and Lipopolysaccharide-Induced Inflammatory Response in Human ...

0021-972X/06/$15.00/0 Printed in U.S.A.

The Journal of Clinical Endocrinology & Metabolism 91(2):546 –554 Copyright © 2006 by The Endocrine Society doi: 10.1210/jc.2005-1664

Dihydrotestosterone Decreases Tumor Necrosis Factor-␣ and Lipopolysaccharide-Induced Inflammatory Response in Human Endothelial Cells Giuseppe Danilo Norata, Gianpaolo Tibolla, Paul Maria Seccomandi, Angelo Poletti, and Alberico Luigi Catapano Department of Pharmacological Sciences (G.D.N., G.T., P.M.S., A.L.C.) and Institute of Endocrinology (A.P.), Centre of Excellence on Neurodegenerative Diseases, University of Milan, 20133 Milan, Italy; and Center for the Prevention and Therapy of Global Cardiovascular Risk (G.D.N., A.L.C.), Italian Society for the Study of Atherosclerosis, Bassini Hospital, 20092 Cinisello Balsamo, Italy Results: Lipopolysaccharide and TNF␣ induced VCAM-1 and ICAM-1 mRNA and protein expression, as detected by real-time quantitative PCR, fluorescence-activated cell sorting, and confocal microscopy, but this effect was inhibited when cells were incubated with DHT. In addition, DHT inhibited mRNA expression of IL-6, MCP-1, CD40, TLR4, PAI-1, and Cox-2 and the release of cytokines and chemokines such as GRO, granulocyte-macrophage colony-stimulating factor, and TNF. The DHT effect was counteracted by bicalutamide, an antagonist of the androgen receptor. Furthermore, when cells were cotransfected with a Cox-2 promoter or a 3X-NF-␬B luciferase reporter vector and a plasmid expressing the human androgen receptor, DHT treatment inhibited the increase of the luciferase activity observed with TNF␣.

Context: An increasing body of evidence suggests that testosterone may exert beneficial effects on the development of atherosclerosis. It was suggested that testosterone may act after conversion into estradiol and activation of the estrogen receptors; however, a direct role of androgens on the vascular wall has been proposed. Objective: We investigated the effects of dihydrotestosterone on the proinflammatory response observed in human endothelial cells. Design: Human endothelial cells isolated from umbilical cords were incubated with lipopolysaccharide or TNF␣ in the presence or absence of dihydrotestosterone (DHT). mRNA and cellular proteins were processed for gene expression studies, and transient transfection experiments were performed to investigate molecular mechanisms involved in the effects observed.

Conclusion: DHT could positively regulate endothelial function through the control of the inflammatory response mediated by nuclear factor-␬B in endothelial cells. (J Clin Endocrinol Metab 91: 546 –554, 2006)

Setting: These studies took place at the Department of Pharmacological Sciences, University of Milan, Milan, Italy.

M

EN ARE MORE than twice as likely as women to die from coronary heart disease, and this ratio is consistent in all populations and is independent of differences in other risk factors (1). Sex hormones decline with age in both sexes, but the relationship of sex hormones to cardiovascular risk is complex (1); male gender is one of the classical risk factors for coronary artery disease (CAD), and androgens or the lack of estrogens have been traditionally regarded as the cause underlying this male disadvantage. Although a detrimental effect of androgens is usually presumed, the effects of testosterone on the vascular bed at physiological concentrations remain unclear, with documentation of both vasodilatory and vasoconstrictive actions (1, 2). An increasing body of evidence suggests that testosterone

may exert beneficial effects on the development of atherosclerosis in animal models (1). Testosterone levels are inversely related to arterial wall thickness (3), and patients with established CAD exhibit lower free testosterone levels compared with healthy controls (4). The mechanisms by which testosterone produces these effects are not clear. It was suggested that testosterone may exert its effects after conversion into estradiol and activation of the estrogen receptors (5). Neither the aromatase inhibitor aminoglutethimide nor the estrogen receptor antagonist ICI 182780, however, prevent the testosterone-induced vasodilatation (6, 7), thus suggesting an effect involving also the androgen pathway. The androgen receptor (AR) and 5␣-reductase [the enzyme responsible for the conversion of testosterone to the more potent androgen derivative 5␣-dihydrotestosterone (DHT)], usually present only in androgen-dependent structures, has been identified in several vascular cell types including human umbilical vein endothelial cells (HUVECs) (8). AR presence has been inversely correlated with coronary calcification and atherosclerosis in men without known CAD (9); furthermore, its activation mediates nongenomic activation of kinases (10), thus affecting cardiac repolarization (11). These observations suggest a role for the androgen pathway activation in vascular protection (12). Because testosterone could activate both the estrogen pathway and the androgen pathway, the

First Published Online November 29, 2005 Abbreviations: AR, Androgen receptor; CAD, coronary artery disease; Cox-2, cyclooxygenase 2; DHT, 5␣-dihydrotestosterone; GM-CSF, granulocyte-macrophage colony-stimulating factor; GRO, growthrelated oncogene; HUVEC, human umbilical vein endothelial cell; ICAM-1, intercellular adhesion molecule-1; LPS, lipopolysaccharide; MCP-1, monocyte chemoattractant protein 1; NF-␬B, nuclear factor-␬B; PECAM-1, platelet-endothelial adhesion molecule-1; VCAM-1, vascular cell adhesion molecule-1. JCEM is published monthly by The Endocrine Society (http://www. endo-society.org), the foremost professional society serving the endocrine community.

546

Norata et al. • DHT and Endothelial Inflammation

J Clin Endocrinol Metab, February 2006, 91(2):546 –554

547

TABLE 1. Primer sequences Gene

Primer forward

Primer reverse

VCAM-1 ELAM-1 PECAM-1 ICAM-1 IL-6 MCP-1 PAI-1 MMP2 TLR-4 COX-2 CD40 RLP13a

GGGCTTTCCTGCTGCGAA GTAGCTGGACTTCTGCTGCTG CCCAGTTTGAGGTCATAAAAGGA GCCGGCCAGCTTATACACAA CCAGGAGCCCAGCTATGAAC CGCCTCCAGCATGAAAAGTCT CGCCAGAGCAGGACGAA CAATGATGGAGAGGCAGACA AATTCCATGGTATTATTGA TTACAATGCTGACTATGGCTACAA TCTCACCTCGCTATGGTTCGT TAGCTGCCCCACAAAACC

AAGAGGCTGTAGCTCCCCG CGTAAGCATTTCCGAAGCCA AGGCAAAGTTCCACTGATCGA CAATCCCTCTCGTCCAGTCG CCCAGGGAGAAGGCAACTG ATGAAGGTGGCTGCTATGAGC GGAGACATCTGCATCCTGAAGTT GGAGTCCGTCCTTACCGTCAA TCTTTTACCCTTTCAATAGT CTTTGACACCCAAGGGAG GCTGGACAGCGGTCAGCAA TGCCGTCAAACACCCTTGAGA

use of the androgen derivative DHT, which could not be aromatized to estradiol, is of great interest to specifically investigate the androgen-dependent response. The endothelium is a key factor in the pathogenesis of atherosclerosis (13). Several factors, including TNF␣ and lipopolysaccharide (LPS), promote endothelial dysfunction (14) via the induction of several genes, including adhesion molecules. Among these are intercellular adhesion molecule-1 (ICAM-1), vascular cell adhesion molecule-1 (VCAM1), platelet-endothelial adhesion molecule-1 (PECAM-1) and E-selectin (13, 14), chemokines and chemotactic factors such as IL-6 or monocyte chemoattractant protein (MCP-1) (14), receptors and enzymes involved in the inflammatory response such as toll-like receptor 4 (15) or cyclooxygenase 2 and proteases such as metalloproteinases (14). Because endothelial dysfunction plays a central role during atherogenesis and endothelial cells express the enzymes and the receptor of the androgen pathway, we postulated that DHT, a nonaromatizable androgen, may decrease or attenuate the inflammatory response in human endothelial cells; therefore, in the present study, we investigated the possible effects of DHT on endothelial cell gene expression and the molecular mechanisms involved.

fection studies), or 18 h (immunofluorescence studies). The concentrations used are the commonly used dosages in similar studies and correlate to the physiological concentration used in vivo. In the experiments investigating the inhibition of the AR, bicalutamide (10⫺8 mol/ liter) or vehicle was added 1 h before the DHT addition. Control cells were incubated with the same amount of vehicle that was added with the stimuli.

Materials and Methods Cell culture HUVECs were isolated as described (16) and cultured under standard conditions in medium M-199 containing 20% fetal calf serum, heparin (15 U/ml), and endothelial cell growth factor (20 ␮g/ml) (Roche, Milan, Italy). The original donors of the cells gave their signed consent to participate in the research. The cells were used within the fourth passage. Cells were plated in six-well plates and used after 48 h as subconfluent cultures. In all experiments, cells were preincubated with serum-free medium for 6 h. Cells were incubated in the presence or absence of compounds with appropriate chemicals or vehicle additions. The human hepatoma cell line HepG2 was cultured as described (17) in MEM supplemented with 10% heat-inactivated fetal calf serum containing 2 mmol/liter l-glutamine, 100 IU/ml penicillin, 100 mg/ml streptomycin, 2.2 mg/liter sodium bicarbonate, and 1 mmol/liter sodium pyruvate. Chinese hamster ovary (CHO) cells were cultured as described (18). For experiments, cells were plated at 300,000 per well in six-well plates and used at subconfluency after a 24-h preincubation in serum-free medium.

Experimental set-up HUVECs were kept in serum-free medium for 6 h, then incubated with DHT (10⫺10 mol/liter) or vehicle for 1 h followed by incubation with TNF␣ (10 ng/ml) or LPS (1 ␮g/ml) for 10 min (intracellular signaling pathways detection), 4 h (mRNA expression studies), 6 h (trans-

FIG. 1. Effect of DHT on TNF␣- and LPS-induced adhesion molecule mRNA expression. A, mRNA expression of VCAM-1, ICAM-1, PECAM-1, and E-selectin is shown for control cells (CTRL) and cells incubated with TNF␣ (10 ng/ml), TNF␣ plus DHT (10⫺10 mol/liter), and TNF␣ plus DHT plus bicalutamide (BIC) (10⫺8 mol/liter); B, mRNA expression of VCAM-1, ICAM-1, PECAM-1, and E-selectin is shown for control cells and cells incubated with LPS (1 ␮g/ml), LPS plus DHT (10⫺10 mol/liter), and LPS plus DHT plus bicalutamide (10⫺8 mol/liter). Results from real-time PCR from four separate experiments are shown (fold induction vs. control cells, corrected for the RLP13a expression, mean ⫾ SD). *,°, P ⬍ 0.05.

548



FIG. 2. Effect of DHT on TNF␣-induced adhesion molecule protein expression. HUVECs were incubated for 18 h in control medium or in medium containing TNF␣ (10 ng/ml) or TNF␣ plus DHT (10⫺10 mol/liter). A, The expressions of VCAM-1, ICAM-1, PECAM-1, and E-selectin (green signal) were evaluated by confocal microscopy. Cytoskeleton (red signal) and nucleus (blue signal) were stained with selective dyes. For details, see Materials and Methods. The results are representative of four separate experiments. Magnification, ⫻600. B, The expressions of VCAM-1, ICAM-1, PECAM-1, and E-selectin were evaluated by cytofluorimetric analysis. The results are representative of four experiments. FL1-H, Fluorescence intensity, log scale.


Real-time quantitative PCR Total RNA was extracted and reverse transcribed as described (19). Three microliters of cDNA were amplified by real-time quantitative PCR with 1⫻ SYBR Green Universal PCR Mastermix (Bio-Rad, Hercules, CA). The specificity of the SYBR Green fluorescence was tested by plotting fluorescence as a function of temperature to generate a melting curve of the amplicon. The melting peaks of the amplicons were as expected (not shown). The primers used are shown in Table 1. Each sample was analyzed in duplicate using the IQ-Cycler (Bio-Rad). The PCR amplification was related to a standard curve ranging from 10⫺11 to 10⫺14 m.

Immunoblotting The analysis of AR expression in the transfected cells was performed as described (16). Briefly, the transfected cells were lysed using a Tris-glycine buffer (0.25 m Tris, 0.173 m glycine) containing


549

3% SDS and 1 mm phenylmethylsulfonyl fluoride. Aliquots of the samples (15 ␮g) were diluted in a 2% ␤-mercaptoethanol buffer containing glycerol and bromophenol blue, electrophoresed on a 12% SDS-PAGE, and then transferred onto a nitrocellulose membrane using a Trans Blot Cell (Hoefer Scientific Instruments, San Francisco, CA) (19, 20). The membrane was saturated at room temperature in PBS containing 3% BSA for 1 h, washed with PBS containing 0.1% Tween 20, and then incubated overnight at 4 C with a primary antibody specific for the AR (Santa Cruz Biotechnology, Santa Cruz, CA) and anti-␤-actin antibody (1:10,000) (Sigma Chemical Co., St. Louis, MO). Because second antibody and antirabbit or antimouse IgG peroxidase-conjugate (Bio-Rad) was used followed by enhanced chemiluminescence and autoradiography; the bands were quantified by a computer-assisted system for image analysis (NIH Image 1.52; National Institute of Standards and Technology, Gaithersburg, MD).

FIG. 3. Effect of DHT on LPS- and TNF␣-induced chemokine expression. Protein release in the supernatant was measured using a human cytokine antibody array. A, Representative result; B, description of the antibody spotted in the array; C, results from four separate experiments (mean ⫾ SD; TNF␣ response is regarded as 100%). *, P ⬍ 0.05.

550


Immunofluorescence studies Cells were cultured on coverslips in 24-well plates. Fixed cells (18) were incubated overnight at 4 C with a monoclonal antibody directed against VCAM-1, ICAM-1, or E-selectin (1:50), followed by incubation with antimouse fluorescein isothiocyanate-conjugated IgG (1:100) (BD Biosciences, Franklin Lakes, NJ) for 30 min and then a mix of phalloidin (Molecular Probes, Leiden, The Netherlands) (1:40), and TOPRO 3 (Molecular Probes) (1:100) was added for 20 min. The coverslips were analyzed with a confocal microscope (Nikon Eclipse TE 2000-S, Radiance 2100 Bio-Rad) at ⫻600 magnification (18). Colocalization analysis was performed using Laserpix software (Bio-Rad).

Detection of cytokine release For the detection of the cytokines in the supernatant, a commercial protein array system (RayBio human cytokine antibody array 3.1; RayBiotech, Norcross, GA) was used according to the manufacturer’s instructions. Briefly, after the incubation with the blocking buffer for 1 h, the membranes were incubated with the supernatants overnight at 4 C and then washed three times with washing buffer 1 and two times with washing buffer 2 (each wash lasted 5 min), followed by incubation with the specific biotin-conjugated antibody mix for 2 h. After the washes, the membranes were incubated with the horseradish peroxidase-conjugated streptavidin followed by enhanced chemiluminescence and autoradiography. The dots were quantified by a computer-assisted system for image analysis (ISF Image 1.52); normalized intensities were calculated from each array by first subtracting the local background from each spot and then normalizing by the average intensity of the arrays. The data were then corrected for the cell protein content of each well.

Transcription assay The construction of the reporter vector for the human Cox-2 gene and the reporter vector containing three response sites for nuclear factor-␬B (NF-␬B) has been described previously (21, 22). Transfection experiments were first performed using HUVECs and EAhy 926 cells; however, the efficiencies reached were very low with a high degree of cytotoxicity (data not shown). Because human cyclooxygenase 2 (Cox-2) promoter regulation is similar in a wide number of cell types (18, 23), we performed transfection experiments in HepG2 and CHO cells. The cells were transiently transfected with Cox-2 (nucleotide ⫺327/⫹59) or the 3X-NF-␬B (nuclear factor ␬ B) luciferase reporter vectors and an AR plasmid (pCMV-hAR has been obtained from Marco Marcelli, Baylor College of Medicine, Houston, TX) using a calcium phosphate precip-


itation method. pRSV-galactosidase control vector (Promega, Madison, WI) was cotransfected as internal control. Luciferase activity was determined using the Lucy3 luminometer (Anthos, Rottweil, Germany) as described (18), and ␤-galactosidase activity was assayed as described (17). Luciferase activity was normalized to the ␤-galactosidase activity of the cotransfected pRSV-galactosidase construct.

Statistical analysis Data are expressed as mean ⫾ sd and are the result of four separate experiments. Statistical analysis was performed using SPSS version 11.0 for Windows (Chicago, IL) with a two-independent-samples test (MannWhitney test), setting the significance level at P ⬍ 0.05.

Results Inhibition of the expression of adhesion molecules by DHT

TNF␣ and LPS induced the expression of VCAM-1 and ICAM-1 (Fig. 1). This effect was inhibited by preincubation with DHT. The inhibitory effect of DHT was reduced when the cells were preincubated with bicalutamide, a selective AR antagonist (Fig. 1). No significant effect on PECAM-1 and E-selectin expression was observed upon incubation with TNF␣, LPS, or DHT (Fig. 1). These data suggest that DHT can inhibit induction of VCAM-1 and ICAM-1 in the endothelium via interaction with the ARs. When cells were incubated with DHT alone (up to 10⫺8 mol/liter) or bicalutamide (up to 10⫺6 mol/liter), no significant effect on endothelial cell gene expression and/or morphological change was observed (data not shown). To study whether increased mRNA expression was associated with increased protein expression, we investigated the expression of VCAM-1, ICAM-1, PECAM-1, and E-selectin after TNF␣ incubation with or without preincubation with DHT (Fig. 2). For VCAM-1 and ICAM-1, an increased protein expression was observed upon incubation with TNF␣, and this effect was prevented by preincubation with DHT (Fig. 2). Similar results were obtained when cells were incubated with LPS (data not shown). No effect on PECAM-1 and

FIG. 4. Effect of DHT on TNF␣- and LPS-induced chemokine expression. A, mRNA expression of IL-6 and MCP-1 is shown for control cells (CTRL) and cells incubated with TNF␣ (10 ng/ml), TNF␣ plus DHT (10⫺10 mol/liter), and TNF␣ plus DHT plus bicalutamide (BIC) (10⫺8 mol/liter); B, mRNA expression of IL-6 and MCP-1 is shown for control cells and cells incubated with LPS (1 ␮g/ml), LPS plus DHT (10⫺10 mol/liter), and LPS plus DHT plus bicalutamide (10⫺8 mol/liter). Results from real-time PCR from four separate experiments are shown (fold induction vs. control cells, corrected for the RLP13a expression, mean ⫾ SD). *,°, P ⬍ 0.05.



551

E-selectin expression was observed in agreement with the mRNA data. Effects of DHT on TNF␣-induced cytokine release and expression in endothelial cells

Next we investigated the effect of DHT on TNF␣-induced cytokine release in endothelial cells using a human cytokine antibody array (Fig. 3). TNF␣ induced the release of IL-6, MCP-1, granulocytemacrophage colony-stimulating factor (GM-CSF), and growth-related oncogene (GRO) (24), and preincubation with DHT decreased this effect (Fig. 3). Also TNF␣ release was increased, but this is probably an artifact caused by the presence on TNF␣ in the supernatant. The effect of DHT was partially inhibited by bicalutamide (Fig. 3). Because the effect of DHT was more evident on IL-6 and MCP-1, we investigated the role of DHT on TNF␣- and LPS-induced expression at the mRNA level. TNF␣ and LPS induced the expression of IL-6 mRNA and of MCP-1 mRNA. These effects were inhibited by preincubation with DHT (Fig. 4). The inhibitory effect of DHT was reduced when the cells were incubated with bicalutamide (Fig. 4), in agreement with the effects observed on adhesion molecules expression. Modulation of inflammatory receptors and proteases

In addition to adhesion molecules and cytokines, the inflammatory response observed in the lesion is associated with the increased expression of receptors and proteases (14). TNF␣ and LPS induced the expression of CD40, TLR4, and PAI-1, whereas no major effect on MMP-2 was observed (Fig. 5). This effect was inhibited by preincubation with DHT (Fig. 5). Again, the inhibitory effect of DHT was reduced when the cells were incubated with bicalutamide (Fig. 5). Modulation of Cox-2 expression, Cox-2 promoter activity, and modulation of NF-␬B

Cox-2 modulates processes contributing to atherosclerosis and thrombosis, including platelet aggregation and the local inflammatory response, by regulating the production of eicosanoids (25). TNF␣ and LPS induced the expression of Cox-2. Again, preincubation with DHT decreased Cox-2 mRNA induction and bicalutamide reduced this effect in endothelial cells (Fig. 6, A and B). To analyze whether the DHT effect was exerted at the transcriptional level, the luciferase activity of a plasmid containing the Cox-2 promoter was analyzed. No effect of DHT in CHO cells under basal conditions was observed (data not shown), in agreement with the absence of AR in CHO cells (Fig. 6C). We thus cotransfected the AR in CHO cells and analyzed the effects of DHT on TNF␣-induced Cox-2 promoter activity. Transient transfection assay showed that TNF-␣ significantly increased the promoter activity, and this effect was inhibited when the cells were incubated with DHT (P ⬍ 0.01 for TNF␣ vs. control and for TNF␣ plus DHT vs. TNF␣) (Fig. 6D). NF-␬B has been implicated in the modulation of several proinflammatory genes involved in endothelial dysfunction, including Cox-2 (14). We thus investigated whether DHT

FIG. 5. Effect of DHT on TNF␣- and LPS-induced CD40, TLR-4, PAI-1, and MMP-2 mRNA expression. A, mRNA expression of CD40, TLR-4, PAI-1, and MMP-2 is shown for control cells (CTRL) and cells incubated with TNF␣ (10 ng/ml), TNF␣ plus DHT (10⫺10 mol/liter), and TNF␣ plus DHT plus bicalutamide (10⫺8 mol/liter); B, mRNA expression of CD40, TLR-4, PAI-1, and MMP-2 is shown for control cells and cells incubated with LPS (1 ␮g/ml), LPS plus DHT (10⫺10 mol/liter), and LPS plus DHT plus bicalutamide (10⫺8 mol/liter). Results from real-time PCR from four separate experiments are shown (fold induction vs. control cells, corrected for the RLP13a expression, mean ⫾ SD), *,°, P ⬍ 0.05.

could interfere with NF-␬B activity. CHO cells were cotransfected with a plasmid containing three NF-␬B-responsive sites upstream of the luciferase gene. Transient transfection assay showed that TNF-␣ significantly increased the luciferase activity, and this effect was inhibited when the cells were incubated with DHT (P ⬍ 0.01 for TNF␣ vs. control and for TNF␣ plus DHT vs. TNF␣) (Fig. 6E). Discussion

Low testosterone plasma levels are related to increased arterial wall thickness independently of other cardiovascular risk factors in elderly men (26) and in overweight and obese young adults (27). Furthermore, men with established CAD exhibit lower free testosterone levels compared with healthy controls (4). Clinical studies indicate that, in men, androgen replacement may provide beneficial effects when CAD is present (2), and testosterone replacement in men with androgen deficiency reduces TNF␣ and IL-1␤ and increases IL-10 plasma concentrations (28). Despite these clinical observations, few and controversial reports have been published on the molecular mechanisms

552



FIG. 6. Effect of DHT on TNF␣- and LPS-induced Cox-2 mRNA expression, promoter activity, and 3X-NF-␬B construct activity. A, mRNA expression of Cox-2 is shown for control cells (CTRL) and cells incubated with TNF␣ (10 ng/ ml), TNF␣ plus DHT (10⫺10 mol/liter), and TNF␣ plus DHT plus bicalutamide (BIC) (10⫺8 mol/liter); B, mRNA expression of Cox-2 is shown for control cells and cells incubated with LPS (1 ␮g/ml), LPS plus DHT (10⫺10 mol/liter), and LPS plus DHT plus bicalutamide (10⫺8 mol/liter). Results from real-time PCR from four separate experiments are shown (fold induction vs. control cells and corrected for the RLP13a expression, mean ⫾ SD). *,°, P ⬍ 0.05. C, AR expression in CHO cells transfected with the empty plasmid or the plasmid containing the human AR sequence; D, relative luciferase activity of the cells cotransfected with the plasmid containing the AR sequence and the plasmid containing the 5⬘-flanking region of the human Cox-2 promoter is shown. The luciferase activity is normalized to the ␤-galactosidase (␤gal) activity of the cotransfected pRSV-galactosidase construct. Results from four separate experiments are shown (mean ⫾ SD). *,°, P ⬍ 0.05. E, Relative luciferase activity of the cells cotransfected with the plasmid containing the AR sequence and the plasmid containing the 3X-NF-␬B construct is shown. The luciferase activity is normalized to the ␤-galactosidase activity of the cotransfected pRSVgalactosidase construct. Results from four separate experiments are shown (mean ⫾ SD). *,°, P ⬍ 0.05.

involved in the effects observed in the vascular wall. Endothelial dysfunction and subsequent inflammation are key steps in the development of atherosclerosis (14); thus, mechanisms counteracting these effects are of great importance for maintaining the integrity and homeostasis of the vascular wall (29). In the present study, we show that DHT, a more potent testosterone derivative, decreases the inflammatory response induced by TNF␣ and LPS in endothelial cells. These effects include the down-regulation of the expression of adhesion molecules, chemokines, and proteases. In experimental studies, androgens decrease IL-6, IL-1, and TNF␣ production in monocyte-macrophages (12) and VCAM-1 and NF-␬B nuclear translocation in the endothelium (8) via the conversion to estradiol (30). In contrast, an induction of VCAM-1 expression and monocyte adhesion to vascular endothelium have been reported in endothelial cells incubated with DHT (31, 32); however, in these experiments, very high concentrations of DHT were used (10⫺7 mol/liter), whereas the antiinflammatory effects exerted by DHT were detectable at a much lower concentration (10⫺10 mol/liter) that is approximately the Kd for the AR (33).

In fact, as shown in this study, 10⫺10 mol/liter DHT decreases the inflammatory response induced by TNF␣ and LPS in endothelial cells, as determined by the down-regulation of adhesion molecules, chemokines, and protease expression. The effects of DHT are prevented when the cells are incubated with bicalutamide, suggesting that the DHT effect is mediated by the activation of the AR. This is in agreement with previous data reported by Hatakeyama et al. (8) who have shown that the administration of cyproterone acetate (an AR blocker) blocked the inhibitory effect of testosterone and of DHT on VCAM-1 expression in endothelial cells. Our findings confirm and extend these results because in addition to VCAM-1, the induction of the expression of other adhesion molecules (at the mRNA and protein level) such as ICAM-1 is prevented by DHT. Furthermore, the release of cytokines and chemokines, such as IL-6, MCP-1, TNF␣, and GM-CSF and the expression of CD40, TLR-4, PAI-1, and Cox-2 is prevented by DHT, suggesting a more general antiinflammatory and endothelium protective effect. This hypothesis is confirmed by several studies showing acute and chronic antiischemic properties of testosterone (34, 35). The effect of DHT on PAI-1 supports the cross-sectional epidemiological


studies, where serum testosterone levels have been positively correlated with tissue plasminogen activator and inversely correlated with PAI-1, fibrinogen, ␣-2 antiplasmin, and factor VIIc levels (36), supporting the idea of a modulation of the fibrinolytic activity by testosterone; however, testosterone supplementation resulted in an increase of the circulating levels of both pro- and anticoagulant factors. Additional work is clearly required to address this issue. The mechanisms by which DHT exerts its effect are uncertain. Because up to now androgen response elements have not been described on the promoter of several inflammatory genes, including VCAM-1, it is unlikely that DHT-AR interacts with the 5⬘-flanking region of the gene. Our results have shown that DHT decreases TNF␣-induced luciferase activity of the Cox-2 promoter, suggesting an effect of DHT on transcription factors modulating proinflammatory gene expression. Indeed, AR can modulate NF-␬B, a key transcription factor in the inflammatory response observed during atherogenesis (14). Testosterone inhibits NF-␬B nuclear translocation (8), and AR modulates the expression of I-␬B␣ (32), the inhibitory protein of the NF-␬B signaling pathway. Furthermore, cardiovascular protective nonnuclear actions of steroid receptors have been reported for corticosteroids and estrogen, suggesting that this could be the case also for DHT (37, 38). In our experiments, when cells were cotransfected with an AR expression plasmid and a plasmid containing three NF-␬B-responsive sites upstream of the luciferase gene, the induction of luciferase activity observed with TNF␣ was prevented by incubation with DHT. A similar effect on NF-␬B signaling has been shown for 17␤-estradiol that inhibits NF-␬B translocation and I-␬B kinase activity (39). It is thus possible that in vivo testosterone could exert antiinflammatory effects via conversion to estradiol and to DHT, thus explaining the partial reversion of TNF␣ and LPS effects on endothelial cells. In summary, we show here that DHT can positively affect endothelial function via the control of the inflammatory response through the inhibition of the NF-␬B-dependent expression of adhesion molecules, chemokines, and proteases. These data have been performed in HUVECs and do not necessarily reflect the behavior of other endothelial cells such as arterial endothelial cells. Previous study has shown that DHT administration to females produced a significantly higher Th2 helper response (40), suggesting in vivo a potential antiinflammatory response to androgens. Additional experiments with the administration of DHT are required to investigate whether physiological levels of androgens affect inflammatory markers and endothelial function in vivo. Acknowledgments We thank Fabio Pellegatta for helpful discussion. Received July 25, 2005. Accepted November 21, 2005. Address all correspondence and requests for reprints to: Giuseppe Danilo Norata, Ph.D., Department of Pharmacological Sciences, University of Milan, Italy, Via Balzaretti 9, 20133, Milan, Italy. E-mail: [email protected]. This work was supported by grants from Fondi Interuniversitari Ricerca di Base (2001-RBNE01HLAK_006), COFIN 2004 (2004065985_006 and 2004069574_003), Consorzio Interuniversitario Ricerca Cardiovascolare (CIRC), and Societa` Italiana Studio Aterosclerosi (SISA) Lombardia.


553

References 1. Wu FC, von Eckardstein A 2003 Androgens and coronary artery disease. Endocr Rev 24:183–217 2. Littleton-Kearney M, Hurn PD 2004 Testosterone as a modulator of vascular behavior. Biol Res Nurs 5:276 –285 3. van den Beld AW, Bots ML, Janssen JA, Pols HA, Lamberts SW, Grobbee DE 2003 Endogenous hormones and carotid atherosclerosis in elderly men. Am J Epidemiol 157:25–31 4. English KM, Mandour O, Steeds RP, Diver MJ, Jones TH, Channer KS 2000 Men with coronary artery disease have lower levels of androgens than men with normal coronary angiograms. Eur Heart J 21:890 – 894 5. Nathan L, Shi W, Dinh H, Mukherjee TK, Wang X, Lusis AJ, Chaudhuri G 2001 Testosterone inhibits early atherogenesis by conversion to estradiol: critical role of aromatase. Proc Natl Acad Sci USA 98:3589 –3593 6. Chou TM, Sudhir K, Hutchison SJ, Ko E, Amidon TM, Collins P, Chatterjee K 1996 Testosterone induces dilation of canine coronary conductance and resistance arteries in vivo. Circulation 94:2614 –2619 7. Yue P, Chatterjee K, Beale C, Poole-Wilson PA, Collins P 1995 Testosterone relaxes rabbit coronary arteries and aorta. Circulation 91:1154 –1160 8. Hatakeyama H, Nishizawa M, Nakagawa A, Nakano S, Kigoshi T, Uchida K 2002 Testosterone inhibits tumor necrosis factor-␣-induced vascular cell adhesion molecule-1 expression in human aortic endothelial cells. FEBS Lett 530:129 –132 9. Liu PY, Christian RC, Ruan M, Miller VM, Fitzpatrick LA 2005 Correlating androgen and estrogen steroid receptor expression with coronary calcification and atherosclerosis in men without known coronary artery disease. J Clin Endocrinol Metab 90:1041–1046 10. Baron S, Manin M, Beaudoin C, Leotoing L, Communal Y, Veyssiere G, Morel L 2004 Androgen receptor mediates non-genomic activation of phosphatidylinositol 3-OH kinase in androgen-sensitive epithelial cells. J Biol Chem 279:14579 –14586 11. Bai CX, Kurokawa J, Tamagawa M, Nakaya H, Furukawa T 2005 Nontranscriptional regulation of cardiac repolarization currents by testosterone. Circulation 112:1701–1710 12. Malkin CJ, Pugh PJ, Jones RD, Jones TH, Channer KS 2003 Testosterone as a protective factor against atherosclerosis: immunomodulation and influence upon plaque development and stability. J Endocrinol 178:373–380 13. Ross R 1999 Atherosclerosis: an inflammatory disease. N Engl J Med 340:115– 126 14. Libby P 2002 Inflammation in atherosclerosis. Nature 420:868 – 874 15. Hansson GK 2001 Immune mechanisms in atherosclerosis. Arterioscler Thromb Vasc Biol 21:1876 –1890 16. Norata GD, Pirillo A, Callegari E, Hamsten A, Catapano AL, Eriksson P 2003 Gene expression and intracellular pathways involved in endothelial dysfunction induced by VLDL and oxidised VLDL. Cardiovasc Res 59:169 –180 17. Norata GD, Banfi C, Pirillo A, Tremoli E, Hamsten A, Catapano AL, Eriksson P 2004 Oxidised-HDL induces the expression of PAI-1 in human endothelial cells. Role of p38MAPK activation and mRNA stabilization. Br J Haematol 127:97–104 18. Norata GD, Callegari E, Inoue H, Catapano AL 2004 HDL3 induces cyclooxygenase-2 expression and prostacyclin release in human endothelial cells via a p38 MAPK/CRE-dependent pathway: effects on COX-2/PGI-synthase coupling. Arterioscler Thromb Vasc Biol 24:871– 877 19. Norata GD, Callegari E, Marchesi M, Chiesa G, Eriksson P, Catapano AL 2005 High-density lipoproteins induce transforming growth factor-␤2 expression in endothelial cells. Circulation 111:2805–2811 20. Pirillo A, Norata GD, Zanelli T, Catapano AL 2001 Overexpression of inducible heat shock protein 70 in Cos-1 cells fails to protect from cytotoxicity of oxidized LDLs. Arterioscler Thromb Vasc Biol 21:348 –354 21. Inoue H, Taba Y, Miwa Y, Yokota C, Miyagi M, Sasaguri T 2002 Transcriptional and posttranscriptional regulation of cyclooxygenase-2 expression by fluid shear stress in vascular endothelial cells. Arterioscler Thromb Vasc Biol 22:1415–1420 22. Ricote M, Li AC, Willson TM, Kelly CJ, Glass CK 1998 The peroxisome proliferator-activated receptor-␥ is a negative regulator of macrophage activation. Nature 391:79 – 82 23. Loudon JA, Elliott CL, Hills F, Bennett PR 2003 Progesterone represses interleukin-8 and cyclo-oxygenase-2 in human lower segment fibroblast cells and amnion epithelial cells. Biol Reprod 69:331–337 24. Weber C, Schober A, Zernecke A 2004 Chemokines: key regulators of mononuclear cell recruitment in atherosclerotic vascular disease. Arterioscler Thromb Vasc Biol 24:1997–2008 25. Linton MF, Fazio S 2004 Cyclooxygenase-2 and inflammation in atherosclerosis. Curr Opin Pharmacol 4:116 –123 26. Muller M, van den Beld AW, Bots ML, Grobbee DE, Lamberts SW, van der Schouw YT 2004 Endogenous sex hormones and progression of carotid atherosclerosis in elderly men. Circulation 109:2074 –2079 27. Resta O, Foschino Barbaro MP, Bonfitto P, Giliberti T, Depalo A, Pannacciulli N, De Pergola G 2003 Low sleep quality and daytime sleepiness in obese patients without obstructive sleep apnoea syndrome. J Intern Med 253:536 –543 28. Malkin CJ, Pugh PJ, Jones RD, Kapoor D, Channer KS, Jones TH 2004 The

554

29. 30.

31.

32.

33. 34.

35.


effect of testosterone replacement on endogenous inflammatory cytokines and lipid profiles in hypogonadal men. J Clin Endocrinol Metab 89:3313–3318 Tedgui A, Mallat Z 2001 Anti-inflammatory mechanisms in the vascular wall. Circ Res 88:877– 887 Mukherjee TK, Dinh H, Chaudhuri G, Nathan L 2002 Testosterone attenuates expression of vascular cell adhesion molecule-1 by conversion to estradiol by aromatase in endothelial cells: implications in atherosclerosis. Proc Natl Acad Sci USA 99:4055– 4060 McCrohon JA, Jessup W, Handelsman DJ, Celermajer DS 1999 Androgen exposure increases human monocyte adhesion to vascular endothelium and endothelial cell expression of vascular cell adhesion molecule-1. Circulation 99:2317–2322 Death AK, McGrath KC, Sader MA, Nakhla S, Jessup W, Handelsman DJ, Celermajer DS 2004 Dihydrotestosterone promotes vascular cell adhesion molecule-1 expression in male human endothelial cells via a nuclear factor␬B-dependent pathway. Endocrinology 145:1889 –1897 Poletti A, Melcangi RC, Negri-Cesi P, Maggi R, Martini L 1994 Steroid binding and metabolism in the luteinizing hormone-releasing hormone-producing neuronal cell line GT1–1. Endocrinology 135:2623–2628 Rosano GM, Leonardo F, Pagnotta P, Pelliccia F, Panina G, Cerquetani E, della Monica PL, Bonfigli B, Volpe M, Chierchia SL 1999 Acute anti-ischemic effect of testosterone in men with coronary artery disease. Circulation 99: 1666 –1670 English KM, Steeds RP, Jones TH, Diver MJ, Channer KS 2000 Low-dose


36.

37.

38.

39.

40.

transdermal testosterone therapy improves angina threshold in men with chronic stable angina: a randomized, double-blind, placebo-controlled study. Circulation 102:1906 –1911 De Pergola G, De Mitrio V, Sciaraffia M, Pannacciulli N, Minenna A, Giorgino F, Petronelli M, Laudadio E, Giorgino R 1997 Lower androgenicity is associated with higher plasma levels of prothrombotic factors irrespective of age, obesity, body fat distribution, and related metabolic parameters in men. Metabolism 46:1287–1293 Hafezi-Moghadam A, Simoncini T, Yang Z, Limbourg FP, Plumier JC, Rebsamen MC, Hsieh CM, Chui DS, Thomas KL, Prorock AJ, Laubach VE, Moskowitz MA, French BA, Ley K, Liao JK 2002 Acute cardiovascular protective effects of corticosteroids are mediated by non-transcriptional activation of endothelial nitric oxide synthase. Nat Med 8:473– 479 Simoncini T, Rabkin E, Liao JK 2003 Molecular basis of cell membrane estrogen receptor interaction with phosphatidylinositol 3-kinase in endothelial cells. Arterioscler Thromb Vasc Biol 23:198 –203 Simoncini T, Maffei S, Basta G, Barsacchi G, Genazzani AR, Liao JK, De Caterina R 2000 Estrogens and glucocorticoids inhibit endothelial vascular cell adhesion molecule-1 expression by different transcriptional mechanisms. Circ Res 87:19 –25 Dalal M, Kim S, Voskuhl RR 1997 Testosterone therapy ameliorates experimental autoimmune encephalomyelitis and induces a T helper 2 bias in the autoantigen-specific T lymphocyte response. J Immunol 159:3– 6

JCEM is published monthly by The Endocrine Society (http://www.endo-society.org), the foremost professional society serving the endocrine community.