subunits and has a molecular weight of about 940,000. The enzyme is composed of: Subunit

Activity

2 α (alpha)

polymerase activity

2 ε (epsilon)

3´→5´ exonuclease, the proof reading activity

2 θ (theta)

function not precisely known, may be involved in α, ε assembly, a scaffold protein

4 β (beta)

forms sliding clamp holding enzyme to DNA

2 τ (tau)

assembly of holoenzyme on DNA

2 γ (gamma)

part of the gamma complex, see note 3

1 δ (delta)

part of the gamma complex

1 δ´ (delta prime)


1 χ (chi)


1 ψ (psi)


Notes: 1. The HOLOENZYME with full enzyme activity is formed when all 18 subunits are assembled. 2. One alpha (α), one epsilon (ε), and one theta (θ) subunit forms the CORE ENZYME, the basic functional unit. There are two Core Enzymes in the Holoenzyme. 3. The gamma complex is responsible for assembling and disassembling the β subunits, the sliding clamp, on DNA. The γ complex is referred to as the clamp loader. 4. DNA Polymerase III Holoenzyme synthesizes both the leading and lagging strand of DNA simultaneously. When DNA-Directed DNA Polymerase III (Polymerase III or Pol III) binds to the Primosome the initiation phase is completed and elongation begins. Pol III remains bound until replication is completed. After the DNA Polymerase III has bound to the replication fork, this large protein complex (Helicase, Accessory Proteins, Primase, and DNA Polymerase III) is called the REPLISOME. DNA unwinding in the fully functional replisome is performed by three enzymes operating together; the DnaB Hexamer, the Rep Protein, and Helicase II. DNA Polymerase III replicates the Leading strand in one continuous piece. On the lagging strand, the DNA is synthesized as Okazaki fragments. When DNA Polymerase III encounters an RNA primer of a previously completed Okazaki fragment the clamp loading complex, γ2δδ´χψ, releases the clamp (β2) from the lagging strand and reassembles it at the beginning of the next Okazaki fragment.

12


The RNA primers on the Lagging Strand are removed and the gaps are filled in by DNA-Directed DNA Polymerase I (Polymerase I or Pol I). This enzyme contains a DNA Polymerase activity, a 3´ → 5´ Exonuclease activity for proof reading, and a 5´ → 3´ Exonuclease activity specific for RNA primer removal. DNA Polymerase I binds to the nick between the 3´ end of an Okazaki fragment and the 5´ end of the previous RNA primer. The 5´ → 3´ Exonuclease activity removes nucleotides from the RNA primer one nucleotide at a time and simultaneously adds deoxyribonucleotides to the 3´ end of the upstream Okazaki Fragment. After removing the RNA primer, DNA Polymerase I dissociates from the replisome, leaving a “nick”, a gap of one phosphodiester bond, between the two DNA strands. DNA Ligase binds to the nick and seals it. DNA Ligase requires energy to close the nick. At the nick there is a 3´ hydroxyl group on one side and a 5´ monophosphate on the other side. The 5´ triphosphate at the 5´ end of the gap was used when this deoxynucleotide was attached to the RNA primer. Most DNA Ligases use ATP as the energy source to seal the nick. E. coli DNA Ligase uses the energy stored in the phosphoanhydride bond of NAD. In E. coli the products of the DNA Ligase reaction are a sealed DNA strand, AMP, and Nicotinamide Mononucleotide.

13


DNA Polymerase I 5´

3´

5´

RNA Primer

Leading Strand

Lagging Strand

5´→3´ Exonuclease Activity (Primer Removal)

Polymerase Activity

3´→5´ Exonuclease Activity (Proofreading)

TERMINATION in E. coli occurs within the TER region of the circular chromosome. This region is opposite from the Origin of Replication. The TER region prevents the replication forks from passing through each other. Within the TER region there are six DNA sequences, known as TerA, TerB, TerC, TerD, TerF, and TerG. The Ter sequences are organized into two sets inversely oriented with respect to one another.

TUS on TerG

Counterclockwise Trap

5´

3´

To Ori

TUS on TUS on TUS on TerF TerB TerC

Leading Strand (Counterclockwise)

Leading Strand (Clockwise)

Clockwise Trap

3´

5´

TUS on TUS on TUS on TerA TerD TerB

A protein called Terminator Utilization Substance (TUS) binds tightly to the Ter regions of the chromosome. When bound to DNA, TUS blocks the passage of the replication forks by preventing Helicase mediated unwinding of DNA. Only one TUS-TER complex is needed to terminate replication so redundancy is built into the system. The TUS protein bound to the TER Regions assures that the two replisomes collide and that all of the DNA is replicated. After the collision the large protein complexes of the replisome dissociate. At the completion of Replication in bacteria the two daughter chromosomes are catenanes, i.e., linked circles. The two chromosomes are not linked to each other, rather they are like links on a chain. In E. coli the daughter chromosomes are separated by the action of DNA Topoisomerase IV. This enzyme breaks both strands of one of the chromosomes, allows the intact chromosome to pass through the break, and then reseals the nicks.

14


Replication of Eukaryotic DNA The biochemical mechanisms of DNA replication in eukaryotic cells are fundamentally similar. The differences arise from the greater size of eukaryotic DNA and its packaging into chromatin. In eukaryotes the Origin of Replication is called AUTONOMOUSLY REPLICATING SEQUENCES (ARS) or REPLICATORS. Replicators are highly conserved regions of about 150 base pairs. Eukaryotic chromosomes have multiple AUTONOMOUSLY REPLICATING SEQUENCES. There appears to be one REPLICATOR on each of the major loops of chromatin. Multiple Replicators assures that the DNA is replicated in a timely fashion. During initiation the Replicators are recognized by a multisubunit protein complex, the Origin Recognition Complex (ORC). Assembly of the ORC and its binding to the replicators is controlled by proteins involved in the regulation of the cell cycle. Eukaryotic replication also requires a larger number of accessory proteins. In eukaryotes a protein called Replication Factor A (RFA) serves the same function as single-strand binding protein in bacteria. The eukaryotic cell contains multiple different Helicases which function specifically with the different DNA polymerases. There are several different DNA Ligases. All of them function to seal nicks in DNA. Some of the DNA Ligases are specific for the replication process while others function during DNA repair. OKAZAKI FRAGMENTS formed during eukaryotic replication are much shorter that those formed in bacteria. The eukaryotic Primase enzyme inserts a RNA primer every 50 to 200 bases along the Lagging Strand. Eukaryotic cells contain at least fifteen different DNA-Directed DNA Polymerases. Five of them have been well characterized. DNA-Directed DNA Polymerase α (alpha) DNA-Directed DNA Polymerase β (beta) DNA-Directed DNA Polymerase γ (gamma) DNA-Directed DNA Polymerase δ (delta) DNA-Directed DNA Polymerase ε (epsilon) DNA Polymerase δ is the DNA polymerase in eukaryotic cells that does the majority of replication. It catalyzes the synthesis of the Leading Strand as well as some / most of the Lagging Strands. Eukaryotic DNA Polymerase δ is similar in structure to E coli DNA Polymerase III. DNA Polymerase δ consists of a Catalytic Core that is bound to Replication Factor C (RFC) and bound to Proliferating Cell Nuclear Antigen (PCNA). When all three subunits are assembled the resulting holoenzyme catalyzes DNA synthesis at a high rate. PCNA is the eukaryotic counterpart of the bacterial Pol III β2 sliding clamp, it clamps DNA Polymerase δ to the DNA. Like β2, PCNA encircles the DNA, but, in contrast to the bacterial β2 sliding clamp, the eukaryotic clamp contains three PCNA subunits. Replication Factor C (RFC) is the eukaryotic clamp loading complex. DNA Polymerase ε also plays an important role in DNA replication. All of the details of the role it plays in replication have yet to be worked out, it will substitute for DNA Polymerase δ during the synthesis of the Lagging Strand and it may fill the gaps between Okazaki fragments following RNA primer removal. 15


In eukaryotes, two DNA polymerases (δ & ε) are used for the synthesis of DNA at the replication fork, whereas in E. coli DNA polymerase III synthesizes both strands simultaneously. DNA Polymerase α is tightly associated with the Primase enzyme. It synthesizes the RNA primers (7 to 10 bases) followed by a short length (~15 bases) of DNA attached to the primer. DNA Polymerase α does not contain a 3´→5´ Exonuclease proof reading activity. Hence, the DNA sequence it inserts may contain errors because it is not proof read by the polymerase (see FEN1 below). DNA Polymerase β is used for DNA Repair. DNA Polymerase γ is used for replication of mitochondrial DNA. Plants have a DNA Polymerase specific for the DNA in chloroplasts. None of the eukaryotic DNA polymerases contain a 5´→3´ Exonuclease activity necessary for RNA primer removal. Primer removal is catalyzed by two other proteins. RNase H1 removes all but one of the ribonucleotides of the RNA primer, then Flap Endonuclease-1 (FEN1/RTH1) removes the one remaining ribonucleotide and any mismatched deoxyribonucleotides that were incorporated by DNA Polymerase α. FEN1 provides the proofreading function for DNA Polymerase α. It contains an endonuclease activity that removes mismatched oligonucleotides up to 15 nucleotides from the 5´ end of a DNA strand. DNA Polymerase δ or DNA Polymerase ε then fills the gap with DNA and a DNA Ligase joins the fragments. A Model for Initiation of Eukaryotic DNA Replication A PRE-REPLICATIVE COMPLEX (pre-RC) is assembled at each REPLICATOR during the G1 phase of the cell cycle. The Origin Recognition Complex (ORC), a hexamer of ORC1 through ORC6, binds to the replicator. ORC1 through ORC6 are the functional analogs of DnaA in E. coli. CDC6 {CELL-DIVISIONCYCLE PROTEIN 6; Replication Activator Protein (RAP)} and CDT1 {Replication Licensing Factor (RLF)} then bind to the ORC. CDC6 and CDT1 then load the MCM Complex (MiniChromosome Maintenance Proteins), a hexamer of related proteins (Mcm2 through Mcm7) onto the DNA. The MCM Complex is a ring shaped ATP-driven Helicase analogous the DnaB in E. coli. CDC6 & CDT1 are analogous to DnaC in E. coli. Loading of the MCM Complex completes the formation of the PRE-REPLICATIVE COMPLEX. S-Phase is entered, replication begins when the S-Cdk Complex forms and the resulting active protein kinase phosphorylates CDC6. CDC6 dissociates from the pre-replicative complex. Then either the S-Cdk Complex and/or other associated protein kinases phosphorylates the ORC, the MCM Complex, and other proteins within PRE-REPLICATIVE COMPLEX. Phosphorylation of the MCM Complex converts it into an active Helicase. The S-Cdk Complex also recruits CDC45. CDC45 plays a role in the addition of DNA Polymerase α / Primase complex, DNA Polymerase ε, and several accessory proteins including PCNA, RFA and RFC to the pre-RC converting it to an active replication complex. Leading strand synthesis is initiated by DNA Polymerase α. It synthesizes the RNA primer followed by a short deoxynucleotide oligomer. RFC then mediates polymerase switching, i.e., dissociation of DNA Polymerase α, assembly of PCNA sliding clamp, and addition of DNA Polymerase δ. DNA Helicase unwinds the helix at the replication fork and RFA binds the single stranded DNA. On the lagging strand DNA Polymerase α initiates synthesis through formation of an RNA primer followed by a short 16


deoxynucleotide oligomer. The RFC loads PCNA and either DNA Polymerase δ or DNA Polymerase ε and the synthesis of the Okazaki fragment continues. Replicator

Cdt1

Cdc6

Cdc45

Cdt1

P

P

P

P

P

P

Cdc6

P

P

Cdc45

P P P

RFA

P

P

P

Cdc45

P

P P

P

Pol α

RFA RFA RFA

P P

Cdc45

Pol α

P

P P

P

P

Pol α

Cdc45

RFA RFA RFA

P P

P

RFC

Pol δ PCNA

Pol α

Pol δ

P

RFC

RFA RFA RFA RFA RFA RFA RFA RFA RFA

P P P

P

Pol δ

Cdc45

RFA RFA RFA RFA RFA RFA RFA RFA RFA

RFC

P P

P P

P

RFC

17


Pol

P

RFC

RFA RFA RFA RFA

Pol

Pol

P

P

Pol

P

P P

P

RFA RFA RFA RFA

RFC

Pol

P P

P

RFC

Pol Pol

PCNA

Pol RFC

Pol

P

RFC

RFA RFA

Pol

P

P

Pol

P

P P

P

RFA RFA

RFC

Pol

P P

RFC

P

RNase H1

Pol

P

RFC

RFA

Pol

RFC

P

P

P P

Pol

P

P

RFA

RFC

Pol

P P

RFC

P

FEN1/RTH1

RFC

RFC

Pol

P

Pol

P

Pol

RFC

P

P

Pol RFC

P

Pol RFC

RFC

P P

P P

P P

RFC

RFC

DNA Ligase

P

P P

P

Pol

P

Pol

P

Pol

P P

RFC

P

When the DNA polymerase approaches the RNA primer of the downstream Okazaki fragment, RNase H1 degrades this RNA by removing all but one of the ribonucleotide and Flap Endonuclease-1 (FEN1/RTH1) removes the one remaining ribonucleotide and any mismatched DNA incorporated by DNA Polymerase α during initiation of this Okazaki fragment. DNA Polymerase δ or DNA Polymerase ε fills the gap, and DNA Ligase joins the two Okazaki fragments. 18


When eukaryotic DNA is replicated, it has to be unwound from the Histones, the nucleosomes have to dissociate. Synthesis of new histones is coordinated with replication so that as replication proceeds nucleosomes can form on both daughter strands. HISTONE DUPLICATION coordinates histone synthesis with replication. The most recent data suggests that the core histone present on the parent DNA strand splits into (H3/H4)2 tetramers and (H2A/H2B)2 tetramers. These tetramers combine with new histone subunits to form the octamer, and these hybrid molecules (half old and half new - semiconservative) are inserted randomly into each double helical DNA strand. Correlation (Equivalency) Table for Replication Bacteria

Eukaryotes

DnaA

ORC1 - ORC6

Recognizes and binds to the Origin of Replication or the Replicator Sequence.

DnaB

MCM Complex

Helicase Activity

DnaC & DnaT

Cdc6 & Cdt1

SSB

Replication Factor A RFA

Single Strand Binding Protein

Primase

DNA Polymerase α

Synthesizes RNA primer

DNA Polymerase III α, ε, & θ subunits

DNA Polymerase δ DNA Polymerase ε

The polymerase and the 3´ → 5´ exonuclease (proofreading) activities

DNA Polymerase III β subunits

Proliferating Cell Nuclear Antigen (PCNA)

The sliding clamp that tethers the enzyme to the DNA

DNA Polymerase III δ, δ′, χ & ψ subunits

Replication Factor C (RFC)

DNA Polymerase I

RNase H1 FEN1/RTH1

5´ → 3´ exonuclease

Function

Loads the Helicase into the Initiation Complex

Clamp loading complex Removes the RNA primers

DNA Polymerase I α, ε, & θ subunits

DNA Polymerase ε

The polymerase and the 3´ → 5´ exonuclease (proofreading) activities

DNA Polymerase I β subunits

Proliferating Cell Nuclear Antigen (PCNA)

The sliding clamp that tethers the enzyme to the DNA

DNA Polymerase I δ, δ′, χ & ψ subunits

Replication Factor C (RFC)

DNA Ligase

DNA Ligase

19

Clamp loading complex Seals “nicks” between Okasaki fragments


Termination of Linear Chromosome Replication Termination of the Leading Strand occurs when the replication apparatus falls off the end of the linear chromosome; when the replication fork runs out of DNA to replicate. However, when the replisome falls off of the Lagging Strand some of the chromosome may not have been replicated. The length of unreplicated single stranded DNA on the Lagging Strand depends on the location of the last Okazaki fragment. DNA Polymerase α primase activity might not recognize this piece of single stranded DNA as needing a primer because it is too short (< 50 bases) or it was primed correctly and the subsequent removal of the primer left an unreplicated segment of DNA. These unreplicated regions are called PRIMER GAPS. If this small piece of DNA on the Lagging Strand is not replicated, cellular exonucleases specific for single stranded DNA will hydrolyze them, resulting in chromosome shortening. Chromosome shortening is not necessarily a good thing so there must be a mechanism to prevent this. The last 1000 to 12000 base pairs of eukaryotic chromosomes is a stretch of short repetitive sequences. The repeated sequence can be 4 to 8 bases in length. These terminal repeats are called TELOMERES. Human TELOMERES have a consensus sequence of TTAGGG. Progressive chromosome shortening is prevented by the enzyme Telomerase. This enzyme contains a tightly bound RNA molecule containing a sequence complementary to the Telomere repeats. The human Telomerase contains a piece of RNA 450 nucleotides long. Near the center of this piece of RNA is the sequence CUAACCCUAAC. The enzyme activity of Telomerase is an RNA-Directed DNA Polymerase, a Reverse Transcriptase, (it uses an RNA template to synthesize DNA). Telomerase binds to the repeat sequences on the Telomere and the RNA-Directed DNA Polymerase (Reverse Transcriptase) activity of Telomerase uses the sequence on the RNA molecule as a template to add bases to the DNA of the chromosome. Telomerase catalyzes several cycles of DNA extension until the single stranded end of the lagging strand is about 50 to 60 bases long. At this point DNA Polymerase α binds to the 3´ end of the single stranded extension and finishes the replication of the end of the chromosome. Even with the action of Telomerase, there appears to be a gradual loss of DNA from the ends of eukaryotic chromosomes. This loss has been postulated to be part of the cell differentiation process; the sequence of events by which a cell goes from a pleuripotent stem cell to a fully differentiated mature cell. Chromosome shortening has also been postulated to be a cause of cell senescence and cell death. Telomerase is an inducible enzyme; the gene coding for its synthesis is “turned on” when the enzyme is needed and “turned off” when the enzyme is not needed. In stem cells the gene for Telomerase is induced / “turned on” and these cells can divide an infinite number of times with no significant chromosome shortening. When the cell begins the maturation process Telomerase is no longer induced and during each round of cell division leading from stem cell to mature cell there is a significant amount of chromosome shortening. When the cell is fully matured its chromosomes have undergone a considerable amount of shortening. Mature cells in culture can be induced to divide from 40 to 50 times before the cells begin to die. If Telomerase is induced by artificial means, cells in culture can be made to divide an infinite number of times and the culture can be made immortal. Telomerase has been shown to be induced in certain forms of cancer and this could account for the ability of these cells to divide an infinite number of times.

20


TEL 5´

Telomerase binds to the 3´ end of the singlestranded region, and the RNA template forms base pairs with the chromosomal DNA.

3´

CUAACCCUAAC AACCCTAACCCTAA…3´ ATTGGGATTGGGATTGGGATTGGGATT…5´

An additional repeat is added to the 3´ end of the DNA using the internal RNA as a template.

TEL 5´

3´

CUAACCCUAAC AACCCTAACCCTAA…3´ ATTGGGATTGGGATTGGGATTGGGATTGGGATT…5´

Telomerase shifts by six nucleotides and is positioned to synthesize another repeat.

TEL

5´

3´

CUAACCCUAAC AACCCTAACCCTAA…3´ ATTGGGATTGGGATTGGGATTGGGATTGGGATT…5´

21


DNA Repair DNA is the only cellular macromolecule that can be and is repaired in vivo. Since DNA contains all of the information necessary for cell differentiation, growth, and function, if it is damaged the entire organism may be placed in jeopardy. The information for the synthesis of some essential protein may become permanently altered. A distinction must be made between DNA DAMAGE and a DNA MUTATION. Damage takes a variety of forms: base modifications, nucleotide deletions, nucleotide insertions, cross-linking of the DNA strands, or breakage in the phosphodiester backbone. Damage is repaired. A Mutation is damage that has escaped repair. Mutations are permanent, unrepairable changes in the sequence of nucleotides. They are inheritable changes in the base sequence of DNA. Inheritable meaning that they are passed from cell to cell during mitosis. In multicellular organisms, mutations are passed from generation (parent) to generation (child) only if they arise in the germ cell line. Mutations, permanent base changes different from the majority population, can be subdivided into POLYMORPHISMS and TRUE MUTATIONS or CLINICAL MUTATIONS. POLYMORPHISMS are present in an individual or a small percentage of the population and are base changes in the nucleotide sequence of a particular gene that results in little or no deleterious change in the structure and function of the resulting protein. Several polymorphisms have been found that result in a more efficient protein. A TRUE MUTATION or CLINICAL MUTATION is likewise a base change in a particular gene present in an individual or a small percentage of the population that results in a significant deleterious change in the structure and function of the resulting protein. The change in the protein causes some significant clinical sign or symptom. When a mutation gives an organism a better chance at survival its EVOLUTION. Types of DNA Damage - The Causes of DNA Damage DNA is damaged: 1. During Replication. DNA polymerases are very accurate during the replication process. They have an error rate of about 1/107. The fidelity of replication is due to the specific interaction between bases and due to the proof reading 3´→5´ exonuclease activity of the polymerases. During replication two types of errors can occur; TRANSITIONS or TRANSVERSIONS. In a TRANSITION a purine is replaced by another purine or a pyrimidine is replaced by the other pyrimidine, e.g., an A is replaced by a G or a T by a C. In a TRANSVERSION a purine is replaced by a pyrimidine or a pyrimidine is replaced by a purine, e.g., A is replaced by a C or a G replaced by a T, etc. 2. By Deamination. The amino group on Adenine, Cytosine, and/or Guanine can be hydrolytically removed by a variety of means. Most often the hydrolytic removal of the amino group is a non enzymatic spontaneous process. When Cytosine is deaminated Uracil is produced. If this Uracil is not replaced or repaired the next round of replication will make the change permanent by incorporating an incorrect A rather than the correct G. Since Uracil is not a normal component of DNA it is easily identified in a DNA molecule and repaired. 3. By Radiation. Ionizing radiation primarily causes breaks in the phosphodiester bonds along the 22


backbone of DNA molecules. These breaks can be either single stranded or double stranded. Radiation is used as a treatment for cancer in the hope that the damage produced overwhelms the cell’s repair capability. Radiation can also cause base modification. UV radiation causes dimerization of adjacent Thymidine bases. Thymidine Dimers inhibit DNA replication. 4. By Base Alkylation. Alkylating agents are molecules that contain reactive methyl groups. Some alkylating agents are naturally occurring molecules, some are man made drugs, and some are innocuous chemicals that are converted to reactive molecules by normal or abnormal metabolism. Alkylating agents methylate N-7 of guanine and / or N-3 of adenine. These methylated bases cause base pair mismatches and / or they can disrupt the replication process. 5. By Intercalating Agents. Intercalating Agents are aromatic molecules with large planar ring structures that look like a base pair in DNA. These rings can span the DNA double helix by inserting themselves between the stacked bases. They do not interfere with normal base pairing. However, they interfere with base stacking and distort the DNA double helix. The presence of intercalating agents inhibit both replication and transcription. A replication fork or transcription bubble will pass over a region of DNA containing intercalating agents resulting in insertions or deletions. 6. By the Incorporation of Base Analogs into DNA During Replication. Base analogs are man made drugs / chemicals used to combat cancer and / or viral infections. These bases are absorbed from the gut, attached to PRPP by the purine salvage pathways or pyrimidine synthesis pathway, and then converted to the deoxytriphosphate forms. Base analogs include: 5-Bromouracil, 5-Fluorouracil, 5Azacytosine, 8-Azaguanine, 6-Thioguanine, 6-Mercaptopurine, 2-Aminopurine, and 2,6Diaminopurine. Once incorporated into DNA these analogs cause base pair mismatch during the next round of replication and / or they directly inhibit replication by preventing the formation of the replication fork. Repair Mechanisms 1. Direct Repair. Direct repair mechanisms repair damaged DNA without breaking the phosphodiester backbone of the DNA molecule. These mechanisms recognize damaged and mismatched bases. Thymidine Dimers are repaired by these mechanisms. Photolyase (also called Photoreactivating Enzyme) is a light activated enzyme. It binds to Thymidine Dimers, absorbs a photon of light, and uses this light energy to cleave the Thymidine Dimers. Alkylated bases are also repaired by direct repair mechanisms. Specific Methyltransferases recognize improperly and incorrectly methylated bases. The Methyltransferases transfer the methyl group from the base to themselves. The methyl transfer reaction inactivates the enzyme. Inactive methylated enzyme stimulates the synthesis of more active enzyme.

23


Oxidative demethylation of improperly alkylated bases is catalyzed by the AlkB protein. This enzyme is a member of the α-ketoglutarate-Fe2+–dependent dioxygenase family of enzymes. One atom from a molecules of O2 is utilized to oxidize α-ketoglutarate to succinate and the other atom is used to oxidize the methyl group to the alcohol. The dioxygenase then removes the methyl group by oxidation to formaldehyde. NH 2 N

N

N O

P

O

CH 2

NH 2 CH 3

N

O

O

O

P

O

CH 2

NH 2 OH

N

N

N

N

H2 C

N

N O

P

O

CH 2

O

O

O

P

O

O

P

O

P O

O

α-Ketoglutarate O2

1-Methyladenine

N

O

O

O O O

N

Adenine

O

Succinate CO2

C H

NH 2

NH 2 N

N O

P

O

CH 2

O

O

CH 3

O

N O

P

O

CH 2

O

OH

O

N

O

N O

P

O

CH 2

O

O

O

O

P

NH 2

Formaldehyde

N

O O

H2 C

H

O

O O

P O

3-Methylcytosine

O

P O

Cytosine

2. Base - Excision Repair. Base-excision repair is used primarily to repair regions of DNA with deaminated bases. The bases usually deaminated are cytosine and/or adenine. DNA Glycosylases cleave the N-glycosidic bond between the base and deoxyribose releasing the deaminated base. This cleavage forms an APURINIC or APYRIMIDINIC site in the DNA; an AP SITE. AP Endonucleases recognize these AP sites and cuts the DNA strand removing several bases around the AP site. DNA Polymerase I in bacteria or DNA Polymerase β in eukaryotes fills the gap and DNA Ligase seals the nick.

25


dNTPʼs

dNMPʼs + Deoxyribose Phosphate

26


4. Mismatch Repair. This repair mechanism recognizes base pair mismatches. This repair mechanism is most active immediately after replication. Mature (the parent) DNA is methylated at specific sites, newly replicated DNA is HEMIMETHYLATED, the parent strand is methylated whereas the new daughter strand is unmethylated. The Mismatch Repair mechanism scans the new DNA strand and when it finds base pair mismatches it cleaves the new strand between methylation sites. The single strand is covered with single strand binding proteins and the gap is filled in by DNA Polymerase III in E. coli or DNA Polymerase δ or ε in eukaryotes. Mismatch Repair mechanisms are in a race against the DNA Methylases (DAM Methylase) that function to methylate the newly synthesized DNA strand, once the daughter strands are methylated, Mismatch Repair cannot determine which strand contains the correct sequence.

CH3 | GATC CTAG | CH3


CH3 | GATC CTAG

CH3 | GATC CTAG



(E 6 Homologs) MutS

(E 5 Homologs) MutL

28


5. Error-Prone Repair or SOS Response This repair mechanism is found in all cells. Error-Prone Repair takes over when the replisome stalls at a site of DNA damage. When the replisome stalls, the synthesis of the set of proteins that mediates Error-Prone Repair is stimulated. The proteins of ErrorProne Repair assemble at the lesion site and form a MUTASOME, an error-prone replication apparatus. Error-Prone Repair inserts bases as best as possible to fill the gap caused by the damaged area. These inserted bases contain many errors. When replication is complete, the Mismatch Repair system corrects the errors, provided it reaches the site of damage before the DNA Methylases. In higher organisms the other chromosome of the pair is often used as a template to repair the areas initially filled in by the error-prone repair mechanisms.

29
