Pneumocystis jirovecii Pneumonia in Systemic Lupus ...

ORIGINAL ARTICLE

Pneumocystis jirovecii Pneumonia in Systemic Lupus Erythematosus From Southern Taiwan Chia-Tse Weng, MD,* Ming-Fei Liu, MD,* Meng-Yu Weng, MD,* Nan-Yao Lee, MD,Þ Ming-Chang Wang, MD,þ Wei-Chieh Lin, MD, PhD,§ Chih-Ying Ou, MD,|| Wu-Wei Lai, MD,¶ Shiang-Chin Hsu, MD,# Sheau-Chiou Chao, MD,** Ta-Jung Chung, MD,ÞÞ Chung-Ta Lee, MD,þþ Chi-Chang Shieh, MD, PhD,§§ Jiu-Yao Wang, MD, PhD,§§ and Chrong-Reen Wang, MD, PhD*

Background: Opportunistic infection has been documented in systemic lupus erythematosus with special attention paid to Pneumocystis jirovecii because of the significant morbidity and high mortality. Objectives: The limited large-scale investigations covering P. jirovecii pneumonia (PCP) in systemic lupus erythematosus following biologics or immunosuppressants therapy prompted us to perform this study in southern Taiwan. Methods: A retrospective study was completed in 858 hospitalized lupus patients from January 2000 to December 2011. The definite diagnosis of PCP was made by the laboratory detection of Pneumocystis organisms together with consistent clinical and radiological manifestations of PCP. Positive polymerase chain reaction results of sputum samples were not regarded as infection in this study, unless P. jirovecii was the sole pathogen found and pulmonary manifestations resolved following antibiotics for PCP treatment alone. Results: The laboratory identification of Pneumocystis organisms depended on lung biopsy in 2 cases and bronchoalveolar lavage in 3 patients. Five cases, 2 women and 3 men aged 30 to 50 years (41.8 T 8.8 years), were identified with a 0.6% incidence. None received chemoprophylactics against P. jirovecii infection. All had lupus nephritis and lymphopenia with low CD4+ T-cell counts. Prior usages of higher daily prednisolone dosages and concomitant biologics or immunosuppressants were observed in all patients. Pneumocystis jirovecii pneumonia contributed to a high mortality rate (60%). Conclusions: We report the rare occurrence but high mortality of PCP infection in this study. A consensus guideline addressing prophylactic antibiotics against Pneumocystis organisms in highest-risk lupus patients on biologics or immunosuppressants could be helpful in guiding their management. Key Words: biologics, immunosuppressants, Pneumocystis jirovecii pneumonia, prophylactic antibiotics, systemic lupus erythematosus (J Clin Rheumatol 2013;19: 252Y258)

P

neumocystis jirovecii pneumonia (PCP), a cause of pneumonia in immunocompromised patients, has gained attention

From the Sections of *Rheumatology and Immunology, †Infectious Disease, ‡Nephrology, §Critical Care Medicine, ||Chest Medicine, Department of Internal Medicine, and Departments of ¶Surgery, #Emergency Medicine, **Dermatology, ††Radiology, ‡‡Pathology, and §§Pediatrics, National Cheng Kung University Hospital and Dou-Liou Branch, Tainan, Taiwan, Republic of China. The authors declare no conflict of interest. Correspondence: Chrong-Reen Wang, MD, PhD, Section of Rheumatology and Immunology, Department of Internal Medicine, College of Medicine, National Cheng Kung University, 1 University Rd, Tainan 70101, Taiwan, Republic of China. E-mail: [email protected]; [email protected]. Copyright * 2013 by Lippincott Williams & Wilkins ISSN: 1076-1608/13/1905Y0252 DOI: 10.1097/RHU.0b013e31829d5017

252

www.jclinrheum.com

in the era of the human immunodeficiency virus (HIV) epidemic.1 Despite the usages of effective antiretroviral agents, PCP remains a leading opportunistic infection in patients with acquired immunodeficiency syndrome (AIDS). Notably, the overall incidence of P. jirovecii infection in HIV-negative individuals has increased, and there are numerous reports of PCP in connective tissue diseases (CTDs) and other autoimmune diseases, a growing occurrence due to the prescription of biologics and immunosuppressants with expanding indications.2Y4 With the substantial morbidity and considerable mortality, P. jirovecii infection is particularly a matter of concern in systemic lupus erythematosus (SLE) on cyclophosphamide treatment, and such patients constitute the highest portion with the greatest risk of inhospital mortality among miscellaneous CTD.5,6 Nevertheless, large-scale prospective or retrospective investigations of PCP in SLE following therapy with biologics or immunosuppressants are still limited. The risk of P. jirovecii infection has been increased in rheumatoid arthritis (RA) receiving tumor necrosis factor > antagonists, and the need for antibiotic prophylaxis is emphasized in patients at risk.3 Recently developed monoclonal antibodies targeting B cells (anti-CD20) are known to predispose patients with hematologic malignancies and solid organ transplantation to PCP.4 Rituximab (anti-CD20) is an effective treatment in intractable CTD, and it has been suggested to be considered in lupus patients whose nephritis fails to improve or worsens after 1 induction therapy or fail both cyclophosphamide and mycophenolate mofetil (MMF) treatment according to the 2012 American College of Rheumatology guidelines.7 Cases of PCP in RA, granulomatosis with polyangiitis, and SLE receiving such a therapy have been reported recently.8Y10 There is a high incidence and prevalence of lupus patients with characteristic presentations and widespread usages of biologics and immunosuppressants in Taiwan.11 A 12-year retrospective study of PCP in SLE was completed in 858 hospitalized patients at the National Cheng Kung University Hospital, a medical center located in southern Taiwan.12 Their demographic information, clinical characteristics, radiological images, and laboratory data were analyzed in detail.

MATERIALS AND METHODS Patients A retrospective review of medical records was performed in patients with lupus who were admitted to the National Cheng Kung University Hospital from January 2000 to December 2011. All patients who fulfilled the American College of Rheumatology Revised Criteria for SLE Classification were included.13 Demographic information, clinical characteristics, radiological images, and laboratory data in lupus patients with PCP were analyzed, including age and sex, associated medical conditions, disease activity (Systemic Lupus Erythematosus Disease Activity Index

JCR: Journal of Clinical Rheumatology

&

Volume 19, Number 5, August 2013

Copyright © 2013 Lippincott Williams & Wilkins. Unauthorized reproduction of this article is prohibited.


&


2000 [SLEDAI-2K]),14 blood and urine examinations, chest x-ray and computed tomography (CT), and medication profiles over a 3-month period before the onset of PCP including antibiotics for P. jirovecii infection, corticosteroid, biologics (rituximab), and immunosuppressants such as azathioprine, cyclophosphamide, cyclosporin A, methotrexate, and MMF. The dosages of various preparations of corticosteroid were converted to average daily prednisolone equivalents adjusted with body weight (in mg/kg per day). Permissions were obtained from our institutional review board for this study.

PCP in SLE From Southern Taiwan

The definite diagnosis of PCP was made only in those patients with the laboratory identification of Pneumocystis organisms as the pathogen and consistent clinical and radiological manifestations. Positive PCR results of sputum specimens were not considered as clinical infection in this study, unless P. jirovecii was the sole pathogen found and pulmonary manifestations resolved upon antibiotics for PCP treatment alone. In fact, there is a high prevalence of subclinical colonization of Pneumocystis organisms in systemic autoimmune diseases, and respiratory asymptomatic patients with positive PCR results of P. jirovecii in their sputum samples have not developed PCP even after a long-term clinical follow-up.16

Diagnosis of PCP Laboratory diagnosis of P. jirovecii infection was performed by microscopic demonstration of Pneumocystis organisms in specimens of lung biopsy, bronchoalveolar lavage (BAL) fluid, or hypertonic salineYinduced sputum with Gomori methenamine silver stain and Diff-Quick stain for visualization of cysts and trophozoites, respectively. Although the laboratory diagnosis relies on the microscopic examination, PCP in patients without AIDS has been reported to possess lower burden of Pneumocystis organisms, leading to difficulties in their detection.2 The polymerase chain reaction (PCR) method has been developed to improve the diagnostic sensitivity in such patients; however, a higher sensitivity but lower specificity has been noted in the conventional PCR.15 In this study, we used the most specific and highly sensitive mtLSUrRNA nested PCR method for detection of P. jirovecii in the samples of BAL fluid or sputum. Primers for the first round of the nested PCR are pAZ102-E (GATGGCTGTT TCCAAGCCCA) and pAZ102-H (GTGTACGTTGCAAAGTA CTC) that amplify a 346-base-pair fragment, and those for the second round are pAZ102-X (GTGAAATACAAATCGGACTA GG) and pAZ102-Y (TCACTTAATATTAATTGGGGAGC) with a final 260-base-pair PCR product.

RESULTS Five patients achieved the definite diagnosis of PCP (a 0.6% incidence in 858 hospitalized lupus patients). Table 1 demonstrates the reported larger-scale studies on lupus patients (total number 950) with PCP from different geographical areas in the recent 2 decades.5,6,17Y32 Notably, PCP in SLE has rarely been reported in Chinese (0%Y0.7% incidence), and our study has the largest total number of lupus patients from a single institute. Demographic information, clinical characteristics, radiological images, and laboratory data of our cases are shown in Table 2. There were 2 women and 3 men, aged 35 to 50 years (41.8 T 8.8 years), with clinical presentations of dyspnea and dry cough. Fever was present in 3 patients. Disease duration from the onset of SLE to PCP varied from 0.5 to 13 years (4.5 T 5.3 years). Human immunodeficiency virus infection was not identified. None of our patients had received chemoprophylactics against Pneumocystis organisms. All cases had lupus nephritisYassociated proteinuria and impaired glomerular filtration rate (creatinine clearance rate). Biopsy findings of class IV were noted in patients 4 and 5. Higher disease activity (SLEDAI-2K Q6) was found in

TABLE 1. Reported Larger-Scale Studies on Lupus Patients With PCP in Different Geographical Areas Since 1992 Serial No.

Geographical Location

Publication YearReference

Type of Study

Total No. Patients in Studya

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18

Malaysia France United States Japan United States Korea Hong Kong France Canada United States United States Hong Kong China Spain Thailand Argentina Thailand Taiwan

199218 199419 19965 199620 19996 199921 200022 200123 200224 200525 200526 200627 200628 200629 200730 200931 201132 Present study

S, R S, R S, R S, R M, R S, R S, R S, R S, R S, P M, P S, P S, R S, P S, R S, A S, R S, R

351 750 100 59 72,816 544 186 87 363 59 140 212 283 110 542 90 119 858

PCP Incidence, n (%) 9 6 3 1 94 0 0 0 3 1 0 0 2 2 2 1 3 5

(2.56) (0.80) (3.0) (1.69) (0.13) (0) (0) (0) (0.83) (1.69) (0) (0) (0.71) (1.81) (0.37) (1.11) (2.52) (0.58)

a

Published reports with total patient number of more than 50 were selected in this table. A indicates autopsy; M, multiple hospitals; P, prospective; R, retrospective; S, single institute.

* 2013 Lippincott Williams & Wilkins

www.jclinrheum.com


253

254

www.jclinrheum.com

Death, multiorgan septic failure possibly related to PCP

TMP/SMX (rash), C/P

Death, multiorgan septic failure possibly related to PCP

TMP/SMX

BAL fluid, staining of organisms 0.67 MMF 1.5 g/d

3 48 y, Male 0.8 Fever, dyspnea, dry cough Nil Nephrotic syndrome 1.3/62 4 98/19 54 Ground-glass opacities

TMP/SMX (worsening renal function), C/P Recovery and survived

4 35 y, Female 2 Fever, dyspnea, dry cough Nil Nephrotic syndrome (IV) 6.5/72 9 79/NA 66 Ground-glass opacities, patchy consolidations BAL fluid, mtLSUrRNA nested PCR 0.75 CY monthly pulse 0.5 g/m2

Recovery and survived

5 50 y, Female 6 Dyspnea, dry cough Nil Nephrotic syndrome (IV) 5.1/58 4 949/126 57 Ground-glass opacities, pneumothorax BAL fluid, mtLSUrRNA nested PCR 0.89 CY monthly pulse 0.5 g/m2, MMF 1 g/d TMP/SMX (thrombocytopenia), C/P

&

CCr indicates creatinine clearance rate (in mL/min); CY, cyclophosphamide; NA, not available.

Outcome

Antibiotics for PCP (adverse effect)

2 30 y, Male 13 Fever, dyspnea, dry cough Nil Nephrotic syndrome 8.8/15 12 93/25 48 Ground-glass opacities, patchy consolidations Lung biopsy, staining of organisms 0.69 MMF 0.5 g/d


Death, respiratory failure

Lung biopsy, staining of organisms 0.50 Rituximab 500 mg weekly 4 TMP/SMX (agranulocytosis), C/P

Diagnostic specimen/method

Prednisolone, mg/kg per day Biologic/immunosuppressant

1 46 y, Male 0.5 Dyspnea, dry cough Nil Nephrotic syndrome 15.4/14 9 103/NA 65 Ground-glass opacities

Patient Age, sex Duration of disease, y Clinical presentation TMP/SMX prophylaxis Nephritis (biopsy) 24-h Protein, g/CCr SLEDAI-2K Lymphocyte/CD4, /KL PaO2, mm Hg Chest CT

TABLE 2. Demographic, Clinical, Radiological, and Laboratory Data of 5 Patients With SLE With PCP

Weng et al. Volume 19, Number 5, August 2013




&



FIGURE. Radiological images of PCP in lupus patients. A, Chest radiograph showing bilateral pulmonary infiltrations in patient 1. B, High-resolution chest CT image revealing bilateral diffuse ground-glass opacities in patient 1. C, Chest CT image of bilateral ground-glass opacities and patchy consolidations in patient 2. D, Bilateral ground-glass opacities in patient 3. E, Bilateral ground-glass opacities and patchy consolidations in patient 4. F, Bilateral ground-glass opacities and pneumothorax in patient 5.

3 patients. Lymphopenia (G1000/KL) with low CD4+ T-cell counts (G200/KL) and severe hypoxemia (48 to 66 mm Hg) were identified in all cases at the time of P. jirovecii infection. Characteristic findings on chest CT such as bilateral diffuse groundglass opacities were recognized in all patients (Figure, BYF). In particular, spontaneous pneumothorax of bilateral lungs was noted in patient 5.33 Laboratory diagnosis of PCP was based on specimens from lung biopsy in patients 1 and 2 and BAL fluid in patients 3, 4, and 5. The laboratory diagnostic methods were microscopic examination on staining of Pneumocystis organisms in patients 1, 2, and 3 and mtLSUrRNA nested PCR in patients 4 and 5. Higher daily dosages of corticosteroids (equivalent prednisolone dosage Q0.5 mg/kg per day) and concomitant usages of immunosuppressants (cyclophosphamide and/or MMF) or biologics (rituximab) were observed in all patients. Antibiotics with trimethoprim/sulfamethoxazole (TMP/SMX) were prescribed first and were replaced with clindamycin/primaquine (C/P) in 4 cases because of the TMP/ SMX-associated adverse effects including cytopenia (agranulocytosis and thrombocytopenia), worsening renal function, and rash. Mechanical ventilators were required in all patients at the intensive care unit. Three patients died of P. jirovecii infection (a 60% mortality rate), including 1 patient with respiratory failure and 2 patients with septic multiorgan failure. Although postmortem pathological examinations were not performed in these patients, the cause of death was possibly related to the Pneumocystis organisms due to a failure of identification of other pathogenic microorganisms despite extensive cultures before expiration.8 Despite the great enthusiasm in the targeted therapies of lupus patients, the majority of these novel modalities, abetimus * 2013 Lippincott Williams & Wilkins

sodium as an example, have not met the expectation of efficacy.34 Nevertheless, rituximab is being prescribed for the rapidly increasing disease spectrum and patient numbers in CTD, and several open-label trials have shown evidence that patients with lupus nephritis responded to such treatment.35 In patient 1, a severe fatal PCP infection episode was identified 82 days later after receiving the first infusion of rituximab. His medical history is described in detail as follows. A 46-year-old man presented to the Department of Emergency Medicine with a 2-week history of lower-leg swelling. His blood pressure was 161/112 mm Hg, and bilateral lower-leg pitting edema was noted. Hemogram examinations showed hemoglobin 9.3 g/dL, platelet count 106 103/KL, and white blood cell count 4 103/KL with severe lymphopenia (240/KL). Urine analysis demonstrated proteinuria with 16.2 g/d by quantification. Blood biochemical data revealed albumin 2.1 g/dL, urea nitrogen 34 mg/dL, and creatinine 2.7 mg/dL. Rheumatologic profile evaluation disclosed positive autoantibodies including antinuclear antibody, anti-dsDNA antibody, direct Coombs test and lupus anticoagulant, and hypocomplementemia (C3 17.9 mg/dL, C4 G1.67 mg/dL). Bilateral pleural effusion was noted by chest x-ray, and pericardial effusion was identified by echocardiogram. Systemic lupus erythematosus with lupus nephritis was diagnosed, and high dosages of corticosteroids (equivalent to 1 mg/kg per day prednisolone) and 1 course of pulse methylprednisolone (1 g/d) for 3 consecutive days were prescribed. Despite the corticosteroid therapy, heavy proteinuria (20.6 g/d) and elevated creatinine levels (2.6 mg/dL) persisted 6 weeks later. Further treatment with MMF (1.5 g/d) was discontinued because of the deterioration of underlying thrombocytopenia status. He received 4 infusions of rituximab (500 mg/wk), followed by corticosteroid www.jclinrheum.com


255


Weng et al.

alone (prednisolone 0.5 mg/kg per day). There was a successful depletion of circulating B cells (CD19+ cell counts 2/KL). Eightytwo days later after the first infusion of rituximab, dyspnea and dry cough occurred, and bilateral pulmonary infiltrations were noted on chest radiograph (Figure, A). Laboratory examinations showed hypoxemia (PaO2 65 mm Hg) and severe lymphopenia (103/KL). Chest CT revealed diffuse groundglass opacities (Figure, B). Because of the progressive hypoxemia with pulmonary infiltrations, mechanical ventilator was prescribed, and he was transferred to the intensive care unit. Microscopic findings of lung biopsy demonstrated intra-alveolar foamy exudates with bubbling material and reactive foamy histiocytes, and oval to round cysts of Pneumocystis organisms were identified by Gomori methenamine silver stain. Antibiotics with TMP/SMX were prescribed first and replaced with C/P because of the TMP/SMX-associated agranulocytosis. However, hypoxemia progressed, and he died of respiratory failure 1 month later. The cause of death was related to the P. jirovecii infection because no pathogenic microorganisms were yielded despite extensive antemortem cultures.

DISCUSSION Lupus patients whose immune systems are unable to deliver an effective host defense have a higher baseline occurrence of infection, and the widespread usage of corticosteroid and immunosuppressants in their therapy has further augmented the risk of infection.36 The autopsy studies of SLE have emphasized the missed opportunistic infection such as P. jirovecii antemortem, and it is generally believed that the mortality due to infection could be underestimated.31,37 In most published reports, infection remains the leading cause of death in lupus patients, especially among Chinese.38 All known opportunistic infections have been documented in SLE with a special attention paid to PCP because of the significant morbidity and high mortality.6,36 Indeed, a 60% mortality rate with complete ventilator requirement of P. jirovecii infection is observed in this retrospective study. Furthermore, clinical presentations and image findings such as dyspnea and dry cough with bilateral pulmonary infiltrations (Figure, BYF) are similar between PCP and acute lupus pneumonitis, and such a diagnostic dilemma has a critical impact on the subsequent management. The TMP/SMX with its high clinical efficacy and availability in different preparations is the first-line therapeutic agent for P. jirovecii infection; however, intolerance is observed in patients with known allergic history to sulfa drugs, and adverse events can develop during the therapy.1,2 Higher than the expected overall drug reaction rate, sulfonamides in particular, has been observed in lupus patients of Chinese ethnicity, and most of SLE with PCP in this series experienced such adverse effects associated with the TMP/SMX treatment.39 The C/P is considered as a second-line regimen for AIDS patients with P. jirovecii infection who fail the first-choice TMP/SMX therapy.40 Although the therapeutic response regarding C/P in lupus patients with PCP remains to be determined, 2 of our cases had good recovery under this substitute. A profound depletion of B lymphocytes by rituximab therapy prompts its indication in RA with inadequate response to tumor necrosis factor > antagonists where these cells are considered to play an important pathogenetic role.35 Such a treatment is considered to be used in lupus patients with critical situations or life-threatening conditions refractory to or intolerant of conventional therapy such as the reported patient 1 who lacked responses to high dosages of prednisolone/pulse methylprednisolone and had the MMF-associated adverse effect.35,41 Infection is the most frequent reported adverse events in patients

256

www.jclinrheum.com

&


on rituximab therapy after more than a decade of clinical application.4,42 Mortality due to sepsis and pneumonia has been documented, and accumulated evidence now suggests a greater risk of the certain rare opportunistic infection such as JC (John Cunningham ) polyomavirusYinduced lethal progressive multifocal leukoencephalopathy. Pneumocystis jirovecii pneumonia has been well documented in the literature to be associated with rituximab treatment in hematologic malignancies.4,42 Furthermore, there are reported cases with P. jirovecii infection in an expanding category of CTD following rituximab therapy.4,8Y10 The severe combined immunodeficiency mice, with deficiency in both T and B lymphocytes, have spontaneous PCP at 3 weeks of age, and the reconstruction of immune system with the CD4+ T cells from the spleen could resume their ability in elimination of P. jirovecii infection.43 The CD4+ T lymphocytes, functioning as memory cells conducting the host response by recruiting and activating other effector cells including macrophages and monocytes, are essential for the human defense mechanism against PCP, and the risk of such infection is increased with peripheral blood CD4+ T-cell counts less than 200/KL.44 All of the lupus patients with PCP in this study had CD4+ T lymphocyte counts less than 200/KL at the onset of P. jirovecii infection. An increased susceptibility of B lymphocyteYdeficient mice to Pneumocystis organisms implicates an important role in the host defense by such cells, and B cells are further demonstrated to be essential for the generation of CD4+ T memory cells responsible for protection against P. jirovecii infection by using the bone marrow chimeric mice model that expresses major histocompatibility complex class II on antigen-presenting cells except B lymphocytes.45,46 Nevertheless, the risk of PCP in SLE on rituximab treatment could be attributed to complex factors including the concomitant usage of higher dosages of corticosteroid and/or other immunosuppressants and the underlying immunodeficiency condition such as the prescription of prednisolone (0.5 mg/kg per day) and severe lymphopenia status (103/KL), with deficiency of CD4+ T cells (G200/KL) in the reported patient 1. The relative specificity for activated lymphocyte of MMF has been selected for the therapy of autoimmune diseases, and it is extensively used in the treatment of lupus patients over the past decade with favorable efficacy.47 Although the strong immunosuppressive activities of MMF can serve as an efficacious medication for transplant rejection and lupus nephritis, it also raises the risk of infection in these patients.47,48 Opportunistic infections such as cytomegalovirus and BK virus are frequently associated with the renal transplant recipients on such a therapy, and a recent study using the multivariate analysis clearly demonstrates that the prescription of MMF increases the risk of PCP in kidney transplant patients.49,50 Despite the observation of PCP in 3 lupus patients receiving MMF in this study, there was concurrent prescription of corticosteroid of higher dosages (equivalent prednisolone dosage Q0.5 mg/kg per day). Notably, a fatal episode due to the acute respiratory distress syndrome secondary to P. jirovecii infection has been reported in a patient with proliferative lupus nephritis on such a medication for 10 months.25 Nevertheless, it remains unclear whether the application of MMF in lupus patients can become a risk factor responsible for the development of PCP, and further investigations are needed to clarify this issue. Owing to a low occurrence of PCP in SLE on cyclophosphamide treatment, the routine use of TMP/SMX for prophylaxis of P. jirovecii infection in lupus patients has only been suggested in those patients at higher risk such as those with leukopenia, lymphopenia, high dosages of corticosteroid, active renal disease, and elevated SLEDAI score.17 Analysis of the * 2013 Lippincott Williams & Wilkins



&


cost-effectiveness of PCP prophylaxis is considered to be challenging in giant cell arteritis given the rarity of this complication.51 The routine chemoprophylaxis for P. jirovecii infection, either continuously or in the period of depressed B cell numbers, has been strongly proposed in granulomatosis with polyangiitis undergoing the rituximab therapy.9 Importantly, the recent Food and Drug Administration approval of rituximab recommends Pneumocystis prophylaxis during treatment and at least 6 months following the last infusion for the patients with microscopic polyangiitis and granulomatosis with polyangiitis.52 Regardless of growing evidence supporting the clinical efficacy of primary prophylaxis in HIV-negative CTD for incidence lowering, life quality improvement, and cost reduction, the lack of consensus guidelines addressing prophylactic antibiotics against PCP in SLE clearly reflects the absence of large-scale prospective or interventional studies on this issue.32,53 Further investigations into the efficacy of prophylaxis should involve the unanswered questions including risk-benefit ratio analysis, duration of therapy, and alternative therapeutic regimens. After the completion of these studies, practicing rheumatologists can follow guidelines to achieve better decision making in the management of lupus patients. In conclusion, there is a rare occurrence of PCP but a complete ventilator requirement and a high mortality rate in hospitalized lupus patients from southern Taiwan. None received chemoprophylactics against Pneumocystis organisms. All had lupus nephritis and lymphopenia with low CD4+ T-cell counts. Prior usages of higher daily prednisolone dosages and concomitant biologics or immunosuppressants were observed in all cases. A consensus guideline addressing prophylactic antibiotics against Pneumocystis organisms in SLE on biologics or immunosuppressants would be helpful in clinical management.

KEY POINTS (1) There is a rare occurrence but significant morbidity and high mortality of PCP in hospitalized SLE. (2) Prior usages of higher daily prednisolone dosages (Q0.5 mg/kg per day) and concomitant biologics or immunosuppressants have been observed in lupus patients with PCP. (3) A consensus guideline addressing prophylactic antibiotics against PCP in SLE on biologics or immunosuppressants would be helpful in clinical management. ACKNOWLEDGMENTS The authors thank all of the nurses and doctors including residents and visiting staffs who were involved in the diagnosis and management of lupus patients in the National Cheng Kung University Hospital and Dou-Liou Branch, College of Medicine, National Cheng Kung University. REFERENCES 1. Thomas CF Jr, Limper AH. Pneumocystis pneumonia. N Engl J Med. 2004;350:2487Y2498. 2. Catherinot E, Lanternier F, Bougnoux ME, et al. Pneumocystis jirovecii pneumonia. Infect Dis Clin North Am. 2010;24:107Y138. 3. Takeuchi T, Kameda H. The Japanese experience with biologic therapies for rheumatoid arthritis. Nat Rev Rheumatol. 2010;6:644Y652. 4. Gea-Banacloche JC. Rituximab-associated infections. Semin Hematol. 2010;47:187Y198. 5. Pryor BD, Bologna SG, Kahl LE. Risk factors for serious infection during treatment with cyclophosphamide and high-dose corticosteroids for systemic lupus erythematosus. Arthritis Rheum. 1996;39:1475Y1482.



6. Ward MM, Donald F. Pneumocystis carinii pneumonia in patients with connective tissue diseases: the role of hospital experience in diagnosis and mortality. Arthritis Rheum. 1999;42:780Y789. 7. Hahn BH, McMathon MA, Wilkinson A, et al. American College of Rheumatology Guidelines for screening, treatment, and management of lupus nephritis. Arthritis Care Res. 2012;64:797Y808. 8. Teichmann LL, Woenckhaus M, Vogel C, et al. Fatal Pneumocystis pneumonia following rituximab administration for rheumatoid arthritis. Rheumatology. 2008;47:1256Y1257. 9. Hugle B, Solomon M, Harvey E, et al. Pneumocystis jirovecii pneumonia following rituximab treatment in Wegener’s granulomatosis. Arthritis Care Res. 2010;62:1661Y1664. 10. Tsai MJ, Chou CW, Lin FC, et al. Pneumocystis carinii pneumonia in patients with systemic lupus erythematosus after rituximab therapy. Lupus. 2012;21:914Y918. 11. Weng CT, Chung TJ, Liu MF, et al. A retrospective study of pulmonary infarction in patients with systemic lupus erythematosus from southern Taiwan. Lupus. 2011;20:876Y885. 12. Wang CR, Liu CC, Li YH, et al. Adult-onset acute rheumatic fever: possible resurgence in southern Taiwan. J Clin Rheumatol. 2005;11:146Y149. 13. Hochberg MC. Updating the American College of Rheumatology revised criteria for the classification of systemic lupus erythematosus. Arthritis Rheum. 1997;40:1725. 14. Gladman DD, Ibanez D, Urowitz MB. Systemic Lupus Erythematosus Disease Activity Index 2000. J Rheumatol. 2002;29:288Y291. 15. Robberts FJ, Liebowitz LD, Chalkley LJ. Polymerase chain reaction detection of Pneumocystis jirovecii: evaluation of 9 assays. Diagn Microbiol Infect Dis. 2007;58:385Y392. 16. Mekinian A, Durand-Joly I, Hatron PY, et al. Pneumocystis jirovecii colonization in patients with systemic autoimmune diseases: prevalence, risk factors of colonization and outcome. Rheumatology. 2011;50:569Y577. 17. Gupta D, Zachariah A, Roppelt H, et al. Prophylactic antibiotic usage for Pneumocystis jirovecii pneumonia in patients with systemic lupus erythematosus on cyclophosphamide: a survey of US rheumatologists and the review of literature. J Clin Rheumatol. 2008;14:267Y272. 18. Liam CK, Wang F. Pneumocystis carinii pneumonia in patients with systemic lupus erythematosus. Lupus. 1992;1:379Y385. 19. Godeau B, Coutant-Perronne V, Le Thi Huong D, et al. Pneumocystis carinii pneumonia in the course of connective tissue disease: report of 34 cases. J Rheumatol. 1994;21:246Y251. 20. Kadoya A, Okada J, Iikuni Y, et al. Risk factors for Pneumocystis carinii pneumonia in patients with polymyositis/dermatomyositis or systemic lupus erythematosus. J Rheumatol. 1996;23:1186Y1188. 21. Kim WU, Min JK, Lee SH, et al. Causes of death in Korean patients with systemic lupus erythematosus: a single center retrospective study. Clin Exp Rheumatol. 1999;17:539Y545. 22. Mok CC, Lee KW, Ho CT, et al. A prospective study of survival and prognostic indicators of systemic lupus erythematosus in a southern Chinese population. Rheumatology. 2000;39:399Y406. 23. Noe¨l V, Lortholary O, Casassus P, et al. Risk factors and prognostic influence of infection in a single cohort of 87 adults with systemic lupus erythematosus. Ann Rheum Dis. 2001;60:1141Y1144. 24. Gladman DD, Hussain F, Iban˜ez D, et al. The nature and outcome of infection in systemic lupus erythematosus. Lupus. 2002;11:234Y239. 25. Contreras G, Pardo V, Leclercq B, et al. Sequential therapies for proliferative lupus nephritis. N Engl J Med. 2004;350:971Y980. 26. Ginzler EM, Dooley MA, Aranow C, et al. Mycophenolate mofetil or intravenous cyclophosphamide for lupus nephritis. N Engl J Med. 2005;353:2219Y2228.

www.jclinrheum.com


257


Weng et al.

27. Mok CC, Ying KY, Ng WL, et al. Long-term outcome of diffuse proliferative lupus glomerulonephritis treated with cyclophosphamide. Am J Med. 2006;119:355.e25Ye33. 28. Li J, Huang XM, Fang WG, et al. Pneumocystis carinii pneumonia in patients with connective tissue disease. J Clin Rheumatol. 2006;12:114Y117. 29. Bosch X, Guilabert A, Pallare´s L, et al. Infections in systemic lupus erythematosus: a prospective and controlled study of 110 patients. Lupus. 2006;15:584Y589. 30. Narata R, Wangkaew S, Kasitanon N, et al. Community-acquired pneumonia in Thai patients with systemic lupus erythematosus. Southeast Asian J Trop Med Public Health. 2007;38:528Y536. 31. Quadrelli SA, Alvarez C, Arce SC, et al. Pulmonary involvement of systemic lupus erythematosus: analysis of 90 necropsies. Lupus. 2009;18:1053Y1060. 32. Vananuvat P, Suwannalai P, Sungkanuparph S, et al. Primary prophylaxis for Pneumocystis jirovecii pneumonia in patients with connective tissue diseases. Semin Arthritis Rheum. 2011;41:497Y502. 33. Boiselle PM, Crans CA Jr, Kaplan MA. The changing face of Pneumocystis carinii pneumonia in AIDS patients. AJR. 1999;172:1301Y1309. 34. Horowitz DM, Furie RA. Abetimus sodium: a medication for the prevention of lupus nephritis flares. Expert Opin Pharmacother. 2009;10:1501Y1507. 35. Engel P, Go´mez-Puerta JA, Ramos-Casals M, et al. Therapeutic targeting of B cells for rheumatic autoimmune diseases. Pharmacol Rev. 2011;63:127Y156. 36. Petri M. Infection in systemic lupus erythematosus. Rheum Dis Clin North Am. 1998;24:423Y456. 37. Ruskin J, Remington JS. The compromised host and infection. I. Pneumocystis carinii pneumonia. JAMA. 1967;202:1070Y1074. 38. Jakes RW, Bae SC, Louthrenoo W, et al. Systematic review of the epidemiology of systemic lupus erythematosus in the Asia-Pacific region: prevalence, incidence, clinical features, and mortality. Arthritis Care Res. 2012;64:159Y168.

&


41. Wallace DJ. Advances in drug therapy for systemic lupus erythematosus. BMC Med. 2010;8:77. 42. Kelesidis T, Daikos G, Boumpas D, et al. Does rituximab increase the incidence of infectious complications? A narrative review. Int J Infect Dis. 2011;15:e2Ye16. 43. Harmsen AG, Stankiewicz M. Requirement for CD4+ cells in resistance to Pneumocystis carinii pneumonia in mice. J Exp Med. 1990;172:937Y945. 44. Phair J, Mun˜oz A, Detels R, et al. The risk of Pneumocystis carinii pneumonia among men infected with human immunodeficiency virus type 1. Multicenter AIDS Cohort Study Group. N Engl J Med. 1990;322:161Y165. 45. Marcotte H, Levesque D, Delanay K, et al. Pneumocystis carinii infection in transgenic B cellYdeficient mice. J Infect Dis. 1996;173:1034Y1037. 46. Lund FE, Hollifield M, Schuer K, et al. B cells are required for generation of protective effector and memory CD4 cells in response to Pneumocystis lung infection. J Immunol. 2006;176:6147Y6154. 47. Dall’Era M. Mycophenolate mofetil in the treatment of systemic lupus erythematosus. Curr Opin Rheumatol. 2011;23:454Y458. 48. Hanvesakul R, Kubal C, Jham S, et al. Increased incidence of infections following the late introduction of mycophenolate mofetil in renal transplant recipients. Nephrol Dial Transplant. 2008;23:4049Y4053. 49. Ritter ML, Pirofski L. Mycophenolate mofetil: effects on cellular immune subsets, infectious complications, and antimicrobial activity. Transpl Infect Dis. 2009;11:290Y297. 50. Arichi N, Kishikawa H, Mitsui Y, et al. Cluster outbreak of Pneumocystis pneumonia among kidney transplant patients within a single center. Transplant Proc. 2009;41:170Y172. 51. Kermani TA, Ytterberg SR, Warrington KJ. Pneumocystis pneumonia in giant cell arteritis: a case series. Arthritis Care Res. 2011;63:761Y765.

39. Wang CR, Chuang CY, Chen CY. Drug allergy in Chinese patients with systemic lupus erythematosus. J Rheumatol. 1993;20:399Y400.

52. Go´mez-Puerta JA, Quintana LF, Stone JH, et al. B-cell depleting agents for ANCA vasculitides: a new therapeutic approach. Autoimmun Rev. 2012;11:646Y652.

40. Benfield T, Atzori C, Miller RF, et al. Second-line salvage treatment of AIDS-associated Pneumocystis jirovecii pneumonia: a case series and systematic review. J Acquir Immune Defic Syndr. 2008;48:63Y67.

53. Cettomai D, Gelber AC, Christopher-Stine L. A survey of rheumatologists’ practice for prescribing Pneumocystis prophylaxis. J Rheumatol. 2010;37:792Y799.

258

www.jclinrheum.com

