0963-6897/11 $90.00 + .00 DOI: 10.3727/096368910X536509 E-ISSN 1555-3892 www.cognizantcommunication.com
Cell Transplantation, Vol. 20, pp. 669–680, 2011 Printed in the USA. All rights reserved. Copyright 2011 Cognizant Comm. Corp.
Augmenting Therapy of Ovarian Cancer Efficacy by Secreting IL-21 Human Umbilical Cord Blood Stem Cells in Nude Mice Weihua Hu,*1 Jing Wang,†1 Jun Dou,*1 Xiangfeng He,* Fengshu Zhao,* Cuilian Jiang,* Fangliu Yu,* Kai Hu,* Lili Chu,‡ Xiaoli Li,* and Ning Gu§ *Department of Pathogenic Biology and Immunology, Medical School, Southeast University, Nanjing, China †Department of Gynecology & Obstetrics, Zhongda Hospital, Southeast University, Nanjing, China ‡Paediatric Research Institute, Nanjing Children’s Hospital, Nanjing, China §School of Biological Science & Medical Engineering, Southeast University, Nanjing, China
In the present study, CD34+ human umbilical cord blood stem cells (UCBSCs) were engineered to express interleukin-21 (IL-21) and then were transplanted into A2780 ovarian cancer xenograft-bearing Balb/c nude mice. The therapeutic efficacy of this procedure on ovarian cancer was evaluated. The findings from the study indicated that UCBSCs did not form gross or histological teratomas until up to 70 days postinjection. The CD34+ UCBSC-IL-21 therapy showed a consistent effect in the ovarian cancer of the treated mice, delaying the tumor appearance, reducing the tumor sizes, and extending life expectancy. The efficacy was attributable to keeping CD34+ UCBSC-IL-21 in the neoplastic tissues for more than 21 days. The secreted IL-21 not only increased the quantity of CD11a+ and CD56+ NK cells but also increased NK cell cytotoxicities to YAC-1 cells and A2780 cells, respectively. The efficacy was also associated with enhancing the levels of IFN-γ, IL-4, and TNF-α in the mice as well as the high expressions of the NKG2D and MIC A/B molecules in the tumor tissues. This study suggested that transferring CD34+ UCBSC-IL-21 into the nude mice was safe and feasible in ovarian cancer therapy, and that the method would be a promising new strategy for clinical treatment of ovarian cancer. Key words: Interleukin-21; Umbilical cord blood stem cells (UCBSCs); Ovarian cancer; Gene therapy
INTRODUCTION
them, age-related functional defects, hematopoietic and immune system disorders, heart failures, chronic liver injuries, diabetes, arthritis, muscular, skin, lung, eye, and digestive disorders, Parkinson’s and Alzheimer’s diseases as well as aggressive and recurrent cancers could be successfully treated with stem cell-based therapies (8,28,33). Therapeutic strategies have also been set up using HSCs or UCBSCs to treat solid tumors such as ovarian cancer (31), hepatic cancer (19), breast cancer (16,34), head and neck squamous cell carcinoma (29), glioma (20,21), non-Hodgkin lymphoma (27), liposarcoma (2), etc. These reports suggest that the UCBSCs possessing multipotent HSC characteristics can be expanded ex vivo and can contribute meaningfully to the development of UCBSC-based gene therapy for cancers. There is increasing evidence that ovarian cancer causes more deaths than any other cancers of the female reproductive system. The high mortality rate of ovarian cancer is usually attributed to late diagnosis of this tu-
Hematopoietic stem cells (HSCs) are able to differentiate into all blood cell lineages and generate progeny with the same unrestricted hematopoietic potentials. Human umbilical cord blood stem cells (UCBSCs) are a source of rare and precious primitive HSC and progenitor cells that are increasingly used for stem cell transplantation in treating lethal congenital or malignant and nonmalignant disorders (1,7,22). The use of UCBSC grafts for HSC transplantation is a promising technique that permits a degree of human lymphocyte antigen (HLA) mismatch between the graft and the host without the concomitant increase in posttransplant graft-versushost disease that would be observed between an adult marrow graft and a mismatched host (37). In recent years HSCs have been the object of new research efforts and scientific advances for treating numerous genetic and degenerative disorders. Among
Received September 1, 2009; final acceptance September 22, 2010. Online prepub date: November 5, 2010. 1These authors provided equal contribution to this work. Address correspondence to Dr. Jun Dou, Department of Pathogenic Biology and Immunology, Medical College, Southeast University, Nanjing 210009, China. E-mail:
[email protected] or Dr. Ning Gu, School of Biological Science & Medical Engineering, Southeast University, Nanjing 210096, China. E-mail:
[email protected]
669
670
mor due to a lack of early symptoms. Even in the late stages of the disease, the courses are highly variable, and uncontrolled metastases account for the majority of the deaths associated with ovarian cancer (18,24). Although about 75% of patients initially respond to a primary therapy, the majority of the patients eventually progress and require additional chemotherapy. Unfortunately, the second- and third-line (and beyond) therapies are aimed at palliative care to prolong the time of progression and to improve the quality of life (32). Given that, it is clear that novel therapeutic strategies are desperately needed (18). In our previous studies, interleukin-21 (IL-21) was involved in T and NK cell activation and effector responses in the tumor vaccine approaches (9,10). In fact, IL-21 has been extensively applied to significantly augment antitumor immunity in multiple murine tumor models and clinical trials, such as metastatic lymphoma (21), melanoma (36,37), ovarian cancer (14), etc. In the current study, we made use of the biological characteristics of HSCs that are attractive targets for somatic cellbased gene therapy, because they have the potential to produce progeny cells containing a therapeutic gene for a life-long time (2,38). We used CD34+ UCBSCs that were engineered to express IL-21, transplanted it into A2780 ovarian cancer xenograft-bearing nude mice, evaluated its therapeutic effect on ovarian cancer, and attempted to design a promising new strategy for clinical treatment of ovarian cancer. MATERIALS AND METHODS Cell Lines, Primers, and Antibodies The YAC-1 cell line was Moloney leukemia-induced T-cell lymphoma of A/Sn mouse origin, and the A2780 cell line was of ovarian cancer patients’ origin. The two lines were purchased from the Cellular Institute in Shanghai, China. These cells were cultured at 37°C in 5% CO2 in the complete media (CM) consisting of RPMI-1640, 2 mM L-glutamine, 100 U/ml penicillin, 100 µg/ml streptomycin, and 10% fetal bovine serum (FBS). The sequences of the primers are as follows: 5′GGCGCTAGCATGGATCGCCTCCTGATTAGACTT3′ for the PCR sense primer 1 for IL-21 gene, 5′-TGCG CGGCGTCGGTGGAGAGATGCTGAT-3′ for the antisense primer 2; 5′-CGACCTCAAGCCAGCAAAGTG3′ for the sense primer 3 for NKG2D gene, 5′-TGTTGC TGAGATGGGTAATG-3′ for the antisense primer 4; 5′-ATTACCAGGCTGCAGAACTTT-3′ for the sense primer 5 for glyceraldehyde phosphate dehydrogenase (GAPDH) gene; 5′-TCTTCCTAGATGTTCGTGTGC3′ for the antisense primer 6. All the primers were synthesized by Shenneng Company of Gene and Technology of China in Shanghai.
HU ET AL.
Mouse anti-human CD56, rat anti-mouse CD11a, mouse anti-human and MIC A/B-PE (MHC class I chain related molecules A/B-phycoerythrin) monoclonal antibodies (eBioscience, USA) were respectively used in flow cytometry (FCM) to identify the antigens CD11aPE, CD56-FITC, and MIC A/B-PE. Preparation of CD34+ Cord Blood Stem Cells All human umbilical cord blood samples were obtained from the Department of Gynecology & Obstetrics of Zhongda Hospital, Southeast University (Nanjing, Jiangsu, China) and were used in accordance with the ethical guidelines and accepted human studies protocols at Southeast University School of Medicine. The UCBSCs was obtained with the magnetically activated cell sorting (MACS) technique from previous reports (17,23,24). Briefly, the umbilical cord blood mononuclear cells were isolated from the fresh umbilical cord blood by Ficoll gradient separation and washed in phosphatebuffered saline (PBS). Then, monoclonal antibody (Ab) against the human CD34 molecule (Miltenyi Biotec, Germany) was added for 30 min at 4°C. The cells were then rinsed twice in 1 ml PBS for further MACS. This was performed according to the manufacturer’s protocols (Miltenyi Biotec, Bergisch Gladbach, Germany) (7). Firstly, the magnetically labeled cell population was applied to MACS CS1 columns that had been equilibrated with 3 ml PBS in the VarioMACS unit (Miltenyi Biotec) and was allowed to separate for 60 min. The nonmagnetic negative cell population was washed out of the column and the column was taken out of the magnetic separator. The magnetic-positive cell population retained in column was collected as eluate after the washing step with a total volume of 2 ml PBS. These magnetically isolated CD34+ UCBSCs were later used in vitro culture with a cytokine cocktail containing IL-3 (60 ng/ml), IL-6 (60 ng/ml), and recombinant human colony stimulating factor (60 ng/ml) with 15% FBS for 7 days. Colonies of proliferating, CD34+ UCBSCs were typically noted on days 6–7, and the cultures were serially propagated in six wells for transfection, and the media was changed to CM with cytokine cocktail but no serum (26). Construction, Transfection, and Analysis of IL-21 Expression The construction of recombinant pIRES2-IL-21EGFP (enhancement green fluorescent protein) was according to our previous report (14). CD34+ UCBSCs were cultured in CM in six-well plates and the cells were respectively transfected with the recombinant pIRES2-IL-21-EGFP or blank plasmid pIRES2 with the LipofectamineTM 2000 reagent (Invitrogen, USA) ac-
IL-2-SECRETING UCBSCs AS AN OVARIAN CANCER THERAPY
cording to our previous reports (19,25). Growth medium may be replaced after 4 h of incubation, followed by the selection with 800 µg/ml of G418 (Clontech, CA) in CM with cytokine cocktail, with 15% FBS. After 7–10 days, G418-resistant clones were selected and then screened for IL-21 expression by RT-PCR, fluorescence microscope, and Western blotting, respectively. The cellsexpressing IL-21 are henceforth referred to as CD34+ UCBSC-IL-21 whereas CD34+ UCBSC refers to cells transfected with blank plasmid pIRES2 and no IL21 expression. Evaluation of Gene Therapy of Ovarian Cancer Efficacy The Balb/c nude mice of 4–5 weeks of age were acquired from the Animal Center of Shanghai of China and were randomly assigned to CD34+ UCBSC-IL-21 group, CD34+ UCBSC group, and PBS control group. The mice were raised at the Experimental Animal Center, Medical College, Southeast University, Nanjing, China, under sterile conditions in air-filtered containers. All the experiments were performed in compliance with the guidelines of the Animal Research Ethics Board of Southeast University, China. In establishing an ovarian cancer xenograft-bearing nude mice model, 1 × 107 A2780 cells were subcutaneously (SC) injected into a mouse’s right flank. About 9–10 days after the injection, tumors were visible to the naked eye. Then, 1 × 106 CD34+ UCBSC-IL-21 or 1 × 106 CD34+ UCBSC or 100 µl PBS were respectively SC injected into the mouse’s tumor sites, and tumor growth was monitored once at 7 days by measuring two perpendicular diameters of the tumors using calipers. The tumor sizes and surviving mice were evaluated (14,25). Three mice per group were used and the experiment was repeated thrice. The visible fluorescence was viewed under a fluorescence microscope (OriginFluo 2008, East Image Inc., China). Flow Cytometric CFSE/7-AAD Cytotoxicity Assay and Splenocyte Proliferative Assay The conventional flow cytometric CFSE/ 7-amino actinomycin D (7-AAD, Sigma) cytotoxicity assay was performed using the methods from previous reports (25,35). Briefly, the 5 × 105 splenocytes were labeled with 200 nM CFSE (Molecular Probes) in PBS for 15 min at 37°C in a volume of 1 ml. The CFSE-labeled effector cells were seeded with A2780 or YAC-1 target cells at the E/T ratios of 50:1. The cell mixtures were incubated in the buffer containing 20 µg/ml 7-AAD for 20 min at 4°C in the dark. Acquisition was performed right afterwards on the FCM. Analyses were performed with the Cell QuestTM software (BDIS). The assay was used in triplicate. For identification of bioactivity of
671
CD34+ UCBSC-IL-21 in vitro, the splenocytes from the normal nude mice were incubated with the supernatant from the cultured CD34+ UCBSC-IL-21 for 72 h, then the splenocyte proliferative activity was detected as described in a previous report (39). ELISA for IFN-γ, IL-4, and TNF-α Serum cytokines were measured using a commercially available enzyme-linked immunosorbent assay (ELISA) according to the manufacturer’s protocol (eBioscience Company, USA). Briefly, samples were diluted 1:5 with PBS, and each cytokine was captured by the specific primary monoclonal Ab and detected by biotinlabeled secondary Ab. The plates were read at 450 nm using a microplate reader (Bio-Rad Labs, Hercules, CA). The samples and standards were run in triplicate, and the sensitivity of the assays was 0.1 U/ml for interferon-γ (IFN-γ, IL-4, and tumor necrosis factor-α (TNFα), respectively (3,30). RT-PCR Total cellular RNA was extracted from either the cultured cells or splenocytes, or tumor tissue cells, respectively, by using RNeasy Mini Kit (Qiagen, CA) according to the manufacturer’s instructions. cDNA was synthesized with the reverse SuperScript Choice System (Invitrogen, CA). cDNAs of IL-21, cDNAs of β-actin DNA, cDNAs of CD34+ UCBSCs, and cDNAs of tumor tissue cells were respectively amplified by PCR with the primers described above. All the amplified products were subjected to 1.5% agarose gel electrophoresis containing GelStar dye (FMC BioProducts, Rockland, ME) and visualized by UV light (13). Western Blotting The protocol was based on a previously published report (12). Briefly, 1 × 106 cells were collected and lyzed in a protein extraction buffer (Novagen, WI) according to the manufacturer’s protocol. Western blotting was performed after 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and proteins (15 µg/lane) were electrotransferred onto a nitrocellulose membrane. The goat antimouse Ab was added to the membrane for 1 h, the membrane was washed for 5 min with Ab wash solution three times, and the subsequent steps were performed according to the Western-Breeze Kit’s protocol (Invitrogen). Tissue and Tumor Histopathology Mice were sacrificed 70 days after the A2780 cell challenge. The tissues of the spleens, livers, and lungs as well as the tumor tissues were removed from the nude mice and fixed in 10% formalin, and then embedded in paraffin. Serial thin tissues and tumor sections (4 µm)
672
HU ET AL.
were cut and mounted on SuperFrost Plus glass slides, fixed in methanol, and stained in hematoxylin and eosin (H&E). The slides were viewed under a Zeiss Axioplan light microscope at a magnification of 100× (11). Immunohistochemistry Immunostaining was performed as previously described (15). Briefly, 4 µm formalin-fixed, paraffinembedded slides were incubated with the goat antimouse NKG2D (Natural killer glucoprotein 2 domain) (clone NKG2D molecule, Miltenyi Biotec) after overnight incubation at 4°C. NKG2D detection was performed by using rabbit anti-goat EnVision System-HRP (Dako Cytomation, Carpinteria, CA) for 30 min at room temperature. The samples were then labeled with HRPconjugated streptavidin (Invitrogen) and the chromogenic reaction developed using Liquid DAB Substrate Pack (Biogenex, San Ramon, CA) according to the manufacturer’s instructions. NKG2D-stained cells were counted in 10 random and nonoverlapping fields at high magnification of 200×. Cell Staining and FCM Analysis For the analysis of molecular expression of MIC A/B on the A2780 cells, the experiment protocol was performed based on the manufacturer protocol (eBioscience, USA) and our previous report (14). Briefly, the tumor cells from the tumor tissues were stained with mouse anti-human MIC A/B-PE and the splenocytes were stained with rat anti-mouse CD11a-PE or mouse anti-human CD56-FITC (eBioscience), washed twice in PBS, and then resuspended in PBS 3% FBS. The conjugated cells were kept from light for 30 min at 4°C and the expression of the MIC A/B was analyzed by FCM according to the eBioscience kit’s protocol. Statistical Analysis Statistical comparisons were performed using the Student’s t-test method or single factor analysis of variance to test for any statistically significant differences in the results between the experiment group and the control group. Bonferroni correction was used where multiple comparisons were made. The mean and SDs of the result between the two groups was used in the t-tests and a values of p < 0.05 was considered statistically significant. Analyses were performed with the Graph Pad Prism 3.0 statistical software package (Graph Pad Company, USA) (14). RESULTS Identification of Expression and Bioactivity of IL-21 in CD34+ UCBSC-IL-21 We constructed the recombinant pIRES2-IL-21EGFP and successfully identified it by the analyses of
an endonuclease digestion and DNA sequence (data not shown here). Subsequently, we developed the CD34+ UCBSC-IL-21 that was transfected with the pIRES2-IL21-EGFP, and further identified the expression of IL21 using RT-PCR, Western blotting, and fluorescence microscope, respectively. Figure 1A shows RT-PCR results of the extract templates from the cells treated with the different methods. Figure 1B indicates IL-21’s expression visualized by the fluorescence microscope. However, there is no visible fluorescence in the CD34+ UCBSC (Fig. 1C). Figure 1D indicates that IL-21 was also correctly expressed in its actual size of 17 kDa in the CD34+ UCBSC-IL-21. The results suggested that the CD34+ UCBSC-IL-21 had been engineered successfully. Next, we further identified the IL-21 bioactivity of CD34+ UCBSC-IL-21. The isolated splenocytes from the normal nude mice were incubated with the supernatant from the cultured CD34+ UCBSC-IL-21 for 72 h. The splenocyte’s proliferative activity was 84.01 ± 4.78% for the CD34+ UCBSC-IL-21 group, 38.09 ± 3.75% for the CD34+ UCBSC group, and 21.16 ± 2.67% for the control group. There were significant increases in the CD34+ UCBSC group (*p < 0.05) and the CD34+ UCBSC-IL-21 group (**p < 0.03), respectively, compared with the control group, or in the CD34+ UCBSCIL-21 group (#p < 0.003) compared with CD34+ UCBSC group (Fig. 1, E4). This result suggested that the IL21 in the supernatant from CD34+ UCBSC-IL-21 was functional and that CD34+ UCBSC would provide good vehicle for further CD34+ UCBSC-based IL-21 gene therapy of ovarian cancer. Efficacy of CD34+ UCBSC-IL-21 Therapy for Ovarian Cancer in Nude Mice In order to evaluate the efficacy of CD34+ UCBSCIL-21 therapy for ovarian cancer in the mice, we first tested whether CD34+ UCBSC-IL-21 inhibited tumor growth in the nude mice. Figure 2A shows that CD34+ UCBSC-IL-21 inhibited tumor growth obviously and there were significant decreases of tumor size in the CD34+ UCBSC group (p < 0.05) and the CD34+ UCBSCIL-21 group (p < 0.003) compared with the control group, respectively, or in the CD34+ UCBSC-IL-21 group (p < 0.03) compared with CD34+ UCBSC group. The survival time of the mice was lengthened in the CD34+ UCBSC-IL-21 group, as shown in Figure 2B. Next, we investigated whether CD34+ UCBSC-IL-21 stayed in the tumor sites for a long time in order to know the mechanism of CD34+ UCBSC-based IL-21 gene therapy of ovarian cancer. It was found that, after 1 × 106 CD34+ UCBSC-IL-21 was injected into a mouse’s right flank that was initially challenged with the 1 × 107 A2780 cells, CD34+ UCBSC-IL-21 could stay in the tu-
IL-2-SECRETING UCBSCs AS AN OVARIAN CANCER THERAPY
673
Figure 1. Detection of IL-21 expression and its bioactivity in CD34+ UCBSC-IL-21. (A) The existence of the IL-21 transcription in the CD34+ UCBSC-IL-21. Lane 1: DNA molecular ladder; lanes 2–7 denotes RT-PCR results of the extract temples from the different cells, respectively. There are specific 441 bp bands of IL-21 in lanes 2 and 3, and the amounts of β-actin DNA are shown in lanes 4 and 5 as a control. The negative and positive controls are shown in lane 6 and 7, respectively. (B) IL-21 expression in CD34+ UCBSC-IL-21 identified by the fluorescence microscope, and it indicates IL-21’s expression was visualized by the fluorescence microscope. However, there was no visible fluorescence in the CD34+ UCBSC (C). Scale bars: 50 µm. (D) IL-21’s expression identified by Western blotting is shown in lane 3. (E1–E3) The effects of the supernatant from the different cultured cells on the splenocyte’s proliferative activities. [E1: control CD34+ UCBSC (no transfection), E2: CD34+ UCBSC (transfected with blank plasmid), E3: CD34+ UCBSC-IL-21 (transfected with IL-21 recombinant). It was found that IL-21 exhibited its bioactivity powerfully (86.21%) (E3). There were statistically significant differences between the groups (E4). *p < 0.05, **p < 0.03, #p < 0.003.
mor sites for more than 21 days. The evidence in support of this finding was the visible fluorescence that remained at the tumor sites of the nude mice, although the fluorescence gradually attenuated, as shown in Figure 2C for 2 days or in Figure 2D for 11 days and in Figure 2E for 21 days following the three observations under the fluorescence microscope. This finding implied that CD34+ UCBSC-IL-21 chronically targeted at tumor sites could be used as one of the mechanisms for the CD34+ UCBSC-IL-21 therapy of ovarian cancer.
Numbers of NK Cells and Cytotoxicities of Splenocytes to YAC-1 Cells and A2780 Cells To evaluate whether the efficacy of CD34+ UCBSCIL-21 therapy for ovarian cancer in the nude mice are induced by the NK cells, we examined the NK cell numbers and their cytotoxic activities. Figure 3A displays the numbers of NK cells of mouse and human origin in the upper left and lower right panels, respectively. In addition, the cytotoxic activities of splenocytes to the
674
HU ET AL.
Figure 2. Ovarian cancer therapy efficacy by CD34+ UCBSC-IL-21. (A) The ovarian cancer therapy results in the nude mice that were inoculated with 1 × 107 A2780 cells for 7 days and were subsequently injected with 1 × 106 CD34+ UCBSC-IL-21. The therapy efficacy was shown in the ovarian cancer of the treated mice, delaying the tumor appearance and reducing the tumor sizes. The tumor sizes were 955.75 ± 78.05 mm3 in the control group, 670.55 ± 73.05 mm3 in the CD34+ UCBSC group, and 265.08 ± 50.35 mm3 in the CD34+ UCBSC-IL-21 group, respectively, on day 70 after 1 × 106 different cell injection. There were statistically significant differences between the CD34+ UCBSC group and the control group (*), or between the CD34+ UCBSC-IL-21 group and the control group (**), or between the CD34+ UCBSC-IL-21 group and the CD34+ UCBSC group (*), respectively. (B) The mice in the CD34+ UCBSC-IL-21 group had a longer survival time compared with the other groups until 160 days into the observation. (C–2E) The fluorescence amount of CD34+ UCBSC-IL-21 (arrows) remaining in the tumor sites of mice after 1 × 106 CD34+ UCBSC-IL-21 was injected into mice for 2 days (C), for 11 days (D), and for 21 days (E), respectively. Scale bars: 10 mm. *p < 0.05, **p < 0.03, and #p < 0.003.
YAC-1 cells (Fig. 3B) and the A2780 cells (Fig. 3C) were detected by FCM. The experiment was repeated three times. The results suggested that CD34+ UCBSCIL-21 can not only induce the nude mice to generate more NK cells of mouse and human origin but also can enhance its cytotoxic activities to the YAC-1 cells and the A2780 cells, respectively. Detecting Expressions of IL-21, NKG2D, MIC A/B, and CD34 in Tumor Tissues In the current study, we first engineered CD34+ UCBSC-IL-21 and identified IL-21 expression in CD34+ UCBSC-IL-21, and we then further identified whether IL-21 was expressed in ovarian cancer tissues in the mice. Figure 4A and B indicates that there was IL-21 transcription and protein expression in the tumor tissues,
and this may suggest that the CD34+ UCBSC-based IL21 participated in the therapy of ovarian cancer. NKG2D and MIC A/B play an important role in the immunosurveillance of tumors. We also detected the molecular expressions of NKG2D and MIC A/B in the tumor tissues. Figure 4C (lanes 2–4) shows the RT-PCR results of CD34+ UCBSC-IL-21, CD34+ UCBSC, and the A2780 cells, respectively. The strongest 667 bp NKG2D band was shown in lane 2, whose template was from CD34+ UCBSC-IL-21. The NKG2D expression (brown cells) detected by immunohistochemistry is shown in Figure 4D–F. NKG2D expression was actually upregulated in the tumor tissues of the mice treated with CD34+ UCBSC-IL-21 compared with the other groups. Figrue 4H shows that the expressions of MIC A/B in the tumor tissues were 95.25% in the CD34+ UCBSC-
IL-2-SECRETING UCBSCs AS AN OVARIAN CANCER THERAPY
IL-21 group, 71.38% in the CD34+ UCBSC group, and 43.46% in control group, respectively. The results implied that the secreted IL-21 from CD34+ UCBSC-IL-21 enhanced the expressions of NKG2D and MIC A/B and
675
assisted in exerting an antitumor effect through augmenting NK cytotoxicity. Figure 4I also shows that the expressions of CD34 molecular UCBSC in the tumor tissues were 23.46% in the CD34+ UCBSC-IL-21 group,
Figure 3. Detection of the numbers of NK cells and evaluation of cytotoxic activities of splenocytes detected by FCM. (A) Visibly increased numbers of CD11a+ NK cells of mouse origin in the upper left panels and CD56+ NK cells of human origin in the lower right panels in the mice treated with CD34+ UCBSC-IL-21 compared with the mice treated with CD34+ UCBSC or with the control group, respectively. There were statistically significant differences between the CD34+ UCBSC and the control group (p < 0.05) or between the CD34+ UCBSC-IL-21 group and the control group (p < 0.003) or between the CD34+ UCBSC-IL-21 group and the CD34+ UCBSC group (p < 0.03), respectively. (B, C) The activities of the splenocytes to the YAC-1 cells and the A2780 cells, respectively. The highest cytotoxic activity to the YAC-1 cells (69.64%) or to the A2780 cells (59.77%) was found in the splenocytes from the mice treated with CD34+ UCBSC-IL-21 (B3, C3), followed by the cytotoxic activity to the YAC-1 cells (31.37%) or to the A2780 cells (24.97%) in the mice treated with the CD34+ UCBSC (B2, C2). The lowest cytotoxic activity to the YAC-1 cells (28.33%) or to the A2780 cells (15.64%) was in the splenocytes from the mice treated with PBS (B1, C1). The activities of splenocytes to the YAC-1 cells and the A2780 cells were statistically significant between the CD34+ UCBSC-IL-21 and CD34+ UCBSC groups (p < 0.05) or between the CD34+ UCBSC-IL-21 and control groups (p < 0.03). (A1–A3) Control group; (B1–B3) CD34+ UCBSC group; (C1–C3) CD34+ UCBSC-IL-21 group.
676
HU ET AL.
Figure 4. Expressions of IL-21, NKG2D, MIC A/B, and CD34 detected by RT-PCR, Western blotting, immunohistochemistry, and FCM. Lane 2 in (A) (RT-PCR) and lane 3 in (B) (Western blotting) show the IL-21 RNA transcription and protein expression (17 KD) in the tumor tissues of the mice treated with CD34+ UCBSC-IL-21. However, no specific IL-21 band was shown in the tumor tissues of the mice treated with CD34+ UCBSC [lane 3 in (A) and lane 2 in (B)] or in mice treated with PBS [lane 4 in (A) and lane 1 in (B)]. (C) The RT-PCR results. (D–F) The NKG2D expression detected by the immunohistochemistry assay; the differences were statistically significant as is shown in (G). Scale bars: 50 µm. *p < 0.05, **p < 0.03, #p < 0.003. (H) The MIC A/ B expression detected by the FCM; the differences were statistically significant (*p < 0.05, **p < 0.03, #p < 0.003). (I) The CD34 expression detected by the FCM; the differences were statistically significant (*p < 0.05, **p < 0.03, #p < 0.003).
14.13% in the CD34+ UCBSC group, and 3.46% in control group after 1 × 106 CD34+ UCBSC-IL-21 or 1 × 106 CD34+ UCBSC, or 100 µl PBS were SC injected into the mouse’s tumor sites for 4 weeks. The results suggested that the self-renewing CD34+ UCBSC subpopulation accumulated at a higher rate within the tumor tissues in the CD34+ UCBSC-IL-21 group, and that the CD34+ UCBSC subpopulation could differentiate into the different immunocytes in the tumor tissues to play an antitumor function.
Detecting Cytokines To further analyze the mechanism of CD34+ UCBSCIL-21 therapy for ovarian cancer in the mice, we designed an experiment to find out whether the cytokines IFN-γ, IL-4, and TNF-α in serum were changed in the mice treated with CD34+ UCBSC-IL-21. The results, shown in Figure 5, suggested that after CD34+ UCBSCIL-21 was injected into the mice, IFN-γ, IL-4, and TNFα were increased markedly in comparison with the con-
IL-2-SECRETING UCBSCs AS AN OVARIAN CANCER THERAPY
trol group in nude mice treated with PBS, and that these cytokines may have assist in CD34+ UCBSC-IL-21’s antitumor activity. Histological Analysis of the Spleen, Liver, Lung, and Tumor Tissues in the Nude Mice Six nude mice injected with UCBSCs appeared healthy and showed no clinical symptoms throughout the 70-day observation period, and then were sacrificed. No gross visible tumors were found around the injection sites or in any other regions of the mice. Histological analyses also failed to detect any evidence of tumors in tissues such as lung, liver, and spleen (Fig. 6A–C). These results suggested that the human UCBSCs did not form tumors in mice and thus could be potentially usable for UCBSC-based studies. Histopathological analysis was performed on the tumor sites in the nude mice and the results are shown in Figure 6D–F. Histological result analyses suggested that the CD34+ UCBSC-IL-21 could induce nude mice to generate the immune responses to the A2780 ovarian cancer cells. DISCUSSION We previously found that the ovarian cancer cells that were genetically engineered to secrete biologically active IL-21 alone or in combination with granulocyte macrophage colony stimulating factor cytokines elicited antitumor immunity effectively in the nude mice model (14). The goal of this study was to assess the potential capability of the CD34+ UCBSC-IL-21 against ovarian
677
cancer in the Balb/c nude mice and to explore the mechanisms of such capability. Our experimental result showed that CD34+ UCBSCIL-21 stably expressed IL-21 and induced robust tumoricidal activities against human ovarian tumors in situ with minimal toxic side effects in the nude mice model after the A2780 inoculation, and that this effectiveness was reflected in the tumors showing slower growth, the smaller sizes (Fig. 2A), in the tumor cell necrosis and apoptosis, and in the observation that the vascular bleeding was more obvious in the tumor tissues (Fig. 6F). Regarding the different antitumor efficacy in the CD34+ UCBSC-treated mice that 9 mice all died by day 140 or in the CD34+ UCBSC-IL-21-treated mice that 2 out of 9 mice were still alive by day 160, we think that the therapeutic efficacy was probably related to CD34+ UCBSC-IL-21 staying in tumor tissues for a long time (Fig. 2C–E). The IL-21 secreted by the CD34+ UCBSC may stimulate the innate immune response to A2780 ovarian cells as well as induce CD34+ UCBSC to differentiate more immune cells, enhance its immune activity, play a key role in killing tumor cells, or drive tumor cell apoptosis. Although CD34+ UCBSC can also elicit antitumor immune responses in contrast to the control group, this antitumor efficacy was especially true of the mice transplanted with CD34+ UCBSC-IL-21 that chronically secrete IL-21. To understand the mechanisms of such antitumor efficacy, we examined the NK cytotoxicity and serum cytokines (IFN-γ, IL-4, and TNF-α). NK cells can lyse virally infected and malignant cells without prior sensiti-
Figure 5. Serum IFN-γ, IL-4, and TNF-α detected by ELISA assay. The serum cytokine concentrations of (A) IFN-γ, (B) IL-4, and (C) TNF-α were detected by ELISA assay. It was found that the levels of IFN-γ and TNF-α were significantly increased in the CD34+ UCBSC-IL-21 group (#) and the CD34+ UCBSC group (*), respectively, compared with the control group, or markedly increased in the CD34+ UCBSC-IL-21 group (**) compared with CD34+ UCBSC group. The IL-4 levels were likewise markedly enhanced in both the CD34+ UCBSC-IL-21 group (#) and the CD34+ UCBSC group (*) in comparison with the control group, but there was no significant difference between CD34+ UCBSC-IL-21 group and the CD34+ UCBSC group. One set of data in histogram represents nine mice. *p < 0.05, **p < 0.03, #p < 0.003.
678
HU ET AL.
Figure 6. Histopathology of normal tissues and tumor tissues in the nude mice (H&E 100×). (A–C) The tissue sections of lung, liver, and spleen in order after the 1 × 106 UCBSCs were IV injected into each nude mouse for 70 days, showing no presence of any tumor cells. (D–F) The tumor tissue sections of the mice in the A2780 group, the CD34+ UCBSC group, and the CD34+ UCBSC-IL-21 group, respectively. The tumor histopathological sections were made in the different tumor tissues. The results revealed that some necrotic, apoptotic tumor cells or vascular bleeding was attributable to increased tumor-infiltrating immunocytes (F). In contrast, the active growth of the tumor cells and obvious nucleic divisions or diverse nucleic types were found in the mice challenged with the A2780 cells (D). (E) A few of the tumor-infiltrating immunocytes and a part of the apoptosis tumor cells were noticeable in the tumor tissues of the mice treated with CD34+ UCBSC. The necrotic or apoptosis tumor cells may be due to some immunocytes of UCBSC origin and mouse origin attacking tumor cells. Scale bars: 100 µm.
zation, making them an important member of the first line of defense in innate immunity (38). We found that the numbers of NK cells of mouse (CD11a+ phenotype) and human origin (CD56+ phenotype) were both increased significantly in the mice treated with CD34+ UCBSC-IL-21 and that the splenocyte cytotoxic activities to the YAC-1 cells and the A2780 cells were augmented simultaneously. The results suggested that CD34+ UCBSC-IL-21 would have the capacity to induce UCBSC differentiation and to generate functional NK cells in the CD34+ UCBSC-IL-21-treated mice. Both IFN-γ and TNF-α are important cytokines in antitumor immunity and their levels indirectly represent the capacity of rejection of tumor in bearing-tumor nude mice. The IL-21 released locally from CD34+ UCBSCIL-21 can induce secondary cytokine production. The IFN-γ secreted by the NK cells or the TNF-α secreted by the macrophage, particularly the IFN-γ, can react to the NK cells, enhance its cytotoxic activity, and play a key role in killing tumor cells or induce tumor cell apo-
ptosis (5,6,9,24). Therefore, we also tested the serum levels of IFN-γ and TNF-α. It was found that IFN-γ and TNF-α were markedly increased in the mice treated with CD34+ UCBSC-IL-21. In the presented data, the elevated IFN-γ and TNF-α might markedly enhance the NK cytotoxicity in the splenocytes, especially in the CD34+ UCBSC-IL-21 group (Fig. 3B, C). The enhanced NK cytotoxicity was closely associated with the tumor cell necrosis, apoptosis, and the vascular bleeding in the tumor tissues (Fig. 6F). It was also found that IL-4 was significantly increased in the mice treated with either CD34+ UCBSC-IL-21 or CD34+ UCBSC, in contrast to the control group. Because the IL-4 level is related to Ab generation, we propose that UCBSCs can differentiate into B-lymphoid lineages in the nude mice and that IL-4 may stimulate B lymphocytes to secrete more Ab in the antitumor effect by Ab-dependent cell-mediated cytotoxic activity and complement dependent cytotoxicity. Consequently, the antitumor efficacy induced by CD34+ UCBSC-IL-21 was extremely visible in the mice.
IL-2-SECRETING UCBSCs AS AN OVARIAN CANCER THERAPY
NK cells represent an important effector cell of antitumor immunity. They can lyse virally infected and malignant cells without prior sensitization. NK cells activating immunoreceptors are involved in the recognition and killing of target cells, such as NKG2D, NKp30, NKp44, NKp46, KIR, DNAM-1/CD226, and CD16, etc., and the NKG2D immunoreceptor interacting with its ligand MIC A/B serves as one of the most potent activating receptor and ligand for effector lymphocytes (4,38). To verify this, we detected the expressions of NKG2D and its ligand MIC A/B in the study. Figure 4D–H shows that the expressions of NKG2D and MIC A/B were significantly increased in the tumor tissues of the mice treated with CD34+ UCBSC-IL-21 compared with the mice treated with CD34+ UCBSC or with the mice treated with PBS. Meanwhile, the high number of CD34+ UCBSC maintained in the tumor tissues in the CD34+ UCBSC-IL-21 group may promote UCBSCs to differentiate into various kinds of immunocytes to elicit immune responses against tumors (Fig. 4I). In conclusion, this study was the first one to demonstrate that transplanting CD34+ UCBSC-IL-21 into nude mice augmented the therapy of ovarian cancer efficacy that must likely contribute to the IL-21-secreting UCBSCs staying for a long time in ovarian cancer tissues. The secreted IL-21 probably promoted UCBSC differentiation into the different immunocytes in the nude mice, especially in the NK cells, eliciting antitumor immune responses. Moreover, IL-21 promoted the secretion of the cytokines (IFN-γ, TNF-α, and IL-4) and the high expressions of NKG2D and MIC A/B molecules that probably increased NK cytotoxicity. Therapeutic efficacy was demonstrated in their ability to inhibit and kill ovarian cancer cells in the Balb/c nude mice. A better understanding of the CD34+ UCBSC-based IL-21 gene therapy of ovarian cancer will most likely result in new approaches to treat this aggressive cancer. ACKNOWLEDGMENTS: This work was supported by the Program for Top Researchers in Six Fields in Jiangsu Province, China (No. D14), the Science Foundation of Southeast University (No. 9223001446), in part by the National Natural Science Foundation of China (No. 90406023), and in part by the 973 Program of China (No. 2006CB933206).
REFERENCES 1. Alvarez-Mercado, A. I.; Garcia-Mediavilla, M. V.; SanchezCampos, S.; Abadia, F.; Saez-Lara, M. J.; CabelloDonayre, M.; Gil, A.; Gonzalez-Gallego, J.; Fontana, L. Deleterious effect of human umbilical cord blood mononuclear cell transplantation on thioacetamide-induced chronic liver damage in rats. Cell Transplant. 18:1069– 1079; 2009. 2. Attar, R.; Attar, E. Use of hematopoietic stem cells in obstetrics and gynecology. Transfus. Apher. Sci. 38:245– 251; 2008.
679
3. Banerjee, S.; Nandyala, A.; Podili, R.; Katoch, V. M.; Murthy, K. J.; Hasnain, S. E. Mycobacterium tuberculosis (Mtb) isocitrate dehydrogenases show strong B cell response and distinguish vaccinated with controls from TB patients. Proc. Natl. Acad. Sci. USA 101:12652–12657; 2004. 4. Bauer, S.; Groh, V.; Wu, J.; Steinle, A.; Phillips, J. H.; Lanier, L. L.; Spies, T. Activation of NK cells and T cells by NKG2D, a receptor for stress-inducible MICA. Science 285:727–729; 1999. 5. Bilkenroth, U.; Taubert, H.; Riemann, D. Detection and enrichment of disseminated renal carcinoma cells from peripheral blood by immunomagnetic cell separation. Int. J. Cancer 92:577–682; 2001. 6. Calzascia, T.; Pellegrini, M.; Hall, H.; Sabbagh, L.; Ono, N.; Elford, A. R.; Mak, T. W.; Ohashi, P. S. TNF-α is critical for antitumor but not antiviral T cell immunity in mice. J. Clin. Invest. 117:3833–3845; 2007. 7. Chang, Y. S.; Oh, W.; Choi, S. J.; Sung, D. K.; Kim, S. Y.; Choi, E. Y.; Kang, S.; Jin, H. J.; Yang, Y. S.; Park, W. S. Human umbilical cord blood-derived mesenchymal stem cells attenuate hyperoxia-induced lung injury in neonatal rats. Cell Transplant. 18:869–886; 2009. 8. Cocco, M.; Bellan, C.; Tussiwand, R.; Corti, D.; Traggiai, E.; Lazzi, S.; Mannucci, S.; Bronz, L.; Palummo, N.; Ginanneschi, C.; Tosi, P.; Lanzavecchia, A.; Manz, M. G.; Leoncini, L. CD34+ cord blood cell-transplanted Rag2−/− gamma(c)−/− mice as a model for Epstein-Barr virus infection. Am. J. Pathol. 173:1369–1378; 2008. 9. Dou, J.; Chen, G.; Wang, J.; Zhao, F.; Chen, J.; He, X. F.; Tang, Q.; Chu, L. Preliminary study on mouse interleukin 21 application in tumor gene therapy. Cell. Mol. Immunol. 1:388–396; 2004. 10. Dou, J.; Chu, L.; Zhao, F.; Tang, Q.; Zhang, A.; Zhang, L.; Wang, Y.; Li, Y.; Cao, M.; Gu, N. Study of immunotherapy of murine myeloma by an IL-21-based tumor vaccine in BALB/C mice. Cancer Biol. Ther. 6:1871–1879; 2007. 11. Dou, J.; Hong, X.; Zhao, F.; Wang, J.; Chen, J.; Chen, G. Investigation of GM-CSF immune accessory effects in tumor-bearing mice by direct gene immunization. Immunol. Invest. 35:227–237; 2006. 12. Dou, J.; Liu, P.; Wang, J.; Zhang, X. Effect of hepatitis C virus core shadow protein expressed in human hepatoma cell line on human gene expression profiles. J. Gastroenterol. Hepatol. 21:1794–1800; 2006. 13. Dou, J.; Tang, Q.; Yu, F.; Yang, H.; Zhao, F.; Xu, W.; Wang, J.; Hu, W.; Hu, K.; Liou, C.; He, X. F.; Wang, Y. Investigation of immune effect based on BCG priming and Plasmid DNA expressing Ag85A&GM-CSF boosting in Balb/c mice model. Immunobiology 215:133–142; 2010. 14. Dou, J.; Wang, Y.; Wang, J.; Zhao, F.; Li, Y.; Cao, M.; Hu, W.; Hu, K.; He, X. F.; Chu, L.; Jiang, C.; Gu, N. Antitumor efficacy induced by human ovarian cancer cells secreting IL-21 alone or combination with GM-CSF cytokines in nude mice model. Immunobiology 214:483–492; 2009. 15. Ferrandina, G.; Martinelli, E.; Petrillo, M.; Prisco, M. G.; Zannoni, G.; Sioletic, S.; Scambia, G. CD133 antigen expression in ovarian cancer. BMC Cancer 9:221; 2009. 16. Ganta, C.; Chiyo, D.; Ayuzawa, R.; Rachakatla, R.; Pyle, M.; Andrews, G.; Weiss, M.; Tamura, M.; Troyer, D. Rat umbilical cord stem cells completely abolish rat mammary
680
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
HU ET AL.
carcinomas with no evidence of metastasis or recurrence 100 days post-tumor cell inoculation. Cancer Res. 69: 1815–1820; 2009. Giassi, L. J.; Pearson, T.; Shultz, L. D.; Laning, J.; Biber, K.; Kraus, M.; Woda, B. A.; Schmidt, M. R.; Woodland, R. T.; Rossini, A. A.; Greiner, D. L. Expanded CD34+ human umbilical cord blood cells generate multiple lymphohematopoietic lineages in NOD-scid IL2rgamma (null) mice. Exp. Biol. Med. 233:997–1012; 2008. Hakkarainen, T.; Hemminki, A.; Pereboev, A. V.; Barker, S. D.; Asiedu, C. K.; Strong, T. V.; Kanerva, A.; Wahlfors, J.; Curiel, D. T. CD40 is expressed on ovarian cancer cells and can be utilized for targeting adenoviruses. Clin. Cancer Res. 9:619–624; 2003. Jiang, Z.; Teng, G. J.; Chen, B. A.; Xu, Z. F.; Hu, J.; Shao, Z. Y. Local effects of retrovirally transduced endostatin-expressing human umbilical cord blood CD34+ cells on transplanted malignancy in a mouse model of hepatic cancer. Cell Transplant. 17:969–975; 2008. Kim, S. M.; Lim, J. Y.; Park, S. I.; Jeong, C. H.; Oh, J. H.; Jeong, M.; Oh, W.; Park, S. H.; Sung, Y. C.; Jeun, S. S. Gene therapy using TRAIL-secreting human umbilical cord blood-derived mesenchymal stem cells against intracranial glioma. Cancer Res. 68:9614–9623; 2008. Kim-Schulze, S.; Kim, H. S.; Fan, Q.; Kim, D. W.; Kaufman, H. L. Local IL-21 promotes the therapeutic activity of effector T cells by decreasing regulatory T cells within the tumor microenvironment. Mol. Ther. 17:380–388; 2009. Kohli-Kumar, M.; Shahidi, N. T.; Broxmeyer, H. E.; Masterson, M.; Dalaat, C.; Sambrano, J.; Morris, C.; Auerbach, A. D.; Harris, R. E. Haemopoietic stem/progenitor cell transplant in Fanconi anaemia using HLAmatched sibling umbilical cord blood cells. Br. J. Haematol. 85:419–422; 1993. Kollet, O.; Spiegel, A.; Peled, A.; Petit, I.; Byk, T.; Hershkoviz, R.; Guetta, E.; Barkai, G.; Nagler, A.; Lapidot, T. Rapid and efficient homing of human CD34(+)CD38(−/ low) CXCR4(+) stem and progenitor cells to the bone marrow and spleen of NOD/SCID and NOD/SCID/B2m (null) mice. Blood 97:3283–3291; 2001. Kristiansen, G.; Denkert, C.; Schl?ns, K.; Dahl, E.; Pilarsky, C.; Hauptmann, S. CD24 is expressed in ovarian cancer and is a new independent prognostic marker of patient survival. Am. J. Pathol. 161:1215–1221; 2002. Lecoeur, H.; Fe´vrier, M.; Garcia, S.; Rivie´re, Y.; Gougeon, M. L. A novel flow cytometric assay for quantitation and multiparametric characterization of cell-mediated cytotoxicity. J. Immunol. Methods 253:177–187; 2001. Lin, H.; Cheung, S. W.; Nesin, M.; Cassileth, B. R.; Cunningham-Rundles, S. Enhancement of umbilical cord blood cell hematopoiesis by Maitake beta-glucan is mediated by granulocyte colony-stimulating factor production. Clin. Vaccine Immunol. 14:21–27; 2007. Martinez-Jaramillo, G.; Flores-Guzman, P.; Montesino, J. J.; Quintana, S.; Bautista, J.; Sanchez-Valle, E.; Mayani, H. In vitro proliferation and expansion of hematopoietic progenitors present in mobilized peripheral blood from normal subjects and cancer patients. Stem Cells Dev. 13: 382–389; 2004.
28. Mimeault, M.; Hauke, R.; Batra, S. K. Stem cells: A revolution in therapeutics-recent advances in stem cell biology and their therapeutic applications in regenerative medicine and cancer therapies. Clin. Pharmacol. Ther. 82:252–264; 2007. 29. Nitsch, S. M.; Pries, R.; Wollenberg, B. Head and neck cancer triggers increased IL-6 production of CD34+ stem cells from human cord blood. In Vivo 21:493–498; 2007. 30. Perez, S. A.; Mahaira, L. G.; Sotiropoulou, P. A.; Gritzapis, A. D.; Iliopoulou, E. G.; Niarchos, D. K.; Cacoullos, N. T.; Kavalakis, Y. G.; Antsaklis, A. I.; Sotiriadou, N. N.; Baxevanis, C. N.; Papamichil, M. Effect of IL-21 on NK cells derived from different umbilical cord blood populations. Int. Immunol. 18:49–58; 2006. 31. Perillo, A.; Pierelli, L.; Scambia, G.; Leone, G.; Mancuso, S. The role of hematopoietic stem cells in the treatment of ovarian cancer. Panminerva Med. 44:197–204; 2002. 32. Quiros, R. M.; Valianou, M.; Kwon, Y.; Brown, K. M.; Godwin, A. K.; Cukierman, E. Ovarian normal and tumorassociated fibroblasts retain in vivo stromal characteristics in a 3-D matrix- dependent manner. Gynecol. Oncol. 110: 99–109; 2008. 33. Rachakatla, R. S.; Marini, F.; Weiss, M. L.; Tamura, M.; Troyer, D. Development of human umbilical cord matrix stem cell-based gene therapy for experimental lung tumors. Cancer Gene Ther. 14:828–835; 2007. 34. Rachakatla, R. S.; Pyle, M. M.; Ayuzawa, R.; Edwards, S. M.; Marini, F. C.; Weiss, M. L. Combination treatment of human umbilical cord matrix stem cell-based interferon-beta gene therapy and 5-fluorouracil significantly reduces growth of metastatic human breast cancer in SCID mouse lungs. Cancer Invest. 26:662–670; 2008. 35. Rutigliano, J. A.; Johnson, T. R.; Hollinger, T. N.; Fischer, J. E.; Aung, S.; Graham, B. S. Treatment with anti-LFA-1 delays the CD8+ cytotoxic-T-lymphocyte response and viral clearance in mice with primary respiratory syncytial virus infection. J. Virol. 78:3014–3023; 2004. 36. Shu, S.; Cochran, A. J.; Huang, R. R.; Morton, D. L.; Maecker, H. T. Immune responses in the draining lymph nodes against cancer: Implications for immunotherapy. Cancer Metastasis Rev. 25:233–242; 2006. 37. Steiner, D.; Gelovani, J.; Savoldo, B.; Robinson, S. N.; Decker, W. K.; Brouard, N.; Najjar, A.; Xing, D.; Yang, H.; Li, S.; Marini, F.; Zweidler-McKay, P. A.; Bollard, C. M.; Shpall, E. J.; Dotti, G.; Simmons, P. J. Noninvasive bioluminescent imaging demonstrates long-term multilineage engraftment of ex vivo-expanded CD34-selected umbilical cord blood cells. Stem Cells 27:1932–1940; 2009. 38. Wilk, E.; Kalippke, K.; Buyny, S.; Schmidt, R. E.; Jacobs, R. New aspects of NK cell subset identification and inference of NK cells’ regulatory capacity by assessing functional and genomic profiles. Immunobiology 213:271– 283; 2008. 39. Zhao, F.; Dou, J.; Wang, J.; Chu, L.; Tang, Q.; Wang, Y.; Li, Y.; Cao, M.; Hu, W.; Hu, K.; He, F. X.; Gu, N. Investigation on the anti-tumor efficacy by expression of GPI-anchored mIL-21 on the surface of B16F10 cells in C57BL/6 mice. Immunobiology 215:133–142; 2010.
