ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Mar. 2006, p. 1075–1078 0066-4804/06/$08.00⫹0 doi:10.1128/AAC.50.3.1075–1078.2006 Copyright © 2006, American Society for Microbiology. All Rights Reserved.
Vol. 50, No. 3
Molecular Characterization of Isoniazid Resistance in Mycobacterium tuberculosis: Identification of a Novel Mutation in inhA E. T. Y. Leung, P. L. Ho, K. Y. Yuen, W. L. Woo, T. H. Lam, R. Y. Kao, W. H. Seto, and W. C. Yam* Department of Microbiology, Queen Mary Hospital, The University of Hong Kong, Pokfulam, Hong Kong SAR, China Received 22 September 2005/Returned for modification 25 October 2005/Accepted 8 December 2005
Multiplex allele-specific PCRs detecting katG codon 315 and mabA (bp ⴚ15) mutations could specifically identify 77.5% of isoniazid-resistant Mycobacterium tuberculosis strains in the South China region. One clinical isolate harboring InhA Ile194Thr was characterized to show strong association with isoniazid resistance in Mycobacterium tuberculosis. MabA⫹336R (5⬘-GTTGGCGTTGATGACCTTCTC-3⬘) was used with the same cycling conditions as those for katG MASPCR. For wild-type strains, two fragments of 451 bp and 119 bp were amplified, while a single 451-bp fragment was amplified for mutants (Fig. 1b). Performance of mabA MAS-PCR was verified by DNA sequencing of 100 randomly selected isolates (50 susceptible and 50 resistant) using an ABI3700 genetic sequencer (Applied Biosystems) as described previously (21). Sequencing primers used for different gene loci are listed in Table 1. Both wild-type and Ile194Thr InhA proteins were expressed for kinetic analysis using the pET-15b expression vector (Novagen, Madison, Wis.) and Escherichia coli BL21(DE3) as the host. All kinetic reactions were carried out in 30 mM piperazine-N,N⬘-bis(2-ethanesulfonic acid) (PIPES) buffer, pH 6.8, using 2-trans-hexadecenyl coenzyme A as a substrate, at 25°C (3, 14). Following NADH oxidation at A340, steady-state Km values for NADH were determined with variable concentrations of NADH at fixed saturating concentrations of the substrate. The experiment was repeated with three separate preparations of purified recombinant proteins. Data were fitted to a Michaelis-Menten equation and plotted in Lineweaver-Burk reciprocal form with GraphPad Prism v4.0 software to generate estimates of Km and Vmax values. Among 375 clinical isolates, 371 were successfully amplified by katG and mabA MAS-PCR assays. Four INHR isolates previously identified as catalase negative (9) were positive only by mabA MAS-PCR. Fifty-two of the 102 resistant isolates exhibited katG codon 315 alteration (Fig. 2a). The remaining 50 resistant isolates, as well as the 273 susceptible isolates, showed no mutation in katG codon 315. The findings completely agree with our previous antimycobacterial susceptibility testing, PCR-RFLP, and DNA sequencing results (9). With mabA MAS-PCR, 32 of 102 resistant isolates were identified as having a mutation in mabA bp ⫺15 (Fig. 2b). The remaining 70 resistant isolates and the 273 susceptible isolates exhibited no mutation in the corresponding region. The results also agree with DNA sequencing results of 100 randomly selected isolates (50 resistant and 50 susceptible). Further analysis revealed that 79 (77.5%) resistant isolates carried one or both of the mutations with 100% specificity. The remaining 22.5% may harbor mutations in other regions of katG and inhA associated with
Tuberculosis (TB) remains a public health issue in many parts of the world (20). The situation is further complicated by the emergence of multidrug-resistant TB (18). Multidrug-resistant TB is recognized as infection with Mycobacterium tuberculosis resistant to at least isoniazid (INH) and rifampin. Mutations in dispersed gene loci including katG (catalaseperoxidase), the promoter region of ahpC (alkyl hydroperoxidase), inhA (enoyl-acyl reductase), kasA (-ketoacyl ACP synthase), mabA (3-ketoacyl reductase), and ndh (NADH dehydrogenase) have been found to be associated with INH resistance (2, 4, 7, 10–11, 22). Our previous study using PCR with restriction fragment length polymorphism (PCR-RFLP) to detect the KatG amino acid substitution Ser315Thr successfully identified 51% of INHR M. tuberculosis strains among 375 clinical isolates from the South China region (9). In the present study, a multiplex allele-specific PCR (MAS-PCR) was used to detect mutations in mabA (bp ⫺15) of our clinical isolates. The potential use of mabA and katG MAS-PCRs (12) for rapid diagnosis of INHR M. tuberculosis was evaluated. INHR isolates negative for katG 315 alterations were subsequently subjected to DNA sequencing of various gene loci associated with INH resistance. A novel mutation in inhA was characterized to elucidate non-katG-related resistance mechanisms. Three hundred seventy-five M. tuberculosis isolates collected from patients suffering from tuberculosis in Hong Kong and the South China region between 1999 and 2002 were tested for susceptibility to the antimycobacterial agent INH by using 7H10 medium containing INH at 0.2 or 1.0 g/ml (9, 13). Mycobacterial DNA was extracted as described previously (19). The KatG MAS-PCR protocol was essentially adopted from the work of Mokrousov et al. (12). A mutation at codon 315 would yield an amplicon of 435 bp (Fig. 1a), and wild-type katG would yield a smaller amplicon of 293 bp. For mabA MAS-PCR, 30 pmol of each of the designed primers MabA⫺115F (5⬘-ACAAACGTCACGAGCGTAACC-3⬘), MabA⫹4R (5⬘-TCACCCCGAGAHCCTATCG-3⬘), and
* Corresponding author. Mailing address: Department of Microbiology, 4/F, University Pathology Bldg., Queen Mary Hospital, The University of Hong Kong, Pokfulam, Hong Kong, China. Phone: 852 2855 4821. Fax: 852 2855 1241. E-mail:
[email protected]. 1075
1076
NOTES
ANTIMICROB. AGENTS CHEMOTHER.
FIG. 1. Schematic diagrams of KatG (a) and MabA (b) MASPCRs.
INH resistance. A similar attempt by Herrera-Leo ´n et al. using MAS-PCR identified 68.4% of Inhr strains in Spain (6). DNA sequencing of various gene loci for the 50 INHR isolates negative for katG codon 315 alteration revealed single
point mutations in eight catalase-positive and INHR isolates, among which seven strains exhibited point mutations upstream of ahpC, with the DNA sequence of the coding region unaltered. Previous studies showed that mutations in promoter regions of ahpC in INH-resistant M. tuberculosis could overexpress alkyl hydroperoxidase to combat oxidative damage. Such overexpression does not directly relate to the initiation of INH resistance (1, 5, 8). The MIC of INH for the last strain was ⬎1.0 g/ml, and there was a point mutation at bp 581 of inhA (GenBank accession no. AF06077) causing the amino acid substitution Ile194Thr (ATC3ACC). Compared with wild-type InhA of H37Rv (ATCC 27294), purified protein with Ile194Thr showed a 5-fold increase in Km without a significant increase (1.3-fold only) in Vmax (Table 2 and Fig. 3). The high Km suggested that under cellular concentrations of NADH, Ile194Thr affects the binding of NADH to the enzyme and decreases the rate of reaction. Unless a very high concentration of NADH is available, which is unlikely, since the cellular concentration of NADH is less than 10 M (14), the reaction rate cannot be raised to normal wild-type levels. This finding is also consistent with previous X-ray crystallography data (http://au.expasy.org) showing that isoleucine 194 lies within the binding cleft of the enzyme and in close proximity with the oxygen atom of NADH (16). It is likely that isoleucine 194 participates in hydrogen bonding with the docked NADH. Recently, molecular dynamics simulations also showed Ile194 as 1 of the 10 most important amino acid residues making conserved H bonds with NADH cofactor in wild-type InhA protein (17). It is quite
TABLE 1. Primers used for DNA sequencing Gene locus (size [bp])
katG (2,223)
inhA (810)
kasA (1,251)
mabA (744) ndh (1,392)
oxyR-ahpC (107)
Primer, sequence
Position in reference to start codon (bp)
katG-1F, 5⬘CTTCGGGATCACATCCGTG3⬘ katG-1R, 5⬘AAGCGGCGCGAACCGCTGC3⬘ katG-2F, 5⬘GGCATGCAGCGGTTCGCGC3⬘ katG-2R, 5⬘ACGTCTCGCGAATGTCGAC3⬘ katG-3F, 5⬘CGCGGCGGTCGACATTCG3⬘ katG-3R, 5⬘GAACGGGTCCGGGATGGTG3⬘ katG-4F, 5⬘GTTCGGCGGGCCAGGGCGC3⬘ katG-4R, 5⬘CTGCAGGCGGATGCGACCACC3⬘ katG-5F, 5⬘CGCCAACGGTGGTCGCATC3⬘ katG-5R, 5⬘GCGCACGTCGAACCTGTCG3⬘ inhA-1F, 5⬘GCATGGGTATGGGCCACTGACACAAC3⬘ inhA-2F, 5⬘CGGGTGACCGAGGCGATCG3⬘ inhA-3F, 5⬘CCACATCTCGGCGTATTCG3⬘ inhA-4R, 5⬘GACCGTCATCCAGTTGTAG3⬘ inhA-5R, 5⬘TTCCGGTCCGCCGAACGACAG3⬘ kasA-1F, 5⬘GGCGAGGCTTGAGGCCGAGTCC3⬘ kasA-2F, 5⬘GTCGAGAGAGCTACGACCTGATGAATG3⬘ kasA-3F, 5⬘GCCAAGCCGTTGGCCCGATTGCTG3⬘ kasA-4R, 5⬘CGACCCGCGATGTCGTGCTTC3⬘ mabA-1F, 5⬘GTTACGCTCGTGGACATAC3⬘ mabA-2R, 5⬘CTGCATGCTGCGCGATG3⬘ mabA-3R, 5⬘GATTCCGCTAACCAGAATC3⬘ ndh-1F, 5⬘CACTGAGTACCTGGCAGGCTGAC3⬘ ndh-2F, 5⬘GTCGAAGTACTGGAATGGCTC3⬘ ndh-3F, 5⬘TGGACAGGTCGGGCAGCAC3⬘ ndh-4F, 5⬘CAACTCCAACGCGTCGTCGATG3⬘ ndh-5R, 5⬘GCAATGTCCAGGTACTGTTG3⬘ ndh-6R, 5⬘AGCTAACTGAACTCGCTCATCGAG3⬘ oxyR-ahpC-F, 5⬘CCGCAACGTCGACTGGCTCA3⬘ oxyR-ahpC-R, 5⬘ATTGATCGCCAATGGTTAGC3⬘
⫺57 to ⫺39 396 to 378 373 to 391 754 to 736 729 to 746 1104 to 1096 1101 to 1119 1500 to 1480 1473 to 1491 2220 to 2202 ⫺38 to ⫺13 250 to 268 381 to 399 510 to 492 860 to 840 ⫺24 to ⫺3 365 to 391 775 to 798 1270 to 1250 ⫺59 to ⫺41 384 to 368 807 to 789 ⫺40 to ⫺18 295 to 315 462 to 480 952 to 973 1154 to 1135 1441 to 1418 398 to 417(oxyR) 28 to 9 (ahpC)
VOL. 50, 2006
NOTES
1077
FIG. 2. MAS-PCR for Mycobacterium tuberculosis. (a) Gel electrophoresis patterns of katG MAS-PCR for M. tuberculosis. Lanes: 4, 5, 6, 7, 9, and 11, strains with katG 315 alteration; 1, 2, 3, 8, and 10, strains with the katG 315 wild-type allele; 12, M. tuberculosis H37Rv; 13, sterile distilled water; M, GeneRuler 100-bp DNA ladder. (b) Gel electrophoresis patterns of mabA MAS-PCR for M. tuberculosis. Lanes: 1, 5, 6, 8, and 9, strains with a ⫺15 C3T substitution in the promoter region of the mabA gene; 2, 3, 4, 7, and 10, strains with the mabA ⫺15 wild-type allele; 11, M. tuberculosis H37Rv; 12, sterile distilled water; M, GeneRuler 100-bp DNA ladder.
likely that substitution of the isoleucine alkyl chain with a hydroxyl group of threonine disrupts the hydrogen bond pattern around NADH and reduces the affinity of NADH to InhA. Subsequently, a larger proportion of the cellular InhA molecules would be left in the non-NADH-bound form as a result of the lowered affinity. According to Rozwarski et al. (16), InhA in its NADH-bound form is more susceptible to the attack of activated INH than in its free molecule form. A lowered affinity of NADH therefore protects most of the InhA molecules from INH. Alternatively, if Ile194Thr InhA has a decreased affinity with NADH, its affinity with NADH-isonicotinic adduct will also be reduced. According to Rawat et al. (15), activated INH can bind with free NADH, forming an adduct molecule to block the enzymatic reaction of InhA even if InhA is in its non-NADH-bound form. Lowered affinity with NADH-isonicotinic adduct promotes the release of the adduct
TABLE 2. Steady-state kinetic parameters of Mycobacterium tuberculosis wild-type and mutant InhA
Wild-type InhA
Ile194Thr InhA
Fold difference from wild type
5.8 ⫾ 0.13 6.9 ⫾ 0.5
7.8 ⫾ 0.5 38.6 ⫾ 5.0
1.3 5.59
Value for: Parameter
Vmax (U/mg) NADH Km (M)
FIG. 3. Enzyme kinetics determination for the InhA protein of Mycobacterium tuberculosis. (a) Michaelis-Menten plot of kinetic data; (b) Lineweaver-Burk reciprocal plot of kinetic data.
from the enzyme and allows normal substrate catalysis to proceed. Either scenario could result in INH resistance in this mutant with a wild-type katG sequence. This study evaluated a MAS-PCR protocol suitable for rapid diagnosis of INHR M. tuberculosis. The enzyme kinetics study of an Ile194Thr mutant opens a path to better understanding of the molecular basis of non-katG-related INH resistance mechanisms. This work is supported by research grants from the Research Fund for Control of Infectious Diseases of the Health, Welfare, and Food Bureau of the Hong Kong SAR Government. REFERENCES 1. Baker, L. V., T. J. Brown, O. Maxwell, A. L. Gibson, Z. Fang, M. D. Yates, and F. A. Drobniewski. 2005. Molecular analysis of isoniazid-resistant Mycobacterium tuberculosis isolates from England and Wales reveals the phylogenetic significance of the ahpC ⫺46A polymorphism. Antimicrob. Agents Chemother. 49:1455–1464. 2. Banerjee, A., E. Dubnau, A. Quemard, V. Balasubramanian, K. S. Um, T. Wilson, D. Collins, G. de Lisle, and W. R. Jacobs, Jr. 1994. inhA, a gene encoding a target for isoniazid and ethionamide in Mycobacterium tuberculosis. Science 263:227–230. 3. Basso, L. A., R. Zheng, J. M. Musser, W. R. Jacobs, Jr., and J. S. Blanchard. 1998. Mechanisms of isoniazid resistance in Mycobacterium tuberculosis: enzymatic characterization of enoyl reductase mutants identified in isoniazidresistant clinical isolates. J. Infect. Dis. 178:769–775. 4. Ducasse-Cabanot, S., M. Cohen-Gonsaud, H. Marrakchi, M. Nguyen, D.
1078
5.
6.
7. 8.
9.
10.
11.
12.
13.
NOTES
Zerbib, J. Bernadou, M. Daffe, G. Labesse, and A. Quemard. 2004. In vitro inhibition of the Mycobacterium tuberculosis -ketoacyl-acyl carrier protein reductase MabA by isoniazid. Antimicrob. Agents Chemother. 48:242–249. Gomes-Guimaraes, B., H. Souchon, N. Honore, B. Saint-Joanis, R. Brosch, W. Shepard, S. T. Cole, and P. M. Alzari. 2005. Structure and mechanism of the alkyl hydroperoxidase AhpC, a key element of the Mycobacterium tuberculosis defense system against oxidative stress. J. Biol. Chem. 280:25735– 25742. Herrera-Leo ´n, L., T. Molina, P. Saı´z, J. A. Sa ´ez-Nieto, and M. Soledad Jime´nez. 2005. New multiplex PCR for rapid detection of isoniazid-resistant Mycobacterium tuberculosis clinical isolates. Antimicrob. Agents Chemother. 49:144–147. Kelley, C. L., D. A. Rouse, and S. L. Morris. 1997. Analysis of ahpC gene mutations in isoniazid-resistant clinical isolates of Mycobacterium tuberculosis. Antimicrob. Agents Chemother. 41:2057–2058. Koshkin, A., X. T. Zhou, C. N. Kraus, J. M. Brenner, P. Bandyopadhyay, I. D. Kuntz, C. E. Barry III, and P. R. Ortiz de Montellano. 2004. Inhibition of Mycobacterium tuberculosis AhpD, an element of the peroxiredoxin defense against oxidative stress. Antimicrob. Agents Chemother. 48:2424–2430. Leung, E. T., K. M. Kam, A. Chiu, P. L. Ho, W. H. Seto, K. Y. Yuen, and W. C. Yam. 2003. Detection of katG Ser315Thr substitution in respiratory specimens from patients with isoniazid-resistant Mycobacterium tuberculosis using PCR-RFLP. J. Med. Microbiol. 52:999–1003. Mdluli, K., R. A. Slayden, Y. Zhu, S. Ramaswamy, X. Pan, D. Mead, D. D. Crane, J. M. Musser, and C. E. Barry III. 1998. Inhibition of a Mycobacterium tuberculosis -ketoacyl ACP synthase by isoniazid. Science 280:1607– 1610. Miesel, L., T. R. Weisbrod, J. A. Marcinkeviciene, R. Bittman, and W. R. Jacobs, Jr. 1998. NADH dehydrogenase defects confer isoniazid resistance and conditional lethality in Mycobacterium smegmatis. J. Bacteriol. 180:2459– 2467. Mokrousov, I., T. Otten, M. Filipenko, A. Vyazovaya, E. Chrapov, E. Limeschenko, L. Steklova, B. Vyshnevskiy, and O. Narvskaya. 2002. Detection of isoniazid-resistant Mycobacterium tuberculosis strains by a multiplex allelespecific PCR assay targeting katG codon 315 variation. J. Clin. Microbiol. 40:2509–2512. NCCLS. 2000. Susceptibility testing of mycobacteria, nocardia and other
ANTIMICROB. AGENTS CHEMOTHER.
14.
15.
16. 17.
18.
19.
20. 21.
22.
aerobic actinomycetes. Tentative standard MT24-T2, vol. 20, 26. NCCLS, Wayne, Pa. Que´mard, A., J. C. Sacchettini, A. Dessen, C. Vilche`zes, R. Bittman, W. R. Jacobs, Jr., and J. S. Blanchard. 1995. Enzymatic characterization of the target for isoniazid in Mycobacterium tuberculosis. Biochemistry 34:8235– 8241. Rawat, R., A. Whitty, and P. J. Tonge. 2003. The isoniazid-NAD adduct is a slow, tight-binding inhibitor of InhA, the Mycobacterium tuberculosis enoyl reductase: adduct affinity and drug resistance. Proc. Natl. Acad. Sci. USA 100:13881–13886. Rozwarski, D. A., G. A. Grant, D. H. R. Barton, W. R. Jacobs, Jr., and J. C. Sacchettini. 1998. Modification of the NADH of the isoniazid target (InhA) from Mycobacterium tuberculosis. Science 279:98–102. Schroeder, E. K., L. A. Basso, D. S. Santos, and O. N. de Souza. 2005. Molecular dynamics simulation studies of the wild-type, I21V, and I16T mutants of isoniazid-resistant Mycobacterium tuberculosis enoyl reductase (InhA) in complex with NADH: toward the understanding of NADH-InhA different affinities. Biophys. J. 89:876–884. Toungoussova, O., P. Sandven, A. Mariandyshev, N. Nizovtseva, G. Bjune, and D. A. Caugant. 2002. Spread of drug-resistant Mycobacterium tuberculosis strains of the Beijing genotype in the Archangel Oblast, Russia. J. Clin. Microbiol. 40:1930–1937. Woo, P. C., K. H. Ng, S. K. Lau, K. T. Yip, A. M. Fung, K. W. Leung, D. M. Tam, T. L. Que, and K. Y. Yuen. 2003. Usefulness of the MicroSeq 500 16S ribosomal DNA-based bacterial identification system for identification of clinically significant bacterial isolates with ambiguous biochemical profiles. J. Clin. Microbiol. 41:1996–2001. World Health Organization. 2005. Global tuberculosis control—surveillance, planning, financing. WHO/HTM/TB/2005.349. World Health Organization, Geneva, Switzerland. Yam, W. C., C. M. Tam, C. C. Leung, H. L. Tong, K. H. Chan, E. T. Leung, K. C. Wong, W. W. Yew, W. H. Seto, K. Y. Yuen, and P. L. Ho. 2004. Direct detection of rifampin-resistant Mycobacterium tuberculosis in respiratory specimens by PCR-DNA sequencing. J. Clin. Microbiol. 42:4438–4443. Zhang, Y., B. Heym, B. Allen, D. Young, and S. Cole. 1992. The catalaseperoxidase gene and isoniazid resistance of Mycobacterium tuberculosis. Nature 358:591–593.
