Pulmonary arterial hypertension

Pulmonary arterial hypertension Cardiovascular effects of pharmacological intervention

Mirjam E. van Albada

Financial support by the Groningen University Institute for Drug Exploration (GUIDE) and the University of Groningen for the publication of this thesis is gratefully acknowledged.

Cip-gegevens koninklijke bibliotheek, Den Haag Van Albada, Mirjam E. Pulmonary arterial hypertension; cardiovascular effects of pharmacological intervention Proefschrift Groningen – Met literatuuropgave en samenvatting in het Nederlands ISBN 978-90-367-3077-8 © Mirjam E. van Albada, 2007 All rights reserved. No part of this thesis may be reproduced, or transmitted in any form or by any means, without permission of the author. Tekening cover: Jannie van Oort (www.jannievanoort.nl) Layout: Helga de Graaf, Studio Eye Candy Groningen (proefschrift.info) Printed by Ipskamp PrintPartners, Enschede

RIJKSUNIVERSITEIT GRONINGEN

Pulmonary arterial hypertension Cardiovascular effects of pharmacological intervention

Proefschrift

ter verkrijging van het doctoraat in de Medische Wetenschappen aan de Rijksuniversiteit Groningen op gezag van de Rector Magnificus, dr. F. Zwarts, in het openbaar te verdedigen op woensdag 4 juli 2007 om 14.45 uur

door

Mirjam Ellen van Albada geboren op 17 oktober 1977 te Eindhoven

Promotor:

Prof. dr. R.M.F. Berger

Copromotor:

Dr. R.G. Schoemaker

Beoordelingscommissie:

Prof. dr. R. Naeije

Prof. dr. P.J.J. Sauer

Prof. dr. W.H. van Gilst

Paranimfen:

Willemijn Windt

Marieke van der Werf-Eldering

The publication of this thesis van financially supported by: Actelion Pharmaceuticals Nederland BV, Arie Blok Diervoeding, Astellas Pharma BV, Bristol Meyers Squibb BV, Harlan Netherlands BV, Pfizer BV, Roche Diagnostics Nederland BV, Servier Nederland Farma BV, Therabel Pharma, United Therapeutics.

Contents Chapter 1

Introduction and scope of this thesis

9

Chapter 2

Pulmonary arterial hypertension in congenital heart disease: the need for refinement of the Evian-Venice classification Submitted

27

Chapter 3

Biological serum markers in the management of pediatric pulmonary arterial hypertension Submitted

45

Chapter 4

The role of increased pulmonary blood flow in pulmonary arterial hypertension Eur Respir J. 2005 Sep;26(3):487-93.

63

Chapter 5

Gene expression profiling in a rat model of flow-associated pulmonary hypertension: effects of pulmonary blood flow and prostacyclin treatment Manuscript in preparation

79

Chapter 6

Prostacyclin therapy increases right ventricular capillarisation in a model for flow-associated pulmonary hypertension Eur J Pharmacol. 2006 Nov 7;549(1-3):107-16.

101

Chapter 7

Treprostinil in pulmonary hypertension: beneficial outcome without reversed vascular remodeling J Cardiovasc Pharmacol. 2006 Nov;48(5):249-54.

125

Chapter 8

Dual endothelin receptor antagonism improves both pulmonary vascular and cardiac remodeling in experimental flow-associated pulmonary hypertension Manuscript in preparation

141

Chapter 9

Erythropoietin improves advanced pulmonary vascular remodeling in a rat model Submitted

163

Chapter 10

General discussion and summary

181

Nederlandse samenvatting

193

Dankwoord

203

Bibliography

209

Chapter 1 Introduction and scope of this thesis

Introduction Pulmonary hypertension: introduction and classification of the disease Pulmonary hypertension is a symptom that occurs in a variety of underlying conditions. It is defined as a mean pulmonary arterial pressure of more than 25 mmHg at rest or more than 30 mmHg during exercise. During the Second World Symposium on Pulmonary Hypertension in 1998, a classification for these underlying conditions was proposed. In this classification, five main categories are discriminated based on pathogenetic concepts (chapter 2, table 1). The first category is the category of pulmonary arterial hypertension (PAH). This category includes conditions that share a typical pulmonary vascular histological pattern, the so-called plexogenic arteriopathy, which is exclusively seen in patients with pulmonary arterial hypertension. PAH is further divided into idiopathic PAH, familial PAH and PAH associated with a series of conditions, including congenital heart diseases with a systemic-topulmonary shunt. In this latter population, pulmonary arterial hypertension occurs in 6-15% of patients 1;2. Pulmonary arterial hypertension is a debilitating disease, with progressive remodeling of the pulmonary resistance vessels. After a certain point, this remodeling gets irreversible, even after surgical correction of the cardiac defect. Pulmonary vascular resistance increases, leading to increased right ventricular working load. The secondary right ventricular hypertrophy and failure that develop are an important cause of mortality in patients with congenital heart defects. Until now, no curative treatment exists for this disease. In the past decades, however, new therapeutic options have become available that do ameliorate prognosis 3;4. Besides pulmonary arterial hypertension, other conditions exist that cause an increase in pulmonary arterial pressure. However, in these disease forms, pulmonary vascular histology is different from the plexogenic arteriopathy that is seen in patients with congenital heart defects. These conditions are grouped in the other four classes of pulmonary hypertension and will only be mentioned briefly. First, increased pulmonary arterial pressure can be the consequence of an increased left atrial pressure as is seen in left-sided heart or valvular disease. Besides, the presence of lung diseases as chronic obstructive pulmonary disease and interstitial lung diseases and/or the presence of hypoxemia, that occurs for example during chronic exposure to high altitude, can lead to pulmonary vascular problems. Also the presence of embolic processes causes an increased pulmonary arterial pressure. These embolisms can be either thrombotic from origin, or can be composed of tumor or parasite material. Finally, a fifth miscellaneous category was proposed which contains sarcoidosis, histiocytosis X, lymphangiomatosis and compression of the pulmonary vessels 5. The current thesis is restricted to the category of pulmonary arterial hypertension as occurs in patients with congenital heart defects.

10

Chapter 1

Clinical history Presenting symptoms of pulmonary arterial hypertension are often vague and therefore the disease might go unrecognized in the first stages. Patients mostly present with limited exercise tolerance and shortness of breath. Other common symptoms are syncope, angina pectoris and peripheral edema. None withstanding the recent development of new therapeutic modalities, survival after diagnosis is still limited. In patients with idiopathic pulmonary arterial hypertension, median survival in untreated patients is 2.8 years. Survival in patients with PAH associated with a congenital heart defect is somewhat better, with a number of Eisenmenger patients surviving into their fourth decade 13. Pathological changes in the pulmonary vasculature The pulmonary circulation serves several purposes. Gas exchange, the filtering of particles and the chemical processing of the blood all occur upon passage of cardiac output through the pulmonary vasculature. Normal pulmonary vascular resistance is only 10 percent of systemic vascular resistance. The pulmonary vascular bed is a low pressure system and pulmonary vessels form a thin-walled vasculature. The pulmonary arterial system runs along the airways from the hila to the periphery. The larger arteries are thin-walled, mainly elastic vessels. Arteries smaller than 2 mm are usually muscularized. Due to their smooth muscular content, they can adapt their diameter by vasoconstriction and dilatation, thus regulating blood flow to match local needs. Beyond a diameter of 30 to 50 μm, the muscular coat disappears and the pulmonary arterioles drain into an extensive capillary network. Consequently, most of the pressure drop occurs in the smaller arteries, and modest alterations in the diameter of these vessels cause a large change in vascular resistance. This 11


Pathofysiology of flow-associated pulmonary arterial hypertension The evolvement of pulmonary vascular disease in patients with congenital heart defects differs from person to person depending on the type of underlying cardiac lesion. However, the presence of increased pulmonary blood flow seems to be an essential trigger in the development of pulmonary arterial hypertension. Especially patients with extensive systemic-to-pulmonary shunts, whose pulmonary vascular bed is exposed to a combination of increased pulmonary arterial pressure and increased pulmonary blood flow, develop pulmonary arterial hypertension 2. More than half of patients with this type of lesion 6;7 develop irreversible pulmonary vascular disease in the first years of life 8;9, while this is 10 to 20% of patients that have an isolated increased pulmonary blood flow, as is seen in patients with atrial septal defects 10-12. Due to the pulmonary vascular remodeling, pulmonary vascular resistance increases. This increased right ventricular work load leads to right ventricular hypertrophy and eventually to right ventricular failure as is illustrated in figure 1. When as a result of ongoing pulmonary vascular remodeling pulmonary vascular resistance rises to systemic levels, and an intracardiac shunt is present, the original left-to-right shunt can reverse. This is called the Eisenmenger syndrome.

- Thin-walled

Muscular pulmonary artery

Healthy

- Vaseconstiction - Inflammation - Proliferation


VSD

- Vaseconstiction - Inflammation - Proliferation


Eisenmenger

Figure 1. Schematic representation of the pathois illustrated by Poiseuille’s equation for the calculation of pulmonary vas- physiology of flow-associated pulmonary arterial hypertension that develops in patients with concular resistance, where resistance = genital heart defects. Exposure of the pulmonary 8ηL/πr4. The radius r is present to the vascular bed to increased pressure and flow caused fourth power in the denominator, in- by the intracardiac left-to-right shunt (VSD = dicating that a small change is diam- ventricular septal defect) leads to pulmonary vaseter has enormous consequences for cular remodeling. Due to the increased pulmonary vascular resistance right ventricular hypertrophy pulmonary vascular resistance. develops. Eventually, pulmonary vascular resistance In the determination of vascular re- increases to suprasystemic levels, which leads to sistance, the endothelium, as highly reversal of the intracardiac shunt. This situaactive metabolic organ which pro- tion is called Eisenmenger syndrome. RA = right duces many vasoregulating substanc- atrium, RV = right ventricle, LV = left ventricle. es, plays a crucial role. Endothelial dysfunction results in an altered balance between vasoconstrictive and relaxant factors. This imbalance favors vasoconstriction, proliferation of endothelial cells, vascular smooth muscle cells and fibroblasts and activation of thrombocytes. The pulmonary vascular pattern of plexogenic arteriopathy is composed of several histological alterations 14. Medial wall thickness of the muscular arteries increases, both by increasing number and by increasing size of smooth muscle cells. Moreover, muscularization extends into the smaller arterioles, which are normally non-muscularized. Proliferation of endothelial and smooth muscle cells leads to the development of neointima. Localized dilatation of pulmonary arteries may occur, causing

12

Chapter 1

Hypertrophic cardiac response and right ventricular failure Most of our current knowledge on cardiac failure originates from studies on left ventricular functioning. Since the right ventricle differs from the left ventricle in many respects, these results can not be automatically translated. Cross-sectionally, the right ventricle has a crescent shape, which gives it a lower volume to surface ratio than the left ventricle. Since it also has a much thinner free wall, this results in a compliance that is greater than that of the left ventricle. In contrast to the left ventricle, ejection is sustained during pressure development and continues during pressure decline. Because of the prolonged emptying against low pressure, the right ventricle is very sensitive to changes in afterload 15. To compensate for the increased afterload that occurs in pulmonary arterial hypertension, the right ventricle dilates to maintain an adequate stroke volume 16. The isovolaemic contraction phase and ejection time are prolonged and consequently, myocardial oxygen consumption increases 17. Simultaneously, ventricular myocytes hypertrophy, resulting in a relative reduction of capillary density and an increased oxygen diffusion distance 18. Unfortunately, right ventricular myocardial perfusion, which under normal physiological circumstances occurs during both diastole and systole, is reduced to the diastolic phase in pulmonary hypertension. Together, these alterations suggest a decreased oxygen supply under conditions of increased oxygen demand, causing a deterioration of cardiomyocyte metabolism and function 19. Genetic mutations leading to pulmonary arterial hypertension In recent years, research in cohorts of patients with idiopathic pulmonary arterial hypertension has led to the discovery of several genetic mutations that either cause the disease or are associated with its development. These mutations occur in genes that are all part of the transforming growth factor beta (TGF-β) superfamily. Bone morphogenetic proteins (BMP’s) are growth factors with many functions that form a subgroup within the TGF-β family. BMP’s are involved in the regulation of proliferation, differentiation, migration and apoptosis of many cell types including endothelial and vascular smooth muscle cells 20. The BMP type 2 receptor is part of a heteromeric receptor on vascular smooth muscle cells. About half of the patients with familial pulmonary arterial hypertension have a discovered mutation in this gene 21;22. Moreover, 26% of patients diagnosed as having idiopathic pulmonary arterial hypertension also display a mutation in this gene. In a cohort of 106 pa13


the lumen to become wider, and the arterial wall to become thinner. Ultimately, this can lead to a vein-like appearance of the arteries. The pathognomonic plexiform lesion develops in supranumerary arteries, which branch from larger arteries and have no accompanying airway. The lesion consists of a segment of dilatation, with destruction of the arterial wall, rupture of the internal elastic membrane and loss of smooth muscle cells. In the dilated lumen, a cellular plexus with narrow communicating channels develops. This progressive remodeling of the pulmonary vessels causes the increased right ventricular work load that leads to the development of right ventricular hypertrophy and eventually failure.

PLATELETS

NITRIC OXIDE PATHWAY

eNOS

ENDOTHELIN PATHWAY

PROSTACYCLIN PATHWAY

ECE iNOS

Big ET-1

PGIS Endothelin-1

L-arginine → L-citrulline ET-B

ENDOTHELIUM

Prostacyclin

Thromboxane

NO ET-A GC

GTP → cGMP

PDE5

GMP

Ca ↓

ET-B

AC

ATP → cAMP Ca ↓

VASCULAR SMOOTH MUSCLE VASODILATATION AND ANTIPROLIFERATION

VASOCONSTRICTION AND PROLIFERATION

tients with pulmonary arterial hy- Figure 2. The involvement of nitric oxide, endothelin-1, prostacyclin and thromboxane in the pertension (PAH) and congenital pathogenesis of pulmonary arterial hypertension. heart disease, there was a 6% mu- AC = adenylate cyclase, ATP = adenosine triphostation frequency, which is higher phate, Big ET-1 = Big endothelin-1, cAMP = cyclic than in the general population 23. adenosine monophosphate, Ca = calcium, cGMP = The mutation causes and aberra- cyclic guanosine monophosphate, ECE = endothelin-converting enzyme, ET-A = endothelin type A tion in signal transduction, which receptor, ET-B = endothelin type B receptor, eNOS most probably results in an altered = endothelial nitric oxide synthase, GC = guanylapoptotic process favouring pro- ate cyclase , GMP = guanosine monophosphate liferation. Further research revealed GTP = guanosine triphosphate, iNOS = inducible other mutations in the transforming nitric oxide synthase, NO = nitric oxide, PDE5 = growth factor β family. A lk-1 is a re- phosphodiesterase 5, PGIS = prostacyclin synthase. ceptor on endothelial cells, that has shown to be mutated in several patients with hereditary hemorrhagic telangiectasia and PAH 24. In pediatric patients with PAH, heterogenous mutations in the BMP type 2 receptor, Alk-1 and in endoglin, a part of the transforming growth factor-beta receptor complex, were identified 25. Furthermore, mutations in other signaling pathways have been described. Serotonin (5-HT) is a potent vasoconstrictor. When vascular smooth muscle cells of patients with different forms of PAH are exposed to serotonin, they proliferate excessively 26 . This abnormal response to 5-HT can be attributed to overexpression of the serotonin transporter (5-HTT). This overexpression is associated with the homozygous presence of the L-allelic variant of the 5-HTT gene promotor in the majority of patients with idiopathic PAH 26;27. 14

Chapter 1

Nitric oxide pathway Nitric oxide (NO) is a potent endothelium derived vasodilator that leads to a rise in intracellular cyclic GMP in the vascular smooth muscle cell, causing vasodilatation by acting on potassium-channels. A reduction in NO availability caused by decreased nitric oxide synthase (NOS) activity has long been suspected to play a role in the pathogenesis of pulmonary hypertension 28. However, more recent research suggested that local NOS expression in vascular lesions might be increased 29. This increase in local NO was also noted in the plexiform lesions of patients with PAH and congenital heart disease 30. Nevertheless, a decreased production of total body NO was demonstrated in patients with idiopathic PAH 31. Several mechanisms have been described that can account for this decreased NO availability. NO is formed from L-arginine. Arginase, an enzyme that degrades L-arginine, is increased in patients with PAH, thereby limiting the amount that is available for NO synthesis 32. Besides, endothelin-1 could be an NOS inhibitor in PAH, since in patients with idiopathic PAH treated with an endothelin receptor antagonist, NO production was restored to control levels 33. Reduced NOS activity might also be caused by an increase in the endogenous NOS inhibitor asymmetric dimethylarginine (ADMA). ADMA concentrations are correlated with hemodynamic measurements and with reduced survival in patients with pulmonary hypertension and sickle cell disease 34. Phosphodiesterases are enzymes involved in the inactivation of cGMP, thus abolishing the vasodilatative action of NO. PDE5 is a phosphodiesterase that is particularly expressed in the lung. Inhibition of PDE5, as can be achieved by sildenafil administration, improves exercise tolerance, hemodynamics and quality of life scores, both in patients with idiopathic PAH and in patients with PAH and congenital heart disease 35;36. Endothelin pathway Endothelin-1 is the most potent vasoconstrictor known, that possesses mitogenic properties. It is produced by the endothelium 37, by cardiomyocytes, fibroblasts and macrophages 38-40. Its precursor protein pre-pro-endothelin is cleaved by furin-like proteases to form big-ET-1. Subsequently, big-ET-1 is processed by the endothelin converting enzyme (ECE) to form endothelin-1. Besides ECE, other proteases are also involved in the production of endothelin-1 41. Endothelin-1 regulates pulmonary vascular tone and contributes to proliferation and fibrosis of the pulmonary vascular wall. Moreover, it also stimulates cardiomyocyte hypertrophy 42;43. Regulation of endothelin-1 is complex and involves many factors. Endothelin expression is increased by shear stress, hypoxia, angiotensin II and several growth factors and inhibited by nitric oxide and prostacyclin 44;45. Effects of endothelin-1 are mediated by two types of transmembrane domain recep15


Molecular mechanisms and therapeutic interventions Many vaso-active substances have been discovered to be associated with the pathogenesis of PAH. The three most important pathways, the nitric oxide pathway, the endothelin pathway and the prostacyclin pathway are discussed below (figure 2).

tors, the endothelin-A and endothelin-B receptors 46;47. Activation of the endothelin-A receptor leads to vasoconstriction and proliferation 48. Activation of the B-type receptor when located on the endothelium leads to the release of nitric oxide and prostacyclin, thereby causing vasodilatation 49;50. Additionally, the pulmonary endothelin-B receptor is responsible for the clearance of plasma endothelin-1 from the circulation 51. This suggests a potentially beneficial effect of endothelin-B receptor activity in pulmonary hypertensive conditions. Nevertheless, activation of endothelin-B receptors that are located on vascular smooth muscle cells leads to vasoconstriction and proliferation 52. In the heart, both the endothelin-B receptor and the endothelin-A receptor are involved in the development of cardiac fibrosis 53. Furthermore, activation of the endothelin-B receptor stimulates aldosteron production, contributing to undesirable sodium retention in states of cardiac failure 54. Endothelin-1 levels are increased in patients with PAH 55;56. This increase in endothelin-1 is related to changes in hemodynamics, and appears to have prognostic value, since it is inversely correlated with survival in patients with idiopathic PAH 57;58. Also in populations with PAH and congenital heart disease, endothelin-1 levels are increased 59;60. After surgical correction of the original cardiac defect, circulating endothelin-1 levels decline 61. Blockade of the endothelin-receptors has proven to be an effective strategy in the management of PAH, although discussion exists as to whether to block only endothelin-A receptors or both receptor subtypes. Bosentan, a dual endothelin-receptor antagonist, improves cardiac index, pulmonary vascular resistance and exercise tolerance 62-65. On the other hand, selective endothelin-A receptor antagonism also improves exercise tolerance and hemodynamics in a mixed population of patients with idiopathic PAH and PAH with congenital heart defects 66;67. Because cross-talk exists between the two receptor subtypes, blocking one type could potentially cause compensation by the other subtype 68. Hypothetically, this could mean that dual receptor antagonism is more effective. Experimental studies indeed suggest a better effectiveness of dual receptor blockade in the monocrotaline rat model for pulmonary hypertension 69. Prostacyclin pathway Prostacyclin is a vasodilatory prostanoid that is produced from arachidonic acid by cyclo-oxygenase-activity. It acts by increasing levels of cyclic adenosine monophosphate (cAMP) via a membrane bound receptor, inhibiting platelet aggregation and proliferation of vascular smooth muscle cells. In a mixed population of patients with idiopathic and secondary PAH, a decrease of urinary prostaglandin F1α, the metabolite of prostacyclin, was described 70. This might be explained due to decreased pulmonary activity of prostacyclin synthase, as was demonstrated in idiopathic PAH 71. Improved functional class, 6-minute walking distance and survival were described in patients with idiopathic PAH after administration of intravenous epoprostenol 72;73, a synthetic prostacyclin. Similar beneficial effects were described in patients with PAH associated with congenital heart disease 74. An important drawback 16

Chapter 1

Experimental animal models for PAH Although many treatment options seem to be effective, curative treatment for PAH still does not exist. Due to the expanding knowledge of pathophysiological pathways, more treatment possibilities arise. Representative animal models for PAH are needed in order to study pathophysiology and treatment effects in flow-associated PAH in the most reliable way. The most often used animal models are the monocrotaline rat model 81 and the hypoxic rat model 82, both of which lead to increased pulmonary pressure. Unfortunately, these models fail to induce the advanced lesions of PAH 81-84. The role of increased pulmonary blood flow in the pathogenesis of PAH has been explored in experimental models. One example of these models is a pig model, in which an anastomosis of the left subclavian artery to the pulmonary arterial trunk was created 85. In rats, an abdominal anastomosis between the aorta and caval vein has been used 86. Although the disease-inducing stimulus in these models may be more representative for the patient situation, they usually show only a mild increase in pulmonary arterial pressures and a limited increase in medial wall thickness without further associated remodeling 87-89. The combination of increased pulmonary arterial pressure caused by the injection of monocrotaline with increased pulmonary blood flow has been demonstrated to induce neointimal formation 90;91, mimicking characteristics of the typical pulmonary vascular remodeling in PAH. This combination of representative pulmonary vascular lesions and increased pulmonary blood flow makes this type of models especially suitable to study flow-associated PAH as is seen in patients with congenital heart defects.

17


of epoprostenol is that because of its short half-life, continuous intravenous administration is obligatory. A short interruption of delivery causes immediate problems for the patient. Furthermore, infections and thrombo-embolic events complicate the use of intravenous administration. These complications are especially threatening in patients with an intracardiac right-to-left shunt. Therefore, analogues with a longer half-life were developed. Treprostinil has a half life of 4 hours and can be delivered subcutaneously or intravenously. Both modes of delivery improve exercise tolerance and hemodynamics 75;76. Inhaled iloprost has a half-life of 20 to 30 minutes 77 . Improved hemodynamics and exercise were reported. Beraprost is a stable prostacyclin analogue suited for oral administration 78;79. Beneficial effects of this drug were mainly described during the early phases of treatment. Another vasoconstrictor involved in the pathogenesis of PAH is thromboxane 70;80. Its urinary metabolites are increased in patients with idiopathic and secondary PAH 70.

Aims of this thesis Aims of the current thesis are - to determine the prognostic value of serum markers for follow- up in children with pulmonary arterial hypertension - to develop an animal model with increased pulmonary blood flow and advanced pulmonary vascular lesions in order to specifically study flow- associated pulmonary arterial hypertension as is seen in patients with congenital heart defects - to characterize the pathological, hemodynamical and molecular consequences of the presence of increased pulmonary blood flow in this model - to determine the effects of therapeutic intervention on cardiac and pulmonary vascular remodeling in flow-associated pulmonary arterial hypertension - to establish new treatment targets for this disease. The presence of increased pulmonary blood flow separates patients with congenital heart disease from other patients with PAH. Chapter 2 highlights the specific characteristics of the patient with a congenital heart defect and PAH. It stresses the need for a good characterization and classification of the cardiac defects and pulmonary hemodynamics in these patients. Various biomarkers, as NT-proBNP, uric acid, norepinephrine and epinephrine are currently used for follow-up in patients with left heart failure and in adult PAH. Since follow-up in patients with PAH is mainly based on invasively determined hemodynamics and exercise testing, and both have their specific drawbacks in children, we studied the applicability of these markers in chapter 3 in the population of pediatric patients with PAH and congenital heart disease. In chapter 4 and 5, we describe and characterize an animal model with increased pulmonary blood flow that displays advanced pulmonary vascular lesions. The hemodynamical, morphological and histological characteristics of heart and lungs are studied in chapter 4, while the influence of increased pulmonary blood flow on a molecular level is described in chapter 5. In the chapters 6 to 8, we studied the effect of the vasodilating and antiproliferative agents iloprost, treprostinil and bosentan on hemodynamics and histopathology of the pulmonary vessels and right ventricle in this model of flow-associated PAH. Recently, the hematopoietic hormone erythropoietin has been studied for its beneficial effects on myocardial function in cardiac failure. In chapter 9, the effects of erythropoietin treatment on right ventricular function and pulmonary histopathology is determined. Chapter 10, the general discussion, summarizes this thesis. It provides future perspectives in the unraveling of the pathophysiology of PAH and on the development of new treatment strategies.

18


References 1.

Kidd L, Driscoll DJ, Gersony WM, Hayes CJ, Keane JF, O’Fallon WM, Pieroni DR, Wolfe RR, Weidman WH. Second natural history study of congenital heart defects. Results of treatment of patients with ventricular septal defects. Circulation. 1993;87:I38-I51.

2.

Duffels MG, Engelfriet PM, Berger RM, van Loon RL, Hoendermis E, Vriend JW, van der Velde ET, Bresser P, Mulder BJ. Pulmonary arterial hypertension in congenital heart disease: An epidemiologic perspective from a Dutch registry. Int J Cardiol. 2006.

3.

Diller GP, Gatzoulis MA. Pulmonary vascular disease in adults with congenital heart disease. Circulation. 2007;115:1039-1050.

4.

McLaughlin VV, McGoon MD. Pulmonary arterial hypertension. Circulation. 2006;114:1417-1431.

5.

Simonneau G, Galie N, Rubin LJ, Langleben D, Seeger W, Domenighetti G, Gibbs S, Lebrec D, Speich R, Beghetti M, Rich S, Fishman A. Clinical classification of pulmonary hypertension. J Am Coll Cardiol. 2004;43:5S-12S.

6.

Celermajer DS, Cullen S, Deanfield JE. Impairment of endothelium-dependent pulmonary artery relaxation in children with congenital heart disease and abnormal pulmonary hemodynamics. Circulation. 1993;87:440-446.

7.

Rudolph AM, Nadas AS. The pulmonary circulation and congenital heart disease. Considerations of the role of the pulmonary circulation in certain systemic-pulmonary communications. N Engl J Med. 1962;267:1022-1029.

8.

Ikawa S, Shimazaki Y, Nakano S, Kobayashi J, Matsuda H, Kawashima Y. Pulmonary vascular resistance during exercise late after repair of large ventricular septal defects. Relation to age at the time of repair. J Thorac Cardiovasc Surg. 1995;109:1218-1224.

9.

Hornberger LK, Sahn DJ, Krabill KA, Sherman FS, Swensson RE, Pesonen E, Hagen-Ansert S, Chung KJ. Elucidation of the natural history of ventricular septal defects by serial Doppler color flow mapping studies. J Am Coll Cardiol. 1989;13:1111-1118.

10. Steele PM, Fuster V, Cohen M, Ritter DG, McGoon DC. Isolated atrial septal defect with pulmonary vascular obstructive disease--long-term follow-up and prediction of outcome after surgical correction. Circulation. 1987;76:1037-1042. 11. Campbell M. Natural history of atrial septal defect. Br Heart J. 1970;32:820-826. 12. Craig RJ, Selzer A. Natural history and prognosis of atrial septal defect. Circulation. 1968;37:805815. 13. McLaughlin VV, Presberg KW, Doyle RL, Abman SH, McCrory DC, Fortin T, Ahearn G. Prognosis of pulmonary arterial hypertension: ACCP evidence-based clinical practice guidelines. Chest. 2004;126:78S-92S.

19

14. Wagenvoort CA, Mooi WJ. Plexogenic arteriopathy. In: Biopsy Pathology of the Pulmonary Vasculature. Munro Neville A, Walker F, Gottlieb LS, eds. 1989. Chapman and Hall Medical, London. 15. Redington AN, Rigby ML, Shinebourne EA, Oldershaw PJ. Changes in the pressure-volume relation of the right ventricle when its loading conditions are modified. Br Heart J. 1990;63:45-49. 16. Matthay RA, Arroliga AC, Wiedemann HP, Schulman DS, Mahler DA. Right ventricular function at rest and during exercise in chronic obstructive pulmonary disease. Chest. 1992;101:255S-262S. 17. Brooks H, Kirk ES, Vokonas PS, Urschel CW, Sonnenblick EH. Performance of the right ventricle under stress: relation to right coronary flow. J Clin Invest. 1971;50:2176-2183. 18. Rakusan K, Moravec J, Hatt PY. Regional capillary supply in the normal and hypertrophied rat heart. Microvasc Res. 1980;20:319-326. 19. Chin KM, Kim NH, Rubin LJ. The right ventricle in pulmonary hypertension. Coron Artery Dis. 2005;16:13-18. 20. Chen D, Zhao M, Mundy GR. Bone morphogenetic proteins. Growth Factors. 2004;22:233-241. 21. Deng Z, Morse JH, Slager SL, Cuervo N, Moore KJ, Venetos G, Kalachikov S, Cayanis E, Fischer SG, Barst RJ, Hodge SE, Knowles JA. Familial primary pulmonary hypertension (gene PPH1) is caused by mutations in the bone morphogenetic protein receptor-II gene. Am J Hum Genet. 2000;67:737744. 22. Lane KB, Machado RD, Pauciulo MW, Thomson JR, Phillips JA, III, Loyd JE, Nichols WC, Trembath RC. Heterozygous germline mutations in BMPR2, encoding a TGF-beta receptor, cause familial primary pulmonary hypertension. The International PPH Consortium. Nat Genet. 2000;26:81-84. 23. Roberts KE, McElroy JJ, Wong WP, Yen E, Widlitz A, Barst RJ, Knowles JA, Morse JH. BMPR2 mutations in pulmonary arterial hypertension with congenital heart disease. Eur Respir J. 2004;24:371-374. 24. Trembath RC, Thomson JR, Machado RD, Morgan NV, Atkinson C, Winship I, Simonneau G, Galie N, Loyd JE, Humbert M, Nichols WC, Morrell NW, Berg J, Manes A, McGaughran J, Pauciulo M, Wheeler L. Clinical and molecular genetic features of pulmonary hypertension in patients with hereditary hemorrhagic telangiectasia. N Engl J Med. 2001;345:325-334. 25. Harrison RE, Berger R, Haworth SG, Tulloh R, Mache CJ, Morrell NW, Aldred MA, Trembath RC. Transforming growth factor-beta receptor mutations and pulmonary arterial hypertension in childhood. Circulation. 2005;111:435-441. 26. Marcos E, Fadel E, Sanchez O, Humbert M, Dartevelle P, Simonneau G, Hamon M, Adnot S, Eddahibi S. Serotonin-induced smooth muscle hyperplasia in various forms of human pulmonary hypertension. Circ Res. 2004;94:1263-1270. 27. Eddahibi S, Humbert M, Fadel E, Raffestin B, Darmon M, Capron F, Simonneau G, Dartevelle P, Hamon M, Adnot S. Serotonin transporter overexpression is responsible for pulmonary artery smooth muscle hyperplasia in primary pulmonary hypertension. J Clin Invest. 2001;108:11411150.

20

Chapter 1

29. Mason NA, Springall DR, Burke M, Pollock J, Mikhail G, Yacoub MH, Polak JM. High expression of endothelial nitric oxide synthase in plexiform lesions of pulmonary hypertension. J Pathol. 1998;185:313-318. 30. Berger RM, Geiger R, Hess J, Bogers AJ, Mooi WJ. Altered arterial expression patterns of inducible and endothelial nitric oxide synthase in pulmonary plexogenic arteriopathy caused by congenital heart disease. Am J Respir Crit Care Med. 2001;163:1493-1499. 31. Demoncheaux EA, Higenbottam TW, Kiely DG, Wong JM, Wharton S, Varcoe R, Siddons T, Spivey AC, Hall K, Gize AP. Decreased whole body endogenous nitric oxide production in patients with primary pulmonary hypertension. J Vasc Res. 2005;42:133-136. 32. Xu W, Kaneko FT, Zheng S, Comhair SA, Janocha AJ, Goggans T, Thunnissen FB, Farver C, Hazen SL, Jennings C, Dweik RA, Arroliga AC, Erzurum SC. Increased arginase II and decreased NO synthesis in endothelial cells of patients with pulmonary arterial hypertension. FASEB J. 2004;18:17461748. 33. Girgis RE, Champion HC, Diette GB, Johns RA, Permutt S, Sylvester JT. Decreased exhaled nitric oxide in pulmonary arterial hypertension: response to bosentan therapy. Am J Respir Crit Care Med. 2005;172:352-357. 34. Morris CR, Kato GJ, Poljakovic M, Wang X, Blackwelder WC, Sachdev V, Hazen SL, Vichinsky EP, Morris SM, Jr., Gladwin MT. Dysregulated arginine metabolism, hemolysis-associated pulmonary hypertension, and mortality in sickle cell disease. JAMA. 2005;294:81-90. 35. Sastry BK, Narasimhan C, Reddy NK, Raju BS. Clinical efficacy of sildenafil in primary pulmonary hypertension: a randomized, placebo-controlled, double-blind, crossover study. J Am Coll Cardiol. 2004;43:1149-1153. 36. Galie N, Ghofrani HA, Torbicki A, Barst RJ, Rubin LJ, Badesch D, Fleming T, Parpia T, Burgess G, Branzi A, Grimminger F, Kurzyna M, Simonneau G. Sildenafil citrate therapy for pulmonary arterial hypertension. N Engl J Med. 2005;353:2148-2157. 37. Yanagisawa M, Kurihara H, Kimura S, Tomobe Y, Kobayashi M, Mitsui Y, Yazaki Y, Goto K, Masaki T. A novel potent vasoconstrictor peptide produced by vascular endothelial cells. Nature. 1988;332:411-415. 38. Rubanyi GM, Botelho LH. Endothelins. FASEB J. 1991;5:2713-2720. 39. Sakai S, Miyauchi T, Kobayashi M, Yamaguchi I, Goto K, Sugishita Y. Inhibition of myocardial endothelin pathway improves long-term survival in heart failure. Nature. 1996;384:353-355. 40. Ehrenreich H, Anderson RW, Fox CH, Rieckmann P, Hoffman GS, Travis WD, Coligan JE, Kehrl JH, Fauci AS. Endothelins, peptides with potent vasoactive properties, are produced by human macrophages. J Exp Med. 1990;172:1741-1748. 41. Wypij DM, Nichols JS, Novak PJ, Stacy DL, Berman J, Wiseman JS. Role of mast cell chymase in the extracellular processing of big-endothelin-1 to endothelin-1 in the perfused rat lung. Biochem Pharmacol. 1992;43:845-853.

21


28. Giaid A, Saleh D. Reduced expression of endothelial nitric oxide synthase in the lungs of patients with pulmonary hypertension. N Engl J Med. 1995;333:214-221.

42. Ito H, Hirata Y, Hiroe M, Tsujino M, Adachi S, Takamoto T, Nitta M, Taniguchi K, Marumo F. Endothelin-1 induces hypertrophy with enhanced expression of muscle-specific genes in cultured neonatal rat cardiomyocytes. Circ Res. 1991;69:209-215. 43. Ito H, Hirata Y, Adachi S, Tanaka M, Tsujino M, Koike A, Nogami A, Murumo F, Hiroe M. Endothelin-1 is an autocrine/paracrine factor in the mechanism of angiotensin II-induced hypertrophy in cultured rat cardiomyocytes. J Clin Invest. 1993;92:398-403. 44. Benatti L, Fabbrini MS, Patrono C. Regulation of endothelin-1 biosynthesis. Ann N Y Acad Sci. 1994;714:109-121. 45. Prins BA, Hu RM, Nazario B, Pedram A, Frank HJ, Weber MA, Levin ER. Prostaglandin E2 and prostacyclin inhibit the production and secretion of endothelin from cultured endothelial cells. J Biol Chem. 1994;269:11938-11944. 46. Arai H, Hori S, Aramori I, Ohkubo H, Nakanishi S. Cloning and expression of a cDNA encoding an endothelin receptor. Nature. 1990;348:730-732. 47. Sakurai T, Yanagisawa M, Takuwa Y, Miyazaki H, Kimura S, Goto K, Masaki T. Cloning of a cDNA encoding a non-isopeptide-selective subtype of the endothelin receptor. Nature. 1990;348:732735. 48. Pollock DM, Keith TL, Highsmith RF. Endothelin receptors and calcium signaling. FASEB J. 1995;9:1196-1204. 49. Ivy D, McMurtry IF, Yanagisawa M, Gariepy CE, Le Cras TD, Gebb SA, Morris KG, Wiseman RC, Abman SH. Endothelin B receptor deficiency potentiates ET-1 and hypoxic pulmonary vasoconstriction. Am J Physiol Lung Cell Mol Physiol. 2001;280:L1040-L1048. 50. Hirata Y, Emori T, Eguchi S, Kanno K, Imai T, Ohta K, Marumo F. Endothelin receptor subtype B mediates synthesis of nitric oxide by cultured bovine endothelial cells. J Clin Invest. 1993;91:13671373. 51. Dupuis J, Goresky CA, Fournier A. Pulmonary clearance of circulating endothelin-1 in dogs in vivo: exclusive role of ETB receptors. J Appl Physiol. 1996;81:1510-1515. 52. Shichiri M, Kato H, Marumo F, Hirata Y. Endothelin-1 as an autocrine/paracrine apoptosis survival factor for endothelial cells. Hypertension. 1997;30:1198-1203. 53. Seccia TM, Belloni AS, Kreutz R, Paul M, Nussdorfer GG, Pessina AC, Rossi GP. Cardiac fibrosis occurs early and involves endothelin and AT-1 receptors in hypertension due to endogenous angiotensin II. J Am Coll Cardiol. 2003;41:666-673. 54. Belloni AS, Rossi GP, Andreis PG, Neri G, Albertin G, Pessina AC, Nussdorfer GG. Endothelin adrenocortical secretagogue effect is mediated by the B receptor in rats. Hypertension. 1996;27:1153-1159. 55. Giaid A, Yanagisawa M, Langleben D, Michel RP, Levy R, Shennib H, Kimura S, Masaki T, Duguid WP, Stewart DJ. Expression of endothelin-1 in the lungs of patients with pulmonary hypertension. N Engl J Med. 1993;328:1732-1739.

22


56. Stewart DJ, Levy RD, Cernacek P, Langleben D. Increased plasma endothelin-1 in pulmonary hypertension: marker or mediator of disease? Ann Intern Med. 1991;114:464-469. 57. Rubens C, Ewert R, Halank M, Wensel R, Orzechowski HD, Schultheiss HP, Hoeffken G. Big endothelin-1 and endothelin-1 plasma levels are correlated with the severity of primary pulmonary hypertension. Chest. 2001;120:1562-1569. 58. Galie N, Grigioni L, Bacchi-Reggiani L, Ussia G, Parlangeli R, and Catanzariti P. Relation of Endothelin-1 to Survival in Patients With Primary Pulmonary Hypertension. Eur J Clin Invest 26, 12S. 2006. 59. Cacoub P, Dorent R, Maistre G, Nataf P, Carayon A, Piette C, Godeau P, Cabrol C, Gandjbakhch I. Endothelin-1 in primary pulmonary hypertension and the Eisenmenger syndrome. Am J Cardiol. 1993;71:448-450. 60. Yoshibayashi M, Nishioka K, Nakao K, Saito Y, Matsumura M, Ueda T, Temma S, Shirakami G, Imura H, Mikawa H. Plasma endothelin concentrations in patients with pulmonary hypertension associated with congenital heart defects. Evidence for increased production of endothelin in pulmonary circulation. Circulation. 1991;84:2280-2285. 61. Ishikawa S, Miyauchi T, Sakai S, Ushinohama H, Sagawa K, Fusazaki N, Kado H, Sunagawa H, Honda S, Ueno H. Elevated levels of plasma endothelin-1 in young patients with pulmonary hypertension caused by congenital heart disease are decreased after successful surgical repair. J Thorac Cardiovasc Surg. 1995;110:271-273. 62. Channick RN, Simonneau G, Sitbon O, Robbins IM, Frost A, Tapson VF, Badesch DB, Roux S, Rainisio M, Bodin F, Rubin LJ. Effects of the dual endothelin-receptor antagonist bosentan in patients with pulmonary hypertension: a randomised placebo-controlled study. Lancet. 2001;358:1119-1123. 63. Sitbon O, Badesch DB, Channick RN, Frost A, Robbins IM, Simonneau G, Tapson VF, Rubin LJ. Effects of the dual endothelin receptor antagonist bosentan in patients with pulmonary arterial hypertension: a 1-year follow-up study. Chest. 2003;124:247-254. 64. Rubin LJ, Badesch DB, Barst RJ, Galie N, Black CM, Keogh A, Pulido T, Frost A, Roux S, Leconte I, Landzberg M, Simonneau G. Bosentan therapy for pulmonary arterial hypertension. N Engl J Med. 2002;346:896-903. 65. Schulze-Neick I, Gilbert N, Ewert R, Witt C, Gruenig E, Enke B, Borst MM, Lange PE, Hoeper MM. Adult patients with congenital heart disease and pulmonary arterial hypertension: first open prospective multicenter study of bosentan therapy. Am Heart J. 2005;150:716. 66. Barst RJ, Langleben D, Frost A, Horn EM, Oudiz R, Shapiro S, McLaughlin V, Hill N, Tapson VF, Robbins IM, Zwicke D, Duncan B, Dixon RA, Frumkin LR. Sitaxsentan therapy for pulmonary arterial hypertension. Am J Respir Crit Care Med. 2004;169:441-447. 67. Galie N, Badesch D, Oudiz R, Simonneau G, McGoon MD, Keogh AM, Frost AE, Zwicke D, Naeije R, Shapiro S, Olschewski H, Rubin LJ. Ambrisentan therapy for pulmonary arterial hypertension. J Am Coll Cardiol. 2005;46:529-535.

23

68. Ozaki S, Ohwaki K, Ihara M, Ishikawa K, Yano M. Coexpression studies with endothelin receptor subtypes indicate the existence of intracellular cross-talk between ET(A) and ET(B) receptors. J Biochem (Tokyo). 1997;121:440-447. 69. Jasmin JF, Lucas M, Cernacek P, Dupuis J. Effectiveness of a nonselective ET(A/B) and a selective ET(A) antagonist in rats with monocrotaline-induced pulmonary hypertension. Circulation. 2001;103:314-318. 70. Christman BW, McPherson CD, Newman JH, King GA, Bernard GR, Groves BM, Loyd JE. An imbalance between the excretion of thromboxane and prostacyclin metabolites in pulmonary hypertension. N Engl J Med. 1992;327:70-75. 71. Tuder RM, Cool CD, Geraci MW, Wang J, Abman SH, Wright L, Badesch D, Voelkel NF. Prostacyclin synthase expression is decreased in lungs from patients with severe pulmonary hypertension. Am J Respir Crit Care Med. 1999;159:1925-1932. 72. Barst RJ, Rubin LJ, Long WA, McGoon MD, Rich S, Badesch DB, Groves BM, Tapson VF, Bourge RC, Brundage BH. A comparison of continuous intravenous epoprostenol (prostacyclin) with conventional therapy for primary pulmonary hypertension. The Primary Pulmonary Hypertension Study Group. N Engl J Med. 1996;334:296-302. 73. Sitbon O, Humbert M, Nunes H, Parent F, Garcia G, Herve P, Rainisio M, Simonneau G. Long-term intravenous epoprostenol infusion in primary pulmonary hypertension: prognostic factors and survival. J Am Coll Cardiol. 2002;40:780-788. 74. Rosenzweig EB, Kerstein D, Barst RJ. Long-term prostacyclin for pulmonary hypertension with associated congenital heart defects. Circulation. 1999;99:1858-1865. 75. Simonneau G, Barst RJ, Galie N, Naeije R, Rich S, Bourge RC, Keogh A, Oudiz R, Frost A, Blackburn SD, Crow JW, Rubin LJ. Continuous subcutaneous infusion of treprostinil, a prostacyclin analogue, in patients with pulmonary arterial hypertension: a double-blind, randomized, placebo-controlled trial. Am J Respir Crit Care Med. 2002;165:800-804. 76. Tapson VF, Gomberg-Maitland M, McLaughlin VV, Benza RL, Widlitz AC, Krichman A, Barst RJ. Safety and efficacy of IV treprostinil for pulmonary arterial hypertension: a prospective, multicenter, open-label, 12-week trial. Chest. 2006;129:683-688. 77. Olschewski H, Simonneau G, Galie N, Higenbottam T, Naeije R, Rubin LJ, Nikkho S, Speich R, Hoeper MM, Behr J, Winkler J, Sitbon O, Popov W, Ghofrani HA, Manes A, Kiely DG, Ewert R, Meyer A, Corris PA, Delcroix M, Gomez-Sanchez M, Siedentop H, Seeger W. Inhaled iloprost for severe pulmonary hypertension. N Engl J Med. 2002;347:322-329. 78. Galie N, Humbert M, Vachiery JL, Vizza CD, Kneussl M, Manes A, Sitbon O, Torbicki A, Delcroix M, Naeije R, Hoeper M, Chaouat A, Morand S, Besse B, Simonneau G. Effects of beraprost sodium, an oral prostacyclin analogue, in patients with pulmonary arterial hypertension: a randomized, double-blind, placebo-controlled trial. J Am Coll Cardiol. 2002;39:1496-1502. 79. Barst RJ, McGoon M, McLaughlin V, Tapson V, Rich S, Rubin L, Wasserman K, Oudiz R, Shapiro S, Robbins IM, Channick R, Badesch D, Rayburn BK, Flinchbaugh R, Sigman J, Arneson C, Jeffs R. Beraprost therapy for pulmonary arterial hypertension. J Am Coll Cardiol. 2003;41:2119-2125.

24

Chapter 1

81. Meyrick B, Gamble W, Reid L. Development of Crotalaria pulmonary hypertension: hemodynamic and structural study. Am J Physiol. 1980;239:H692-H702. 82. Rabinovitch M, Gamble W, Nadas AS, Miettinen OS, Reid L. Rat pulmonary circulation after chronic hypoxia: hemodynamic and structural features. Am J Physiol. 1979;236:H818-H827. 83. Stenmark KR, Fasules J, Hyde DM, Voelkel NF, Henson J, Tucker A, Wilson H, Reeves JT. Severe pulmonary hypertension and arterial adventitial changes in newborn calves at 4,300 m. J Appl Physiol. 1987;62:821-830. 84. Perkett EA, Brigham KL, Meyrick B. Continuous air embolization into sheep causes sustained pulmonary hypertension and increased pulmonary vasoreactivity. Am J Pathol. 1988;132:444-454. 85. Rondelet B, Kerbaul F, Motte S, van Beneden R, Remmelink M, Brimioulle S, McEntee K, Wauthy P, Salmon I, Ketelslegers JM, Naeije R. Bosentan for the prevention of overcirculation-induced experimental pulmonary arterial hypertension. Circulation. 2003;107:1329-1335. 86. Garcia R, Diebold S. Simple, rapid, and effective method of producing aortocaval shunts in the rat. Cardiovasc Res. 1990;24:430-432. 87. Rondelet B, Kerbaul F, Motte S, van Beneden R, Remmelink M, Brimioulle S, McEntee K, Wauthy P, Salmon I, Ketelslegers JM, Naeije R. Bosentan for the prevention of overcirculation-induced experimental pulmonary arterial hypertension. Circulation. 2003;107:1329-1335. 88. Dai ZK, Tan MS, Chai CY, Chen IJ, Jeng AY, Wu JR. Effects of increased pulmonary flow on the expression of endothelial nitric oxide synthase and endothelin-1 in the rat. Clin Sci (Lond). 2002;103 Suppl 48:289S-293S. 89. Lam CF, Peterson TE, Croatt AJ, Nath KA, Katusic ZS. Functional adaptation and remodeling of pulmonary artery in flow-induced pulmonary hypertension. Am J Physiol Heart Circ Physiol. 2005;289:H2334-H2341. 90. Tanaka Y, Schuster DP, Davis EC, Patterson GA, Botney MD. The role of vascular injury and hemodynamics in rat pulmonary artery remodeling. J Clin Invest. 1996;98:434-442. 91. Okada K, Tanaka Y, Bernstein M, Zhang W, Patterson GA, Botney MD. Pulmonary hemodynamics modify the rat pulmonary artery response to injury. A neointimal model of pulmonary hypertension. Am J Pathol. 1997;151:1019-1025.

25


80. Morecroft I, Heeley RP, Prentice HM, Kirk A, MacLean MR. 5-hydroxytryptamine receptors mediating contraction in human small muscular pulmonary arteries: importance of the 5-HT1B receptor. Br J Pharmacol. 1999;128:730-734.

Chapter 2 Pulmonary arterial hypertension in congenital heart disease: the need for refinement of the Evian-Venice classification

Mirjam E. van Albada, Rolf M.F. Berger

Submitted

Abstract Pulmonary hypertension associated with congenital systemic-to-pulmonary shunts has been classified in the Evian-Venice classification as pulmonary arterial hypertension (PAH), which includes a heterogeneous group of conditions. Emerging treatment options for patients with PAH are mostly investigated in those with idiopathic PAH but may also improve quality of life and survival in patients with congenital heart disease and PAH. However, despite the evident similarities in pulmonary vascular disease, important differences have to be recognized between patients with PAH associated with systemic-to-pulmonary shunts and those with other conditions. Patients with pulmonary hypertension associated with congenital heart disease form a rather heterogeneous patient population in which generalization is hazardous. Specific considerations with respect to cardiac diagnosis, prognosis, evolution of pulmonary vascular disease and circulatory physiology have to be made in the individual patient, before embarking on new medical treatment strategies. This review highlights the features that require specific attention in these patients. Further, the currently available data on effectiveness of new PAH-drugs in Eisenmenger patients will be discussed shortly.

28

Chapter 2

Introduction

29

Pulmonary arterial hypertension in congenital heart disease: the need for refinement of the Evian-Venice classification

Pulmonary hypertension is characterized by an increased pulmonary arterial pressure (PAP), defined as a mean PAP > 25 mmHg in rest or > 30 mmHg during exercise 1, and may be a symptom of a variety of underlying conditions. During the successive World Symposia on Pulmonary Hypertension in Evian (1998) and Venice (2003), pulmonary hypertension was classified into 5 clinical categories, based on similarities in pathophysiological mechanisms, clinical presentation, and therapeutic options (table 1) 2. The first category, pulmonary arterial hypertension (PAH), includes a heterogeneous group of conditions, all sharing a typical pulmonary vascular disease that is assumed to have common characteristics regarding morphological findings, clinical presentation and responsiveness to therapy. Meanwhile, these characteristics distinguish PAH from the other 4 categories of pulmonary hypertension. In a complex disease as pulmonary hypertension, occurring in a relatively limited number of patients, such classification, although inevitably associated with limitations, has proven to be of utmost importance in the communication about individual patients, in standardizing diagnosis and treatment, in conducting trials with homogeneous groups of patients, and in analyzing novel pathobiological abnormalities in well-characterized patient populations. PAH associated with congenital systemic-to-pulmonary shunts is, according to the Evian/Venice classification, assigned to the category of PAH 2. Patients with pulmonary hypertension associated with congenital heart disease (CHD) are a growing population and form a rather heterogeneous group in which simplification may be hazardous and misleading. The one typical patient with this condition does not exist: patients with cardiac defects with systemic-to-pulmonary shunts and pulmonary hypertension distinguish themselves from patients with cardiac defects without those shunts. Patients with restrictive shunts will have a different natural history compared to patients with non-restrictive shunts. This applies to not only the natural history of the heart defect and the risk for development of pulmonary hypertension, but also to prognosis, once pulmonary hypertension is established. Similarly, patients in which the original shunt is surgically closed will face other sequels of PAH than patients in which it was not closed. It is obvious that these different types of patients cannot be regarded as one single group, when discussing or evaluating treatment options 3;4. Thus, although the Evian/Venice classification has introduced a standardized approach to pulmonary hypertension, which can be regarded as a major achievement, it may not be sufficiently customized for its application to patients in which pulmonary hypertension co-occurs with CHD. In these patients, additional specific considerations have to be made before decisions on diagnosis and treatment can be taken into account. This review highlights several aspects of clinical presentation, diagnosis and treatment that require specific attention in patients with pulmonary hypertension and CHD.

Table 1. Clinical Classification of Pulmonary Hypertension, Third World Congress on PAH, Clinical2003 Venice Classification of Pulmonary Hypertension, Third World Congress on PAH, Venice 2003 1. Pulmonary Arterial Hypertension Idiopathic pulmonary hypertension Sporadic disorder Familial disorder Related conditions Collagen vascular disease Congenital systemic-to-pulmonary shunt Portal hypertension Human Immunodeficiency Virus infection Drugs and toxins Anorectic agents (appetite suppressants) Persistent Pulmonary Hypertension of the Newborn Associated with significant venous or capillary involvement 2. Pulmonary Venous Hypertension Left-sided atrial or ventricular heart disease Left-sided valvular heart disease Pulmonary venous obstruction 3. Pulmonary Hypertension associated with disorders of the respiratory system and/or hypoxemia Chronic obstructive pulmonary disease Interstitial lung disease Sleep-disordered breathing Alveolar hypoventilation disorders 4. Pulmonary Hypertension resulting from Chronic Thrombotic and/or Embolic Disease Thromboembolic obstruction of proximal pulmonary arteries Thromboembolic obstruction of distal pulmonary arteries Non-thrombotic pulmonary embolism 5. Pulmonary Hypertension resulting from disorders directly affecting the pulmonary vasculature e.g. schistosomiasis, sarcoidosis, histiocytosis X, lymphangiomatosis Compression of pulmonary vessels (tumor, fibrosing mediastinitis, adenopathy)

30

Chapter 2

Classification rationale

Pulmonary vascular pathology All forms of PAH have a common, characteristic histopathological pattern of vascular remodeling that was first recognized in patients with large systemic-to-pulmonary shunts 5. This typical remodeling process was called plexogenic arteriopathy, indicating the potency to develop the characteristic plexiform lesion, that is unique for PAH. The vascular lesions are characterized by increased muscularization of muscular arteries and extension of muscularization to normally non-muscularized arterioles. This is followed by typical intimal lesions, including concentric laminar intimal fibrosis and plexiform lesions, leading to occlusion of small arteries, and associated with progressive and irreversible disease. The latter lesions do not occur in other forms of pulmonary hypertension 5. Clinical course PAH shows a progressive, ultimately fatal course. However, the time path in congenital shunts differs significantly from other forms 6. In children with CHD associated with a non-restrictive left-to-right shunt, PAH initially appears to be reversible when the shunt can be closed timely and adequately 4. It is the only form of PAH in which a reversible stage can be clinically recognized. Only after a certain time period, that may vary widely in individuals, a point of no return will be reached, where the pulmonary arteriopathy will be progressive even after correction of the defect. Ultimately, when pulmonary vascular resistance (PVR) has increased to systemic level in the unoperated patient, the original left-to-right shunt will reverse in a right-to-left shunt, leading to cyanosis. This condition is called the Eisenmenger syndrome. Life-expectancy in Eisenmenger patients is far more favourable than in other forms of PAH. In contrast to idiopathic PAH (iPAH), for which - untreated - median sur31


Pulmonary hypertension associated with CHD is a misleading and mal-used terminology. This terminology, frequently used in recent literature, is confusing and hampers appropriate clinical decision making and adequate research. In patients with CHD, different types of heart defects and different types of pulmonary hypertension may occur, each of these requiring a specific approach. It is therefore essential in patients with so-called “pulmonary hypertension associated with CHD” to describe in detail the anatomy of the cardiac anomaly, the medical history including previous interventions and present co-morbidity, including left ventricular function, thrombo-embolic events, respiratory or pulmonary complications and medication use. Also in these patients it is important to search for the underlying condition that causes the pulmonary vascular disease, since that cause may not always be the presence of the heart defect per se. The rationale for classifying a heterogeneous group of diseases into one group was the presumption of common characteristics regarding morphological findings, clinical course and responsiveness to therapy. How does this hold for PAH associated with congenital systemic-to-pulmonary shunts?

vival is 2.8 years, the median survival for Eisenmenger patients may be 40-50 years of age 7. It is clear that this contrast in survival must be taken into account when interpreting outcomes of clinical trials with mixed patient populations and when assessing the cost-effect balance of treatment options. Responsiveness to treatment Although at the time of the conception of the Evian-classification definite similarities between the different forms of PAH had been recognized justifying a common classification into one group, it is surprising that this criterium was introduced. At that time, limited data were available regarding response to therapy in different forms of PAH. Most of these were derived from patients with idiopathic PAH, where the differences between PAH associated with congenital systemic-to-pulmonary shunts and other forms of PAH could be expected to affect the response to therapy. No reliable data for Eisenmenger patients were available at that time.

Variation in structural heart defects and its implications Evolution of pulmonary vascular disease may differ in patients with congenital heart defects depending on the type of the underlying cardiac lesion. It appears that increased pulmonary blood flow is obligatory in the development of PAH. In patients with structural congenital heart disease not associated with increased pulmonary blood flow, characteristic PAH does not develop. Other forms of pulmonary hypertension should be considered. The hemodynamic condition in which both an increased PAP and an increased pulmonary blood flow are present is detrimental to the pulmonary vascular bed 8. This situation occurs in patients with a non-restrictive left-to-right shunt at post-tricuspid level. They develop irreversible - and progressive - pulmonary vascular disease in the first years of life in more than 50% of the cases 4;9, resulting in Eisenmenger syndrome. Examples of these lesions are large ventricular septal defects, atrio-ventricular septal defects or univentricular hearts. Obviously, an additional right sided obstructive lesion in these defects, such as pulmonary stenosis, may reduce pulmonary blood flow and pressure and will potentially prevent or delay the development of pulmonary vascular disease. In cardiac lesions with a left-to-right shunt at the pre-tricuspid level, with an isolated increase in pulmonary blood flow, pulmonary vascular disease develops significantly less often and much later in life. Untreated, only 10 to 20% of patients with a hemodynamic important atrial septal defect will eventually develop pulmonary vascular disease, mostly in the 3rd or 4th decade 3. A similar situation may occur in patients with a shunt at post-tricuspid level that is limited in size and therefore restrictive. Then, the pulmonary vascular bed is not exposed to systemic arterial pressure and the development of pulmonary vascular disease will be prevented or delayed. The optimal prevention of progression of pulmonary vascular disease in congenital 32


33

Chapter 2

heart defects is surgical correction of the original defect. When surgery is correctly timed and successful, early pulmonary vascular disease will regress. After a certain point of no return, pulmonary vascular remodeling will progress even after closure of the original cardiac defect. In other words, the possibility for surgical closure of the defect is determined by the developmental stage of the disease process. Thus, timing of correction is critical. Once advanced pulmonary vascular disease has developed, the temptation to close a present defect should be resisted. Closure in such patients will have detrimental effects. In general, patients with a closed defect combined with advanced PAH have a worse outcome than patients with Eisenmenger physiology 10, because the pulmonary vascular disease will continue to progress while the subpulmonary ventricle misses the opportunity to unload and cardiac output can not be maintained. Patients may have a residual shunt after correction of their cardiac defect. The consequences of this shunt depend on its quantity, location (pre- or post-tricuspid) and whether it is restrictive or non-restrictive. As a rule of thumb, in contrast to a nonrestrictive shunt, restrictive shunt physiology is not believed to contribute considerably to further progression of the disease. An exceptional challenge is formed by the functional univentricular heart. These patients eventually require a so-called “Fontan-circulation” as final palliation, where systemic venous return is directed to the lungs without an interposed ventricular pump 11. Consequently, the slightest increase in PVR can jeopardize the total circulation. The type and size of the cardiac defect may not be the only determinants of the pulmonary vascular disease severity in CHD. Of the patients with non-restrictive, post-tricuspid shunts, some develop accelerated end-stage plexogenic arteriopathy, whereas others show delayed or no development of advanced PAH. Of the patients with pre-tricuspid shunts, only 10 to 20% will eventually develop PAH. These epidemiologic observations suggest an individual susceptibility in these patients 12. Genetic factors, such as mutations in the bone morphogenetic protein receptor type 2, activin-like kinase type 1, or the 5-hydroxy tryptamine transporter might play a role in this individual susceptibility 13. Moreover, children with Down’s syndrome and CHD are believed to develop PAH more frequently and at an earlier stage than non-Down children with comparable heart defects 14, suggesting an increased susceptibility in patients with trisomy 21. In patients with a cardiac defect with mild hemodynamic consequences, the question should always remain whether this defect is the cause of the pulmonary vascular disease or if the patient may have another type of PAH independent of the cardiac abnormality. Based on these considerations in patients with pulmonary hypertension associated with CHD, a checklist for characterization of these patients is proposed in table 2.

Table 2. Characterization Characterization of Pulmonary of Pulmonary Hypertension Hypertension associated associated with with Congenital Congenital HeartHeart Disease Disease Presence of a systemic-to-pulmonary shunt Yes / No Previously (age, duration) (the presence of such a shunt - at present or in history - is a prerequisite for the diagnosis PAH. If such shunt has never been present, the patient suffers from another form of pulmonary hypertension ) Location of the shunt Pre-tricuspid level (ASD, SVD, APVD) Post-tricuspid level (VSD, PDA, UVH) Direction of the shunt Systemic-to-pulmonary Pulmonary-to-systemic Bidirectional Size of defect (Anatomical and functional, both at present and at early age): Quantification of the shunt (Qp :Qs) Restriction: is there a pressure drop over the (post-tricuspid) defect. Repair status Correction shunt (age) Pulmonary banding (age, duration) Surgical shunts (Pott’s, Waterston, Blalock-Taussig; at present or previously; age, duration) Residual shunts (quantification, location) Associated cardiac anomalies Affecting pulmonary hemodynamics (e.g. pulmonary stenosis) Affecting pulmonary venous outflow (e.g. cor triatriatum, MS, LVD) Affecting ventricular function and/or cardiac output

NB. A full description of pulmonary hemodynamics at present and - if available - at early age is recommended, as is a full patient history regarding surgical interventions and timelines, in order to fully establish the impact of the heart defect on the development of pulmonary arteriopathy. ASD, atrial septal defect; SVD, sinus venosus defect; APVD, abnormal pulmonary venous drainage; VSD, ventricular septal defect; PDA, persistent arterial duct; UVH, univentricular heart; Qp, pulmonary blood flow; Qs, systemic blood flow; MS, mitral stenosis; LVD, left ventricular dysfunction.

34

Chapter 2

Current therapies

Supportive therapy Adequate supportive care in patients with Eisenmenger syndrome is symptomatic and directed at avoiding or treating harmful interventions, complications associated with hypoxia, hematological/hemostatic abnormalities, rhythm disturbances, 35


Until ten to fifteen years ago, no therapy, other than of supportive nature, was available for PAH. In the last decade, however, insight in pathobiological mechanisms of the disease has evolved and a growing number of disease specific therapies is becoming available. Although not curative, these drug therapies have been demonstrated to improve outcome in patients with PAH. Therapies include different prostacyclin-analogues, dual or selective endothelin receptor antagonists and phospho diesterase-5 inhibitors. In the majority of cases, clinical trials included patients with iPAH. The beneficial effects of therapies in iPAH, however, can not be automatically translated to patients with PAH associated with systemic-to-pulmonary shunts. Reasons for this include differences in the nature of the heart disease, the evolution of pulmonary vascular disease, the variable prognosis, as discussed before, but also the circulatory pathophysiology of different intracardiac shunts and its consequences for vasodilating therapy and, finally, the multi-organ involvement in Eisenmenger syndrome. Therefore, it is extremely important to describe the congenital heart defect in detail, the state of correction and its functional hemodynamic consequences, before one can adequately assess potential treatment options. For example, in patients with nonrestrictive post-tricuspid shunts, the direction and magnitude of the shunt flow directly depend on the ratio of pulmonary and systemic vascular resistance. Since a truly selective pulmonary vasodilator does not exist, this has direct consequences for the effect of potentially vasodilating agents: when the vasodilating effect on the systemic vasculature is more pronounced than on the pulmonary vasculature, the neteffect will be increased right-to-left shunting, progressive hypoxemia and clinical deterioration of the patient. This is in contrast to patients with pre-tricuspid shunts, in which the shunt flow is a mainly diastolic phenomenon and depends mostly on the diastolic properties of both ventricles. Although patients with congenital heart defects have been included in several large trials, insufficiently powered numbers and lack of appropriate definition of the heart defects hampered interpretation of the results for this specific patient group 15-17. The Eisenmenger syndrome, when defined as all systemic-to-pulmonary shunts leading to PAH and resulting in a reversed or bidirectional shunt 18, also comprises a heterogeneous group, including pre- and post-tricuspid shunts. For reasons of homogeneity, the authors prefer to use the term true Eisenmenger syndrome for those patients with non-restrictive, post-tricuspid systemic-to-pulmonary shunts, in which increased PVR has resulted in reversal of the shunt. In the following we will discuss the considerations regarding conventional and new therapies in this specific group.

infection and congestive heart failure. Although this care has been the hallmark for the treatment of these patients for over 40 years, virtually no reliable studies on the effects of this approach, including diuretics, oxygen therapy or digoxin, have been performed. Consequently, it may not be surprising that the use of oxygen suppletion and digoxin in Eisenmenger patients is controversial. These agents are generally prescribed based on the patients well being or the physicians opinion. Diuretics are thought to be beneficial in the treatment of patients with right ventricular failure and systemic venous congestion. Care should be taken not to dehydrate patients too much, since they depend on their preload for adequate circulation. Furthermore, increasing hyperviscosity might lead to the occurrence of thromboembolic events. Eisenmengers are especially sensitive to small changes in temperature and dehydration, leading to increased right-to-left shunting. Therefore, diuretics in Eisenmenger patients should be used with great care 10. The use of phlebotomy in patients with hyperviscosity is controversial. Phlebotomy with fluid replacement may alleviate symptoms of hyperviscosity due to erythrocytosis in Eisenmenger syndrome. However, frequent use will lead to iron depletion, resulting in relative microcytic anemia, often unrecognized because haemoglobin levels are still elevated but low in relation to the magnitude of hypoxemia. The microcytic erythrocytes are believed to increase the risk for cerebrovascular accidents. The use of frequent phlebotomy in Eisenmenger should therefore be discouraged and, if at all, should be directed by symptoms of hyperviscosity rather than hematocrit levels. Iron suppletion and adequate hydration are mandatory 10. Finally, the risk-benefit ratio of elective, non-cardiac surgery should be weighed carefully in these patients, since they can be particular susceptible to relatively small disturbances in their fragile hemodynamic, ventilatory and haematological balance. These interventions should preferably be performed in centers that are familiar with Eisenmenger-specific requirements. Anti-coagulation Anti-coagulation therapy has shown to be beneficial in patients with iPAH 19;20. However, the cyanotic patients with Eisenmenger experience increased general bleeding tendency and abnormal platelet count and function. About 3 to 10% of mortality in Eisenmenger patients has been suggested to be related to haemoptysis 7 , which seems to be clinically more important than in iPAH. Therefore, the use of anticoagulation has been considered contra-indicated in these patients for a long time. Paradoxically, clinical evidence exist of a local prothrombotic state at the pulmonary endothelium of Eisenmenger patients, as demonstrated by a variety of procoagulant biochemical aberrations 21. Silversides et al 22 showed in a retrospective study the presence of chronic proximal pulmonary thrombi in one fifth of patients with Eisenmenger syndrome. These data indicate the need to reconsider the use of anticoagulants in Eisenmenger syndrome. Clinical investigations focused on this topic are needed.

36

Endothelin receptor antagonists Controlled trials on the use of the oral dual endothelin receptor antagonist, bosentan, have demonstrated beneficial effects on exercise capacity, hemodynamics and the combined end-point “time to clinical worsening” in patients with iPAH 29;30. The rationale for endothelin-antagonist therapy in patients with Eisenmenger syndrome has been nicely reviewed 31. Recently, the first randomized placebo-controlled clinical trial in patients with Eisenmenger physiology, that included patients with pre- and post-tricuspid shunts, showed that bosentan did not worsen hypoxemia, but increased exercise capacity and decreased PVR after sixteen weeks of treatment 32. Results of an open label extension study showed that improved functional class and exercise capacity were still present after 40 weeks of treatment 33. Long 37


Prostacyclins Intravenous epoprostenol has been demonstrated to improve functional class, exercise capacity, hemodynamics and survival in patients with iPAH 25. Data on the use of intravenous epoprostenol in patients with PAH caused by congenital cardiac lesions are derived from observational studies, where patients were included with various types of defects in various states of correction. These studies showed improved hemodynamics and exercise tolerance after one year of treatment 26;27. There is only one small patient series studying the effect in patients with true Eisenmenger physio logy 28 that showed beneficial effects regarding hemodynamics and exercise tolerance. However, adverse effects were noted, such as cerebrovascular accidents, pro bably related to the central venous catheter in the presence of a right-to-left shunt. Because of a median survival of 40-50 years of age in patients with Eisenmenger syndrome, the risk-benefit ratio of continuous intravenous epoprostenol therapy will be different from patients with iPAH. Data on the efficacy in Eisenmenger patients are too limited to permit conclusions of their benefits on the long term in this specific patient population. The efficacy of prostacyclin analogues, such as inhaled iloprost or subcutaneous treprostinil, conceptual attractive because their modes of delivery, has not been sufficiently studied in this specific patient group.

Chapter 2

Calcium-antagonists Increased survival has been reported in those patients with iPAH who showed a response to acute pulmonary vasodilating testing during cardiac catheterization, and were subsequently treated with high dose calcium-channel blockers 20. However, systemic vasodilators such as calcium-channel blockers should be given with caution as they may induce hypotension and increase right-to-left shunting, as pointed out previously. In patients that do not respond to vasodilators, treatment with calcium antagonists is considered contra-indicated because of adverse effects. Eisenmenger patients are per definition unable to fulfil the definitions of acute responder, especially according to the new consensus definition described by Sitbon et al 23. Although beneficial hemodynamic effects have been occasionally described in children with Eisenmenger syndrome 24, in general this therapy has not been accepted by the experts for the use in these patients.

term results will have to show whether this effect is lasting and whether bosentan will be able to persistently improve quality of life and survival in these patients. A selective antagonist of the endothelin receptor type A, sitaxsentan, has shown to improve exercise capacity and hemodynamics in placebo-controlled trials, including patients with PAH associated with CHD 34. However, again because definition of the associated heart defect lacked, no conclusion can be drawn concerning the effect of sitaxsentan in patients with Eisenmenger syndrome. Phosphodiesterase-5 inhibitors Sildenafil, a potent and highly specific phosphodiesterase-5 inhibitor, was demonstrated to improve functional class, exercise capacity and hemodynamics in patients with iPAH 35. Preliminary data on the efficacy of two 5-phosphodiesterase inhibitors (sildenafil and tadalafil), from different reports, suggest beneficial effects in patients with Eisenmenger physiology 36-38. These results indicate that 5-phosphodiesterase inhibition may be a promising therapy, warranting further study in this subgroup of patients. Combination therapy The various groups of drugs target different pathobiological pathways. Combination of these drugs therefore may have synergistic effects. On the other hand one should be cautious with regard to potential toxicity and interaction of the agents. Although studies are under way, at present data suggesting the additional value of combination therapy in PAH are scarce, but non-existing in patients with Eisenmenger syndrome. Transplantation Lung transplantation, generally reserved for patients failing other therapies, has been successful in patients with iPAH 39;40. Lung transplantation is limited by donor availability, the occurrence of graft rejection, bronchiolitis obliterans and complications of immunosuppressive therapy. For selected patients with Eisenmenger syndrome, lung transplantation with repair of the cardiac defect or combined heart-lung transplantation may improve quality of life and possibly survival. However, with a 10 year survival rate below 50% after combined heart-lung transplantation, the majority of Eisenmenger patients will have better survival prospects without transplantation. The difficulties in clinical decision making regarding timing of transplantation in these patients are emphasized by reports from Charman et al 41 and Waddell et al 42.

Conclusion At present, patients with progressive, advanced pulmonary arterial hypertension associated with congenital heart defects, including Eisenmenger syndrome, can not 38


39

Chapter 2

be cured. However, appropriate conventional management can reduce morbidity and mortality in these patients. The rapidly increasing knowledge of pathobiological mechanisms and new treatment options, largely obtained from patients with iPAH, are expected to be of great value also for these patients. However, despite various similarities, important differences have to be recognized between iPAH and PAH associated with systemic-to-pulmonary shunts. The emergence of these new treatment options and its applications in patients with PAH associated with CHD, have clearly emphasized the urgent need for an appropriate classification of these patients. The Evian-Venice classification for pulmonary hypertension has been a major achievement in the approach of patients with pulmonary hypertension. However, it does not fully acknowledge the complex hemodynamic, constitutional and pathophysiological interactions in CHD. The heterogeneity of congenital heart defects and its functional consequences require a customized (sub-)classification including a detailed description of the anatomy of the heart defect, the state of surgical repair and its functional hemodynamic consequences. Such clinical phenotype is of crucial importance for a correct diagnosis regarding the nature of the pulmonary vascular disease associated with the specific heart defect, for appropriate risk stratification and clinical decision making in the individual patient and finally, but not less important, for adequate design and interpretation of clinical research in this heterogeneous group of patients.

References 1.

Rich S, Dantzker DR, Ayres SM, Bergofsky EH, Brundage BH, Detre KM, Fishman AP, Goldring RM, Groves BM, Koerner SK. Primary pulmonary hypertension. A national prospective study. Ann Intern Med. 1987;107:216-223.

2.


3.

Craig RJ, Selzer A. Natural history and prognosis of atrial septal defect. Circulation. 1968;37:805-815.

4.


5.

Wagenvoort CA, Mooi WJ. Plexogenic arteriopathy. In: Biopsy Pathology of the Pulmonary Vasculature. Munro Neville A, Walker F, Gottlieb LS, eds. 1989. Chapman and Hall Medical, London.

6.

McLaughlin VV, Presberg KW, Doyle RL, Abman SH, McCrory DC, Fortin T, Ahearn G. Prognosis of pulmonary arterial hypertension: ACCP evidence-based clinical practice guidelines. Chest. 2004;126:78S-92S.

7.

Daliento L, Somerville J, Presbitero P, Menti L, Brach-Prever S, Rizzoli G, Stone S. Eisenmenger syndrome. Factors relating to deterioration and death. Eur Heart J. 1998;19:1845-1855.

8.

Rudolph AM, Nadas AS. The pulmonary circulation and congenital heart disease. Considerations of the role of the pulmonary circulation in certain systemic-pulmonary communications. N Engl J Med. 1962;267:1022-1029.

9.


10. Somerville J. How to manage the Eisenmenger syndrome. Int J Cardiol. 1998;63:1-8. 11. De Leval MR. The Fontan circulation: a challenge to William Harvey? Nat Clin Pract Cardiovasc Med. 2005;2:202-208. 12. Bisset GS, III, Hirschfeld SS. Severe pulmonary hypertension associated with a small ventricular septal defect. Circulation. 1983;67:470-473. 13. Roberts KE, McElroy JJ, Wong WP, Yen E, Widlitz A, Barst RJ, Knowles JA, Morse JH. BMPR2 mutations in pulmonary arterial hypertension with congenital heart disease. Eur Respir J. 2004;24:371-374. 14. Yamaki S, Horiuchi T, Sekino Y. Quantitative analysis of pulmonary vascular disease in simple cardiac anomalies with the Down syndrome. Am J Cardiol. 1983;51:1502-1506.

40

Chapter 2

15. Galie N, Ghofrani HA, Torbicki A, Barst RJ, Rubin LJ, Badesch D, Fleming T, Parpia T, Burgess G, Branzi A, Grimminger F, Kurzyna M, Simonneau G. Sildenafil citrate therapy for pulmonary arterial hypertension. N Engl J Med. 2005;353:2148-2157.

17. Simonneau G, Barst RJ, Galie N, Naeije R, Rich S, Bourge RC, Keogh A, Oudiz R, Frost A, Blackburn SD, Crow JW, Rubin LJ. Continuous subcutaneous infusion of treprostinil, a prostacyclin analogue, in patients with pulmonary arterial hypertension: a double-blind, randomized, placebo-controlled trial. Am J Respir Crit Care Med. 2002;165:800-804. 18. Wood P. The Eisenmenger syndrome or pulmonary hypertension with reversed central shunt. Br Med J. 1958;2:755-762. 19. Fuster V, Steele PM, Edwards WD, Gersh BJ, McGoon MD, Frye RL. Primary pulmonary hypertension: natural history and the importance of thrombosis. Circulation. 1984;70:580-587. 20. Rich S, Kaufmann E, Levy PS. The effect of high doses of calcium-channel blockers on survival in primary pulmonary hypertension. N Engl J Med. 1992;327:76-81. 21. De PS Soares R, Maeda NY, Bydlowski SP, Lopes AA. Markers of endothelial dysfunction and severity of hypoxaemia in the Eisenmenger syndrome. Cardiol Young. 2005;15:504-513. 22. Silversides CK, Granton JT, Konen E, Hart MA, Webb GD, Therrien J. Pulmonary thrombosis in adults with Eisenmenger syndrome. J Am Coll Cardiol. 2003;42:1982-1987. 23. Sitbon O, Humbert M, Jais X, Ioos V, Hamid AM, Provencher S, Garcia G, Parent F, Herve P, Simonneau G. Long-term response to calcium channel blockers in idiopathic pulmonary arterial hypertension. Circulation. 2005;111:3105-3111. 24. Wimmer M, Schlemmer M. Long-term hemodynamic effects of nifedipine on congenital heart disease with Eisenmenger’s mechanism in children. Cardiovasc Drugs Ther. 1992;6:183-186. 25. Barst RJ, Rubin LJ, Long WA, McGoon MD, Rich S, Badesch DB, Groves BM, Tapson VF, Bourge RC, Brundage BH. A comparison of continuous intravenous epoprostenol (prostacyclin) with conventional therapy for primary pulmonary hypertension. The Primary Pulmonary Hypertension Study Group. N Engl J Med. 1996;334:296-302. 26. Rosenzweig EB, Kerstein D, Barst RJ. Long-term prostacyclin for pulmonary hypertension with associated congenital heart defects. Circulation. 1999;99:1858-1865. 27. McLaughlin VV, Genthner DE, Panella MM, Hess DM, Rich S. Compassionate use of continuous prostacyclin in the management of secondary pulmonary hypertension: a case series. Ann Intern Med. 1999;130:740-743. 28. Fernandes SM, Newburger JW, Lang P, Pearson DD, Feinstein JA, Gauvreau K, Landzberg MJ. Usefulness of epoprostenol therapy in the severely ill adolescent/adult with Eisenmenger physiology. Am J Cardiol. 2003;91:632-635.

41


16. Galie N, Humbert M, Vachiery JL, Vizza CD, Kneussl M, Manes A, Sitbon O, Torbicki A, Delcroix M, Naeije R, Hoeper M, Chaouat A, Morand S, Besse B, Simonneau G. Effects of beraprost sodium, an oral prostacyclin analogue, in patients with pulmonary arterial hypertension: a randomized, double-blind, placebo-controlled trial. J Am Coll Cardiol. 2002;39:1496-1502.

29. Rubin LJ, Badesch DB, Barst RJ, Galie N, Black CM, Keogh A, Pulido T, Frost A, Roux S, Leconte I, Landzberg M, Simonneau G. Bosentan therapy for pulmonary arterial hypertension. N Engl J Med. 2002;346:896-903. 30. Channick RN, Simonneau G, Sitbon O, Robbins IM, Frost A, Tapson VF, Badesch DB, Roux S, Rainisio M, Bodin F, Rubin LJ. Effects of the dual endothelin-receptor antagonist bosentan in patients with pulmonary hypertension: a randomised placebo-controlled study. Lancet. 2001;358:1119-1123. 31. Beghetti M, Black SM, Fineman JR. Endothelin-1 in congenital heart disease. Pediatr Res. 2005;57:16R-20R. 32. Galie N, Beghetti M, Gatzoulis MA, Granton J, Berger RM, Lauer A, Chiossi E, Landzberg M. Bosentan therapy in patients with Eisenmenger syndrome: a multicenter, double-blind, randomized, placebo-controlled study. Circulation. 2006;114:48-54. 33. Gatzoulis MA, Beghetti M, Galie N, Granton J, Berger RM, Lauer A, Chiossi E, and Landzberg M. Bosentan shows persistent benefit in functional class and exercise capacity amongst Eisenmenger patients in the BREATHE-5 open label extension study. Eur Heart J 27(Abstract Suppl), 8. 2006. 34. Barst RJ, Langleben D, Frost A, Horn EM, Oudiz R, Shapiro S, McLaughlin V, Hill N, Tapson VF, Robbins IM, Zwicke D, Duncan B, Dixon RA, Frumkin LR. Sitaxsentan therapy for pulmonary arterial hypertension. Am J Respir Crit Care Med. 2004;169:441-447. 35. Sastry BK, Narasimhan C, Reddy NK, Raju BS. Clinical efficacy of sildenafil in primary pulmonary hypertension: a randomized, placebo-controlled, double-blind, crossover study. J Am Coll Cardiol. 2004;43:1149-1153. 36. Singh TP, Rohit M, Grover A, Malhotra S, Vijayvergiya R. A randomized, placebo-controlled, double-blind, crossover study to evaluate the efficacy of oral sildenafil therapy in severe pulmonary artery hypertension. Am Heart J. 2006;151:851-855. 37. Lim ZS, Salmon AP, Vettukattil JJ, Veldtman GR. Sildenafil therapy for pulmonary arterial hypertension associated with atrial septal defects. Int J Cardiol. 2007 (in press). 38. Mukhopadhyay S, Sharma M, Ramakrishnan S, Yusuf J, Gupta MD, Bhamri N, Trehan V, Tyagi S. Phosphodiesterase-5 Inhibitor in Eisenmenger Syndrome. A Preliminary Observational Study. Circulation. 2006; 114: 1807-10. 39. Maurer JR, Frost AE, Estenne M, Higenbottam T, Glanville AR. International guidelines for the selection of lung transplant candidates. The International Society for Heart and Lung Transplantation, the American Thoracic Society, the American Society of Transplant Physicians, the European Respiratory Society. Transplantation. 1998;66:951-956. 40. Trulock EP. Lung transplantation. Am J Respir Crit Care Med. 1997;155:789-818. 41. Charman SC, Sharples LD, McNeil KD, Wallwork J. Assessment of survival benefit after lung transplantation by patient diagnosis. J Heart Lung Transplant. 2002;21:226-232. 42. Waddell TK, Bennett L, Kennedy R, Todd TR, Keshavjee SH. Heart-lung or lung transplantation for Eisenmenger syndrome. J Heart Lung Transplant. 2002;21:731-737.

42

Chapter 3 Biological serum markers in the management of pediatric pulmonary arterial hypertension

Mirjam E. van Albada, Frederieke G. Loot, Rebecca Fokkema, Marcus T.R. Roofthooft, Rolf M.F. Berger

Submitted

Abstract Rationale: Appropriate markers are needed for the monitoring of children with pulmonary arterial hypertension. Various biological serum markers have been suggested to be of use in adults with pulmonary arterial hypertension. No data are available on the value of these markers in children with pulmonary arterial hypertension. Objectives: To study the relation between NT-proBNP, uric acid, norepinephrine and epinephrine and functional parameters and hemodynamic variables in pediatric pulmonary hypertension and to determine the ability of these serum markers to predict survival. Methods: Serum NT-proBNP, uric acid and cathecholamines were measured and correlated with invasive hemodynamics, functional parameters and outcome in 30 pediatric patients with pulmonary arterial hypertension that visited a tertiary reference center for pediatric pulmonary arterial hypertension between 1997 and 2005. Results: Serum NT-proBNP correlated with WHO-class (R = 0.36; p = 0.03) and 6minute walking distance (R = -0.53; p < 0.001). Serum uric acid correlated with mean pulmonary arterial pressure, pulmonary vascular resistance and cardiac index (R = 0.63, p = 0.01; R = 0.71, p = 0.03 and R = -0.65, p = 0.007 respectively). After initiation of treatment, NT-proBNP levels decreased and this decrease correlated with an increase in 6-minute walking distance. Finally, norepinephrine and NT-proBNP levels were highly predictive for mortality. Conclusions: In this series of children with pulmonary arterial hypertension, biological serum markers were correlated with hemodynamics and functional capacity, as parameters of disease severity. Furthermore, the data indicate that these markers can be used to monitor treatment effects and predict mortality in pediatric pulmonary arterial hypertension.

46

Introduction

Biological serum markers in the management of pediatric pulmonary arterial hypertension

47

Chapter 3

Pulmonary arterial hypertension (PAH) is a chronic, progressive and usually fatal disease. It is characterized by proliferation of pulmonary vascular cells and obliteration of small pulmonary arteries, leading to increased pulmonary vascular resistance and eventually to right heart failure and death. PAH may present at any age, from infancy into high age. In the last decade, new pharmacological therapies, although not curative, have been demonstrated to improve hemodynamics, exercise capacity and survival in these patients. For optimal clinical decision making, it has therefore become of growing importance to accurately assess disease severity, effectiveness of therapy and prognosis in the individual patient with PAH. Several correlates of disease severity and survival have been described in adults with PAH. Hemodynamic and functional capacity parameters are currently the cornerstones in characterizing disease progression. Invasively obtainable hemodynamic parameters have been shown to represent disease severity and to predict survival 1. Non-invasive parameters for functional capacity are used for assessing clinical condition, severity of disease and effectiveness of therapy. Six-minute walking distance (6MWD) has been shown to correlate well with WHO-class, and less well with hemodynamic parameters 2. Maximal cardiopulmonary exercise testing can also be safely performed in these patients using specific guidelines, and is used with increasing frequency 3. In pediatric patients with PAH these parameters have specific drawbacks in their use. As in adults, cardiac catheterization is invasive and associated with specific risks. In the pediatric age group, however, cardiac catheterization is mostly performed under general anesthesia, making repetitive catheterizations for follow-up unattractive. Exercise capacity tests as the 6MWD or maximal exercise tests are often not feasible and less validated in young childhood 4. Therefore additional parameters to monitor disease severity, prognosis and efficacy of treatment are highly needed in pediatric patients with PAH. In PAH the neurohumoral axis is activated, as evidenced by elevated circulating levels of brain natriuretic peptide (BNP), N-terminal pro-brain natriuretic peptide (NTproBNP), catecholamines and other neurohumoral markers 5-9. Also uric acid levels have shown to be increased in adults with PAH, both idiopathic and secondary 10. Studies in adult patients with PAH have suggested that NT- proBNP 7, norepinephrine 9 and uric acid 11 are correlated with hemodynamic and functional parameters and could be used for monitoring therapy effects and prognosis in these patients. Although appropriate reference values are lacking in children, preliminary data suggest that BNP and NT-proBNP levels are useful in diagnosing and managing pediatric heart failure, congenital heart disease and cardiac transplantation 12. In this study we aimed to investigate the value of uric acid, NT-proBNP, epinephrine and norepinephrine in a cohort of children with PAH, with respect to predicting prognosis and monitoring disease severity and effectiveness of therapy as assessed by hemodynamic and functional parameters.

Methods Patients Thirty consecutive pediatric patients in whom pulmonary hypertension was diagnosed in a tertiary reference center for pediatric pulmonary hypertension between 1997 and 2005 were followed using a standardized protocol, in which WHO functional class, physical examination, blood withdrawal for biological markers and a 6-minute walking test were performed every 3-6 months. Informed consent was obtained from the parents of all children. Cardiac catheterization Cardiac catheterization was performed under general anesthesia at presentation to confirm the diagnosis pulmonary hypertension. In 17 patients concomitant blood samples were collected prior to the catheterization procedure. Complete hemodynamic data were obtained, including systemic and pulmonary blood flows using the Fick method and vascular resistances, indexed for body surface. Blood sampling and assays Peripheral venous blood samples were further obtained at each outpatient visit. For prognostic value, serum uric acid was determined at presentation, whereas the other serum markers were collected from 2003, when the role of the neurohumoral axis in pulmonary hypertension became more obvious. Blood samples drawn at start of new therapy (either as first line or add-on therapy) and three months later were used to determine the value of the different serum markers in the assessment of therapeutic efficacy. To determine NT-proBNP levels, blood was collected in EDTA tubes, transported on ice and stored at -20°C. Plasma NT-proBNP was determined with an Elecsys proBNP assay (generously provided by Roche Diagnostics, Basel, Switzerland). Uric acid and creatinin were measured using standard clinical chemical methods with a MEGA (Merck, Darmstadt, Germany). For determination of catecholamines, samples were stored at -20°C in glass tubes containing glutathione solution and measured using chromatography. All blood samples were drawn after a 10-minute stabilization period of the patient in a horizontal position. Statistical analysis All data are expressed as mean value ± standard error of the mean (SEM) unless otherwise indicated. Log transformation was used to normalize the distribution of variables. Correlations between variables were measured using Pearson’s correlation coefficient or, in case of non-continuous variables, Spearman’s rho correlation coefficient. To analyze the relation between the two functional parameters WHO-class and 6MWD and simultaneously derived serum markers, we included the first three visits per patient to increase sample size, leaving 21 patients and 63 data points. The relation between WHO-class and serum markers was obtained by logistic regression analysis, after transformation of the classification scores into 48

The clinical and demographic characteristics of the 30 patients included in this study are provided in table 1. Eighteen children were diagnosed with idiopathic PAH and eleven patients with PAH due to a congenital left to right shunt. Of these, 10 had Eisenmenger syndrome with a post-tricuspid defect: patent arterial duct (PDA) n = 2, ventricular septal defect (VSD) n = 7 (4 of which combined with a PDA), AVSD n = 1. One patient had a surgically corrected truncus arteriosus. Finally, one patient had chronic thromboembolic pulmonary hypertension associated with a ventriculo-atrial drain (table 1). Median age at inclusion was 7.0 years (range 0.1 – 17.3). Girls were slightly older than boys (median age in girls 9.3 (2.9 – 17.3) and in boys 4.0 (0.1 – 15.2), p = 0.03). Median and range of all serum markers at the first sample collection was as follows: NT-proBNP 138 (27-7589) pg/ml, uric acid 0.29 (0.12-0.56) mmol/l, norepinephrine 1.46 (0.39-9.60) nmol/l, epinephrine 0.19 (0.03-1.68) nmol/l. Patients were treated as clinically indicated. At the moment of inclusion 20 patients received anticoagulants, 9 patients received diuretics, 7 patients received a calciumantagonist, 1 patient received digoxin, 6 patients received bosentan, 2 patients received epoprostenol and 1 patient received beraprost sodium. During follow-up, 6 patients were started on anticoagulants, 2 on diuretics, 1 on digoxin, 14 patients were started on bosentan, 4 patients were started on epoprostenol and 1 patient received treatment with sildenafil. Median follow up was 32 months (range 8-156 months). During this follow-up, nine patients (30%) died as a result of circulatory insufficiency due to progressive right ventricular failure, one of these during massive hemoptysis.

49


Results

Chapter 3

a dichotomous variable (either < 3 or ≥ 3). An estimated glomerular filtration rate (GFR) was calculated for each patient at the time of cardiac catheterization using the formula (38*heigth(cm))/creatinin(μmol/l) and the relation between hemodynamics and uric acid was corrected for GFR and diuretic use in a multivariate regression analysis. To determine the value of the biological markers in relation to effectiveness of therapy, serum levels at the start of treatment were compared with those three months later with a paired sample t-test or a Wilcoxon signed ranks test when data were not normally distributed. For Kaplan-Meier survival curves, patients were divided into high, middle and low categories, with an equal number of patients in each group. A logrank test based on trends was used. Receiver operating characteristics (ROC) were generated from multiple sensitivity/specificity pairs. All analyses were performed using SPSS© version 12.02 for Windows (SPSS Inc. Chicago, IL). A p-value < 0.05 was considered to be significant.

Table 1. Patient characteristics. Total

IPAH

PAH associated with congenital systemic-to-pulmonary shunt

Chronic thromboembolic pulmonary hypertension

Patient numbers

30

18

11

1

Median age at inclusion (range)

7.0 (0.1 – 17.3)

5.3 (0.1 – 15.4)

11.8 (1.6 – 17.3)

16.1

3 5 17 5

3 4 8 3

0 1 8 2

0 0 1 0

9 (30%)

6 (33%)

3 (27%)

0 (0%)

WHO

Deceased

I II III IV

Biological serum markers and demographic data Uric acid was correlated with age (R = 0.431, p = 0.03) and sex (males 0.25 ± 0.02 mmol/l vs. females 0.32 ± 0.03 mmol/l, p = 0.04). Uric acid did not differ between patients with idiopathic or other type of PAH. NT-proBNP, norepinephrine and epinephrine did not correlate with sex, age or diagnosis. Biological serum markers and disease severity Hemodynamics In 17 patients concomitant biological markers and invasive hemodynamic data were available. Serum uric acid correlated with mean pulmonary arterial pressure (R = 0.63, p = 0.01, figure 2A) and pulmonary vascular resistance (R = 0.71, p = 0.03, figure 2B). A negative relation with cardiac index was demonstrated (R = -0.65, p = 0.007, figure 2C). After correction for GFR, these correlations remained basically unchanged (R = 0.66, p = 0.08; R = 0.69, p = 0.03 and R = -0.65, p = 0.04. respectively). Also, after correction for diuretic use, the correlations remained unchanged. Further, a positive correlation between right atrial pressure and norepinephrine was suggested (R = 0.62, p = 0.06). NT-proBNP and epinephrine levels did not correlate with hemodynamic variables. No correlation could be demonstrated between any of the serum markers and arterial or venous oxygen saturation or hemoglobin levels at cardiac catheterization.

50

A

4,5

3,5 3,0 2,5 2,0 1,5 1,0 100

200

300

400

500

600

700

6-minute walking distance (m)

Log N-terminal proBNP (pg/ml)

B

4

3

2

1

0

1

2

3

4

WHO-classification

Functional capacity A higher WHO-classification was associated with a decreased 6-minute walking distance (R = -0.57, p = 0.001). A higher NT-proBNP was also associated with a higher WHO-classification (logistic regression R = 0.36, p = 0.03; figure 1A). NTproBNP correlated with 6-minute walking distance as tested on the day of blood sampling (R = -0.527, p < 0.001, figure 1B). No correlations could be demonstrated between the other biological markers and these functional parameters. Biological serum markers and treatment effect In 13 patients, biological markers, WHO-class and 6MWD were compared at initiation of therapy with either bosentan (n = 10), epoprostenol (n = 2) or sildena51


Log N-terminal proBNP (pg/ml)

4,0

Chapter 3

Figure 1. Relation between serum markers and functional parameters. A) log N-terminal proBNP and 6-minute walking distance (n = 3 per patient). B) log N-terminal proBNP and WHO-classification. Data are presented as mean ± SEM

Mean pulmonary arterial pressure (mmHg)

A

Figure 2. Relation between serum markers and hemodynamics. Serum uric acid and A) mean pulmonary arterial pressure, B) pulmonary vascular resistance, C) cardiac output.

120 100 80 60 40 20

R = 0.63 p = 0.01

0 0,1

0,2

B Pulmonary vascular resistance (Woods units/m 2)

0,3

0,4

0,5

0,6

Uric acid (mmol/l) 60 50 40 30 20 10 R = 0.71 p = 0.03

0

0,1

0,2

0,3

0,4

0,5

0,6

Uric acid (mmol/l)

C

6 R = 0.65 p = 0.01

Cardiac index (l/min.m 2)

5

4

3

2

1 0,1

0,2

0,3

0,4

Uric acid (mmol/l)

52

0,5

0,6

A

0,8

0,4

NT-proBNP < 80 pg/ml 80 pg/ml < NT-proBNP < 605 pg/ml NT-proBNP > 605 pg/ml

0,2

0,0 0

10

20

30

40

30

40

Time (months)

B

1,0

0,8

Survival

0,6

0,4

Uric acid < 0.25 mmol/l 0.25 mmol/l < Uric acid < 0.32 mmol/l Uric acid > 0.32 mmol/l

0,2

0,0 0

10

20

Time (months)

C

1,0

0,8

Survival

0,6

0,4

Norepinephrine < 1.00 nmol/l 1.00 nmol/l < Norepinephrine < 1.68 nmol/l Norepinephrine > 1.68 nmol/l

0,2

0,0 0

10

20

30

40

Time (months)

53


Survival

0,6

Chapter 3

Figure 3. Kaplan-Meier survival curves for the different biochemical markers. Cumulative survival estimated by Kaplan-Meier curves for NT-proBNP, A) p = 0.004) for uric acid, B) p = 0.01) and for norepinephrine, C) p = 0.04) . P-values are derived from over all log rank testing for trends.

1,0

A

Figure 4. ROC-analysis. ROC-analysis for serum NT-proBNP A), uric acid B) and norepinephrine C) in the prediction of death in pediatric patients with PAH.

1,0

0,8

Sensitivity

AUC = 0.94 p = 0.003

0,6

0,4

0,2

0,0 0,0

0,2

0,4

0,6

0,8

1,0

0,8

1,0

0,8

1,0

1-Specificity

B

1,0

Sensitivity

0,8

0,6

0,4 AUC = 0.65 p = 0.29

0,2

0,0 0,0

0,2

0,4

0,6

1-Specificity

C

1,0

Sensitivity

0,8 AUC = 0.85 p = 0.02

0,6

0,4

0,2

0,0 0,0

0,2

0,4

0,6

1-Specificity

54

Discussion This study demonstrates that serum levels of NT-proBNP, uric acid and norepine phrine can be used for the assessment of disease severity, prognosis and effectiveness of therapy in children with PAH. Serum uric acid levels correlated with invasively obtained hemodynamic data, NTproBNP levels correlated with functional outcome parameters as WHO-class and 6minute walking distance. NT-proBNP levels decreased after initiation of therapy and this decrease correlated with the functional response to the initiation of this treatment. Furthermore, serum levels of NT-proBNP and norepinephrine were highly predictive for mortality in the individual patient. The neurohumoral axis is known to be activated in conditions characterized by abnormal loading conditions of the cardiovascular system, including heart failure and congenital heart disease. Therefore, it has been suggested that serum levels of neurohormones may function as biological markers for disease progression and prognosis. NT-pro-BNP is generated in case of ventricular stretch from its precursor proBNP by cleavage. Sympathetic activation occurs in different types of cardiovascular disease and is evidenced by increased epinephrine and norepinephrine serum levels. These markers have been shown to be useful in the detection and diagnosis of heart failure 55


Biological serum marker and prognosis Of the 30 patients studied, 9 (30%) died during follow-up, 3 boys and 6 girls (table 1). The Kaplan-Meier survival curves of the different serum markers are shown in figure 3. High NT-proBNP, uric acid and norepinephrine levels all predicted increased mortality. ROC-curves for NT-proBNP, uric acid and norepinephrine predicting mortality are provided in figure 4. NT-proBNP and norepinephrine both had an area under the curve > 0.85. When using a cut-off value of 1664 pg/ml for NT-proBNP, the test would have a 100% sensitivity and 94% specificity in predicting mortality. Norepinephrine with a cut-off of 1.63 nmol/l had a 80% sensitivity and 77% specificity in predicting mortality. The area under the ROC curve for uric acid was 0.65 and did not differ significantly from 0.5.

Chapter 3

fil (n = 1) and three months later. NT-proBNP levels were significantly decreased after three months of therapy compared to levels prior to therapy (mean ± SEM 631 ± 228 pg/ml vs 1484 ± 600 pg/ml respectively, p = 0.016). In these patients 6MWD increased more than 50 meters (302 ± 32 m prior to therapy vs. 367 ± 30 after three months of treatment, p = 0.03) and WHO-class improved (3.0 ± 0.1 prior to therapy vs. 2.5 ± 0.1 after three months of treatment, p = 0.006). The size of the change in NT-proBNP was related to the size of the change in 6MWD (R = -0.63, p = 0.04) and in WHO class (R = 0.72, p = 0.02). No changes in the levels of uric acid, norepinephrine and epinephrine could be demonstrated after three months of treatment.

and to predict morbidity and mortality in different cardiovascular conditions 13-17. Furthermore, an increased serum level of uric acid has been demonstrated to be associated with morbidity and mortality in heart failure and in congenital heart disease 18-21. The mechanism behind the increased uric acid in heart failure patients warrants further discussion. Increased serum uric acid in heart failure seems to be caused by the activity of xantine oxidase. Xantine oxidase is the enzyme that catalyzes the oxidation of xanthine to uric acid. In patients with heart failure, inhibition of xantine oxidase activity with allopurinol improved vascular function 22, indicating that xantine oxidase activity is directly contributing to the pathogenetic process in heart failure patients. Since uric acid has been shown to be increased in pulmonary hypertensive patients 11, xantine oxidase activity may also be a mediator in the pathobiological mechanisms of pulmonary hypertension. Disease severity Disease severity in PAH is characterized by hemodynamics and functional capacity. Hemodynamic parameters, including right atrial pressure, pulmonary arterial pressure, pulmonary vascular resistance and cardiac index, are considered indicators for the severity of disease in PAH and have been associated with prognosis 1;23;24. In the present study, of all biological markers investigated, uric acid level displayed the strongest correlations with invasive hemodynamics. It correlated with mean pulmonary arterial pressure, pulmonary vascular resistance and cardiac index, but not with right atrial pressure. To exclude the possibility that hyperuricemia was caused by impaired kidney function or diuretic use, a multivariate analysis was performed to correct for these variables. However, the correlations appeared to be independent of these factors in our pediatric series. In adult PAH patients, uric acid has been previously reported to be correlated with right atrial pressure 10;25, pulmonary vascular resistance 11 and cardiac index 11;25 Norepinephrine levels have also been described to correlate with hemodynamic parameters in adult PAH, although reported data were not always consistent. Nootens et al found a significant correlation between norepinephrine levels and pulmonary arterial pressures, pulmonary vascular resistance and cardiac index in 21 adult patients with idiopathic PAH, whereas Nagaya et al could demonstrate a correlation only with cardiac index 6;9. In the current pediatric study, we found that norepine phrine tended to correlate with right atrial pressure, but not with other hemodynamic parameters. No correlations between serum levels of NT-proBNP and hemodynamic parameters could be demonstrated in the current study. This is in contrast with studies in adult patients with PAH and systemic sclerosis, in which NT-proBNP was found to correlate with pulmonary arterial pressure 26;27. Similarly to our data, Fijalkowska et al could not demonstrate a relation with pulmonary arterial pressure in patients with idiopathic PAH 7. Correlations of NT-proBNP levels with right atrial pressure, pulmonary vascular resistance and cardiac index have been described in adults with PAH 7;27;28. Functional capacity. We found NT-proBNP to correlate well with the functional status of 56

Treatment effect Additionally, NT-proBNP appeared to be useful in monitoring treatment effects in pediatric patients with PAH, since treatment was associated with a decrease in serum NT-proBNP levels and this decrease correlated inversely with improvement in 6MWD. The number of patients and observations in this study did not allow to answer the question if the magnitude of changes in NT-proBNP serum levels after 57


Prognosis Increased levels of NT-proBNP have been associated with poor long-term prognosis in adults with pulmonary hypertension. Fijalkovska et al reported that a serum NTproBNP higher than 1400 pg/ml identified patients with a poor long-term prognosis with a 88% specificity and a 53% specificity 7. In this pediatric study, 5 of 6 patients (83%) with a NT-proBNP level higher than this level died within two years, while all patients with a level below 1400 pg/ml survived. When we used a cut-off value of 1664 pg/ml, sensitivity and specificity for predicting mortality could even be improved to 100% and 94% respectively. In other words, in this study NT-proBNP showed to be an excellent predictor of mortality that can be used in the individual pediatric patient with PAH. Norepinephrine serum levels also correlated significantly with mortality in our study. Although not as strong as NT-proBNP, the area under the ROC curve was 0.85, indicating that norepinephrine serum level was a good predictor of mortality in this population. These findings are in congruency with data in adult patients with iPAH as reported by Nagaya and coworkers. These authors also found increased norepinephrine levels to be correlated with mortality 6. In contrast, no correlation could be demonstrated between epinephrine levels and mortality. This is in congruency with findings in adults with PAH 8. Serum uric acid level has also been described as a prognostic factor in adult PAH 29. In the current pediatric series, serum uric acid levels also appeared to be correlated with mortality. However, the ROC-curve showed that uric acid level was less valuable in predicting mortality in the individual child. It should be noted that, in the current study, the different biological markers predicted mortality, irrespective of the received treatment.

Chapter 3

pediatric PAH patients, characterized by WHO functional class and 6-minute walking distance. This is in concordance with findings in adult patients, in whom also correlations with these parameters have been described 7;27;28. At present, 6MWD is generally accepted as a valuable parameter for clinical status and a predictor for outcome in PAH patients. In pediatric patients, the 6MWD is not always feasible because of young age or lack of co-operation. Furthermore, 6MWD has not been validated in children younger than 8 years of age. Our findings indicate that NT-proBNP serum levels may form a substitute for the 6MWD in pediatric patients with PAH. Serum levels of uric acid and norepinephrine did not correlate with parameters of functional class in our study. In contrast, both uric acid and norepinephrine have been reported to be correlated with WHO functional class in adult patients with PAH 9;11.

initiation of therapy was predictive for outcome or affected the value of baseline NTproBNP level in predicting mortality in the individual patient. Our data indicate that NT-proBNP may be used to evaluate the effect of treatment in children with PAH. This is of especially great importance in the youngest patients in whom the accepted clinical endpoints applied for PAH are often not feasible to obtain. Limitations of this study No healthy control group was used in this study. Normal values for serum levels of the described biological markers in children are not fully established. Therefore, the value of biological markers in diagnosing the presence of PAH in children could not be determined in this study. However, the value of these markers as correlates for disease severity, prognosis and treatment effect in the specific condition of pediatric PAH could be established. Since the levels of the investigated biological serum markers did not correlate with diagnosis and no differences in demographic variables and survival could be demonstrated between patients with iPAH or congenital shunts, we chose to analyze all patients as one group. Therefore, potential differences in serum marker correlates between these diagnosis groups could have been missed in the current study. The 6-minute walking test has not been validated in children younger than 8 years of age. Lack of co-operation at younger age may hamper its results. Seven of our pa tients underwent at least one 6-minute walking test between 5 and 7 years of age. In our experience, familiarizing the young child with the test by training can result in reproducible 6MWD assessments from the age of 5 years. Conclusion This study demonstrates that serum levels of NT-proBNP, uric acid and norepinephrine can be used for the assessment of disease severity, prognosis and effectiveness of therapy in children with PAH. These biological serum markers may therefore allow to support clinical decision making in the management of the individual child with PAH, especially in those in whom obtaining accepted endpoint parameters is not feasible (exercise capacity tests) or unattractive (repeated invasive hemodynamic evaluation). Further prospective studies are warranted to assess the predictive value of treatment induced changes in the serum levels of these markers.

58

References

2.

Miyamoto S, Nagaya N, Satoh T, Kyotani S, Sakamaki F, Fujita M, Nakanishi N, Miyatake K. Clinical correlates and prognostic significance of six-minute walk test in patients with primary pulmonary hypertension. Comparison with cardiopulmonary exercise testing. Am J Respir Crit Care Med. 2000;161:487-492.

3.

Wensel R, Opitz CF, Anker SD, Winkler J, Hoffken G, Kleber FX, Sharma R, Hummel M, Hetzer R, Ewert R. Assessment of survival in patients with primary pulmonary hypertension: importance of cardiopulmonary exercise testing. Circulation. 2002;106:319-324.

4.

Ivy DD. Pulmonary Arterial Hypertension Assessment in Pediatric Cardiology. In: Pulmonary Arterial Hypertension Related to Congenital Heart Disease. Beghetti M, Barst RJ, Naeije R, Rubin LJ, eds. 2006. Elsevier GmbH, Munich.

5.

Tunaoglu FS, Olgunturk FR, Gokcora N, Turkyilmaz C, Gurbuz F. Atrial natriuretic peptide concentrations in children with pulmonary hypertension: correlation with hemodynamic measurements. Pediatr Cardiol. 1994;15:288-295.

6.

Nagaya N, Nishikimi T, Uematsu M, Satoh T, Kyotani S, Sakamaki F, Kakishita M, Fukushima K, Okano Y, Nakanishi N, Miyatake K, Kangawa K. Plasma brain natriuretic peptide as a prognostic indicator in patients with primary pulmonary hypertension. Circulation. 2000;102:865 -870.

7.

Fijalkowska A, Kurzyna M, Torbicki A, Szewczyk G, Florczyk M, Pruszczyk P, Szturmowicz M. Serum N-terminal brain natriuretic peptide as a prognostic parameter in patients with pulmonary hypertension. Chest. 2006;129:1313-1321.

8.

Knirsch W, Eiselt M, Nurnberg J, Haas NA, Berger F, Dahnert I, Uhlemann F, Lange PE. Pulmonary plasma catecholamine levels and pulmonary hypertension in congenital heart disease. Z Kardiol. 2002;91:1035-1043.

9.

Nootens M, Kaufmann E, Rector T, Toher C, Judd D, Francis GS, Rich S. Neurohormonal activation in patients with right ventricular failure from pulmonary hypertension: relation to hemodynamic variables and endothelin levels. J Am Coll Cardiol. 1995;26:1581-1585.

10. Voelkel MA, Wynne KM, Badesch DB, Groves BM, Voelkel NF. Hyperuricemia in severe pulmonary hypertension. Chest. 2000;117:19-24. 11. Nagaya N, Uematsu M, Satoh T, Kyotani S, Sakamaki F, Nakanishi N, Yamagishi M, Kunieda T, Miyatake K. Serum uric acid levels correlate with the severity and the mortality of primary pulmonary hypertension. Am J Respir Crit Care Med. 1999;160:487-492. 12. Davis GK, Bamforth F, Sarpal A, Dicke F, Rabi Y, Lyon ME. B-type natriuretic peptide in pediatrics. Clin Biochem. 2006;39:600-605.

59


D’Alonzo GE, Barst RJ, Ayres SM, Bergofsky EH, Brundage BH, Detre KM, Fishman AP, Goldring RM, Groves BM, Kernis JT. Survival in patients with primary pulmonary hypertension. Results from a national prospective registry. Ann Intern Med. 1991;115:343-349.

Chapter 3

1.

13. Hammerer-Lercher A, Neubauer E, Muller S, Pachinger O, Puschendorf B, Mair J. Head-to-head comparison of N-terminal pro-brain natriuretic peptide, brain natriuretic peptide and N-terminal pro-atrial natriuretic peptide in diagnosing left ventricular dysfunction. Clin Chim Acta. 2001;310:193-197. 14. Masson S, Latini R, Anand IS, Vago T, Angelici L, Barlera S, Missov ED, Clerico A, Tognoni G, Cohn JN. Direct Comparison of B-Type Natriuretic Peptide (BNP) and Amino-Terminal proBNP in a Large Population of Patients with Chronic and Symptomatic Heart Failure: The Valsartan Heart Failure (Val-HeFT) Data. Clin Chem. 2006;52:1528-1538. 15. Hobbs FD, Davis RC, Roalfe AK, Hare R, Davies MK, Kenkre JE. Reliability of N-terminal pro-brain natriuretic peptide assay in diagnosis of heart failure: cohort study in representative and high risk community populations. BMJ. 2002;324:1498. 16. Thomas JA, Marks BH. Plasma norepinephrine in congestive heart failure. Am J Cardiol. 1978;41:233243. 17. Cohn JN, Levine TB, Olivari MT, Garberg V, Lura D, Francis GS, Simon AB, Rector T. Plasma norepinephrine as a guide to prognosis in patients with chronic congestive heart failure. N Engl J Med. 1984;311:819-823. 18. Hoieggen A, Alderman MH, Kjeldsen SE, Julius S, Devereux RB, De Faire U, Fyhrquist F, Ibsen H, Kristianson K, Lederballe-Pedersen O, Lindholm LH, Nieminen MS, Omvik P, Oparil S, Wedel H, Chen C, Dahlof B. The impact of serum uric acid on cardiovascular outcomes in the LIFE study. Kidney Int. 2004;65:1041-1049. 19. Verdecchia P, Schillaci G, Reboldi G, Santeusanio F, Porcellati C, Brunetti P. Relation between serum uric acid and risk of cardiovascular disease in essential hypertension. The PIUMA study. Hypertension. 2000;36:1072-1078. 20. Freedman DS, Williamson DF, Gunter EW, Byers T. Relation of serum uric acid to mortality and ischemic heart disease. The NHANES I Epidemiologic Follow-up Study. Am J Epidemiol. 1995;141:637644. 21. Anker SD, Doehner W, Rauchhaus M, Sharma R, Francis D, Knosalla C, Davos CH, Cicoira M, Shamim W, Kemp M, Segal R, Osterziel KJ, Leyva F, Hetzer R, Ponikowski P, Coats AJ. Uric acid and survival in chronic heart failure: validation and application in metabolic, functional, and hemodynamic staging. Circulation. 2003;107:1991-1997. 22. Doehner W, Schoene N, Rauchhaus M, Leyva-Leon F, Pavitt DV, Reaveley DA, Schuler G, Coats AJ, Anker SD, Hambrecht R. Effects of xanthine oxidase inhibition with allopurinol on endothelial function and peripheral blood flow in hyperuricemic patients with chronic heart failure: results from 2 placebo-controlled studies. Circulation. 2002;105:2619-2624. 23. Chapman PJ, Bateman ED, Benatar SR. Prognostic and therapeutic considerations in clinical primary pulmonary hypertension. Respir Med. 1990;84:489-494. 24. Sandoval J, Bauerle O, Palomar A, Gomez A, Martinez-Guerra ML, Beltran M, Guerrero ML. Survival in primary pulmonary hypertension. Validation of a prognostic equation. Circulation. 1994;89:17331744.

60

25. Hoeper MM, Hohlfeld JM, Fabel H. Hyperuricaemia in patients with right or left heart failure. Eur Respir J. 1999;13:682-685.

28. Souza R, Bogossian HB, Humbert M, Jardim C, Rabelo R, Amato MB, Carvalho CR. N-terminal-probrain natriuretic peptide as a haemodynamic marker in idiopathic pulmonary arterial hypertension. Eur Respir J. 2005;25:509-513. 29. Bendayan D, Shitrit D, Ygla M, Huerta M, Fink G, Kramer MR. Hyperuricemia as a prognostic factor in pulmonary arterial hypertension. Respir Med. 2003;97:130-133.

61


27. Mukerjee D, Yap LB, Holmes AM, Nair D, Ayrton P, Black CM, Coghlan JG. Significance of plasma Nterminal pro-brain natriuretic peptide in patients with systemic sclerosis-related pulmonary arterial hypertension. Respir Med. 2003;97:1230-1236.

Chapter 3

26. Allanore Y, Borderie D, Meune C, Cabanes L, Weber S, Ekindjian OG, Kahan A. N-terminal pro-brain natriuretic peptide as a diagnostic marker of early pulmonary artery hypertension in patients with systemic sclerosis and effects of calcium-channel blockers. Arthritis Rheum. 2003;48:3503-3508.

Chapter 4 The role of increased pulmonary blood flow in pulmonary arterial hypertension

Mirjam E. van Albada, Regien G. Schoemaker, Mariska Kemna, Adri H. Cromme-Dijkhuis, Richard van Veghel, Rolf M.F. Berger

European Respiratory Journal 2005 Sep;26(3):487-93

Abstract Chronic increased pulmonary blood flow is considered a prerequisite for the induction of advanced vascular lesions in pulmonary arterial hypertension in congenital heart defects. Objectives: To characterize the effects of increased pulmonary flow induced by an aortocaval shunt in the monocrotaline rat model for pulmonary hypertension in terms of survival, hemodynamics, pathology and histology. Materials/methods: Male Wistar rats were injected with monocrotaline followed by the creation of an abdominal aortocaval shunt. Animals were sacrificed when displaying symptoms of weight loss or dyspnea, four to five weeks after the creation of the shunt. Results: Echocardiography identified increased ventricular dimensions in shunted rats and right ventricular hypertrophy in monocrotaline-treated rats. At similar pulmonary arterial pressures, shunted monocrotaline-rats displayed higher morbidity and mortality, increased pulmonary-to-systemic arterial pressure ratios, and increased right ventricular hypertrophy compared to non-shunted monocrotaline-rats. Histological assessment demonstrated increased number and diameter of pre-acinar pulmonary arteries. Intra-acinar vessel remodeling and occlusion occurred to a similar extent in shunted and non-shunted monocrotaline-rats. Conclusion: Increased pulmonary blood flow in monocrotaline-induced pulmonary hypertension is associated with increased morbidity, mortality and unfavorable hemodynamic and cardiac effects.These effects could be attributed to more pronounced right heart failure rather than to altered intra-acinar pulmonary vessel remodeling.

64

Introduction

Experimental protocol Thirty-nine male Wistar rats (250-350 gram, fed ad libitum) were housed under diurnal lighting conditions. Animal care and experiments were conducted according to the Dutch Animal Experimental Act. The Erasmus University Animal Care and Use Committee approved the experimental protocol. Rats were randomly assigned to four experimental groups: 1) control (CON, n = 11), 2) increased pulmonary flow by means of an abdominal aortocaval shunt (AV, n = 8), 3) increased pulmonary arterial pressure, induced by monocrotaline (MC, n = 8) and 4) the combination of both interventions (MC + AV, n = 12). Monocrotaline (Sigma Chemical Co, St. Louis, MO, USA, 60 mg/kg subcutaneously) or vehicle was injected. Seven days later, sham surgery or AV-shunt surgery was performed as 65

The role of increased pulmonary blood flow in pulmonary arterial hypertension

Methods

Chapter 4

Patients with congenital heart disease associated with systemic-to-pulmonary shunts, increasing both pulmonary blood flow and pressure, develop characteristic pulmonary vascular lesions as concentric-laminar intimal fibrosis and plexiform lesions. These vascular lesions are characterized by vascular smooth muscle and endothelial cell proliferation. In contrast, in patients with congenital heart defects and isolated increased pulmonary arterial pressure, these lesions almost never develop 1;2. We hypothesize that, in congenital heart defects, increased pulmonary blood flow, in addition to increased pressure, is a prerequisite for the development of the hallmark lesions of advanced pulmonary arterial hypertension. Animal models with an isolated increase in pulmonary arterial pressure, such as induced by the toxic alkaloid monocrotaline, do show pulmonary vascular remodeling, but fail to display the more advanced lesions, as described above 3-5. The role of increased pulmonary blood flow has been explored in animal models 6. In rat models with isolated increased flow 7;8, a moderate increase in pulmonary pressure and medial hypertrophy has been observed, but only after a prolonged period of exposure. When the additional effect of flow was explored in existing rat models for pulmonary arterial hypertension, cellular occlusion of small vessels, referred to as neointimal formation, was observed only in animals with increased pulmonary blood flow 9-11. In contrast, one recent report suggests a favorable effect of increased blood flow. In this study, rats with an abdominal aortocaval shunt in addition to monocrotaline showed a reduction in neointimal formation 10. In the present study, the role of increased pulmonary flow induced by an abdominal aortocaval shunt in the monocrotaline rat model is explored in further detail by thorough hemodynamic, echocardiographic and histopathological characterization, with special emphasis on neointimal formation.

described by Garcia 12 under pentobarbital anesthesia (60 mg/kg intraperitoneally). Shunt patency was verified visually as swelling, color change and pulsation of the caval vein. Animals were weighed, watched for dyspnea and sacrificed when a 15% weight loss or debilitating dyspnea occurred. Matched rats from the other groups were sacrificed simultaneously. Echocardiography In 4 rats of each group, echocardiographic studies were performed under pentobarbital anesthesia before and 4 weeks after the administration of monocrotaline using a 12 MHz phased array transducer (Sonos 5500, Hewlett-Packard Inc, Andover, Massachusetts, USA). Ventricular dimensions and flow profiles over the aortic, pulmonary and tricuspid valve were measured in standard views 13. Cardiac output (ml/min) was calculated using the following equation: cardiac output = aortic valve-area * aortic velocity-time integral * heart rate. Hemodynamics At sacrifice, animals were anesthetized and ventilated with room air. Pulmonary arterial pressures were measured according to Rabinovitch 14. If these pressures could not be obtained, right ventricular systolic pressure was recorded as being equal to systolic pulmonary arterial pressure. Via the left carotid artery, systemic arterial pressures were measured. Pathology After hemodynamic measurements, the thorax was opened and the presence of pleural fluid was noted. Atria, ventricles and lungs were weighed separately. The left lung was fixed in 3.6% formalin. Sections were stained with hematoxylin-eosin and resorcin fuchsin elastin stain 15 for morphometric analysis of vascular dimensions using routine staining procedures. Additional sections were stained with antibodies against eNOS (dilution 1:500, BD Transduction Laboratories, Lexington, KY, USA) and alfa-smooth muscle actin (Dako, Glostrup, DK). Paraffin sections were dewaxed and incubated with monoclonal antibodies for 1 hour. Rabbit anti-mouse IgG coupled to peroxidase was used as secondary antibody (dilution 1:100). The sections were stained with diaminobenzidine for 10 minutes and counterstained with hematoxilin. Histology In lung sections all arteries > 50 micrometer (pre-acinar) and 40 randomly chosen vessels < 50 micrometer (intra-acinar) were assessed at 200 and 400 times magnification using an image analysis system (CZ KS400, Imaging Associates, Bicester, UK). Three different vascular areas were defined: outer vessel area, inner vessel area and luminal area. Outer vessel area was defined as the area within the lamina elastica externa (LEE). The area within the lamina elastica interna (LEI) was denoted as inner vessel area. Wall area was calculated by subtracting luminal area from outer vessel 66

Results Three rats had to be excluded from further analysis due to unsuccessful shunt surgery, two from the AV-group and one from the MC + AV group. Reduced growth, lethargy and dyspnea were observed in the MC and MC + AV groups in the 5th and 6th week after monocrotaline administration. This led to the sacrifice of all rats in this period within a window of one week. Symptoms appeared earliest and most severe in MC+AV rats, leading to preliminary death in 5 out of 11 of these rats (table 1). Echocardiography Increased pulmonary blood flow due to the AV-shunt was confirmed by an increased calculated cardiac output at 4 weeks compared to non-AV rats (259 ± 28 vs. 150 ± 12 ml/min, p = 0.002). Furthermore, an increased diastolic left ventricular internal diameter (8.52 ± 0.22 vs. 6.73 ± 0.34 mm, p = 0.001), an increased diastolic right ventricular internal diameter (5.78 ± 0.20 vs. 4.15 ± 0.33 mm, p = 0.001) and a significantly higher left ventricular mass (1.17 ± 0.06 vs. 0.95 ± 0.03 grams, p = 0.004) were noted in the animals with a shunt compared to animals without shunt. Right ventricular wall thickness, as indication for increased right ventricular afterload, was increased in animals treated with monocrotaline compared to those 67


Statistical analysis Data are expressed as mean ± standard error of the mean (SEM). Differences between groups were determined using one-way analysis of variance (ANOVA) with Bonferroni post-hoc correction, using non-parametric tests when required (MannWhitney and Kruskall- Wallis). Statistical significance was determined as p < 0.05.

Chapter 4

area. Medial area was defined as outer vessel area minus inner vessel area. Intimal area was calculated by subtracting luminal area from the inner vessel area and expressed as a percentage of inner vessel area. Areas were transformed into diameters using the formula: diameter = 2 * square root (area/π). In the pre-acinar pulmonary arteries the ratio between wall thickness and luminal diameter was calculated. Vessels < 50 micrometer usually do not have a clearly discernible internal elastic lamina. Therefore, a vascular occlusion score was calculated in these vessels as opposed to the calculation of a medial wall to lumen ratio in the larger pulmonary arteries. Occlusion was calculated in the intra-acinar pulmonary vessels according to the following formula: (outer vessel area – luminal area)/(outer vessel area). Pulmonary arteries were excluded from measurement if they had a longest/shortest diameter of more than 2, an incomplete circular shape or a collapse of more than one quarter of the vessel wall. Muscularization of 40 small pulmonary vessels was assessed according to Van Suylen and coworkers 3.

Table 1. Animal characteristics. Animals with excessive thoraxfluid (>12 ml)

Animals that determined the moment of sacrifice

Body weight at sacrifice (gram)

CON

0/11 (0%)

0/6 (0%)

409 ± 7

AV

0/6 (0%)

0/6 (0%)

429 ± 24

MC

3/8 (37,5%)

1/6 (16%)

360 ± 6 *

MC + AV

10/11 (91%)

5/6 (83%)

339 ± 9 *

For the number of animals that determined the moment of sacrifice, only the first six animals from each group are shown, since the higher numbers did not have a matched control in all other groups. Body weight is shown as mean ± SEM. CON = healthy control animals, AV = animals with increased pulmonary blood flow due to an aortocaval shunt, MC = animals with increased pulmonary arterial pressure due to monocrotaline injections and MC + AV = animals with both increased pulmonary arterial pressure and increased pulmonary blood flow, receiving both monocrotaline and an aortocaval shunt. * = p < 0.05 vs. control animals Table 2. Heart weights in grams (g). CON

AV

MC

RV (g)

0.234 ± 0.009

0.368 ± 0.017 *

0.394 ± 0.040 *

0.523 ± 0.023 †

IVS (g)

0.305 ± 0.012

0.393 ± 0.033 †

0.286 ± 0.015

0.309 ± 0.015

LV (g)

0.526 ± 0.022

0.735 ± 0.036 †

0.459 ± 0.017

0.516 ± 0.034

RA (g)

0.029 ± 0.003

0.077 ± 0.006 *

0.053 ± 0.011

0.107 ± 0.006 †

LA (g)

0.019 ± 0.002

0.062 ± 0.006 *

0.033 ± 0.006

0.035 ± 0.003 *

HW/BW

2.72 ± 0.07

3.82 ± 0.12 *

3.39 ± 0.14 *

MC + AV

4.42 ± 0.16 †

RV = right ventricle, IVS = inter ventricular septum, LV = left ventricle, RA = right atrium, LA = left atrium, HW/BW = heart weight to body weight ratio. CON = healthy control animals, AV = animals with increased pulmonary blood flow due to an aortocaval shunt, MC = animals with increased pulmonary arterial pressure due to monocrotaline injections and MC + AV = animals with both increased pulmonary arterial pressure and increased pulmonary blood flow, receiving both monocrotaline and an aortocaval shunt. * = p < 0.05 vs. control, † = p < 0.05 vs. all other groups.

68

140

100

CON AV MC MC + AV

120

†

60

* * *

80 60 40

20

20

0

0 sPAP

sSAP

without monocrotaline administration (1.06 ± 0.11 vs. 0.72 ± 0.03 mm, p = 0.02). Three out of the four MC + AV rats developed a significant tricuspid regurgitant jet, that was not present at baseline, compared to none of the animals from the other groups. Hemodynamics Hemodynamic data are shown in figure 1. Systolic pulmonary arterial pressure (sPAP) was increased in the MC and MC + AV group, whereas systolic systemic arterial pressure (sSAP) was decreased only in the MC + AV group. Consequently, the sPAP/sSAP ratio was increased in the MC + AV group compared to the other animal groups (figure 1).

PAP/SAP Figure 1. Pulmonary and systemic arterial pressures. A bar chart demonstrating pulmonary arterial (PAP) and systemic arterial pressures (SAP) and PAP/SAP ratios in healthy control animals (CON n = 9), animals with increased pulmonary blood flow due to an aortocaval shunt (AV n = 6), animals with increased pulmonary pressure due to monocrotaline injections (MC n = 5), and animals with both increased pulmonary arterial pressure and increased pulmonary blood flow, receiving monocrotaline and an aortocaval shunt (MC + AV n = 6). At sacrifice, systolic right ventricular and/or systolic PAP was obtained in a total of 26 rats. Sudden premature deaths in the MC group (one out of eight rats) and MC + AV group (five out of 11 rats) precluded invasive haemodynamic measurements. *: p < 0.05 versus CON; †: p < 0.05 versus CON and AV.

Pathology Ventricular and atrial weights are shown in table 2. Heart weight to body weight ratios increased in all experimental groups with a significantly additive effect in the combined MC + AV group. Right ventricular to left ventricular plus septal weight ratio increased in the MC group with an additive effect of the shunt in the MC + AV group (figure 2). Right atrial weight correlated with echocardiographic diastolic right ventricular internal diameter measured four weeks after surgery (Pearson correlation coefficient 0.61; p = 0.02) 69


40

Chapter 4

80

100

PAP/SAP ratio (%)

Pressures (mmHg)

120

140

Table 3. Pulmonary vascular remodeling. CON

AV

MC

MC + AV

Pre-acinar pulmonary arteries (> 50 µm) Outer vessel diameter (µm)

106.8 ± 5.6

100.7 ± 9.2

106.1 ± 6.5

140.0 ± 4.7 *

Inner vessel diameter (µm)

88.0 ± 5.3

75.3 ± 7.5

78.0 ± 7.3

110.2 ± 4.1 *

Medial wall thickness (µm)

9.4 ± 0.5

12.7 ± 2.1

14.0 ± 2.1 *

14.9 ± 0.7 *

0.12 ± 0.01

0.20 ± 0.04

0.24 ± 0.07 *

0.15 ± 0.01

20 ± 2

24 ± 4

38 ± 6

Wall-lumen ratio Number of arteries

48 ± 4 *

Intra-acinar pulmonary vessels (< 50 µm) Outer diameter (µm)

32.3 ± 0.7

34.3 ± 1.5

32.5 ± 1.0

31.5 ± 0.6

Luminal diameter (µm)

31.5 ± 0.7

32.4 ± 1.7

26.3 ± 1.1 *

25.7 ± 0.6 *

Total wall thickness (µm)

0.38 ± 0.10

0.97 ± 0.21

3.09 ± 0.28 *

2.89 ± 0.23 *

3.7 ± 0.8

8.8 ± 2.0

30.9 ± 2.6 *

29.8 ± 2.0 *

7.0 ± 1.9

12.6 ± 3.6

32.8 ± 8.4 *

24.0 ± 2.8 *

0.9 ± 0.5

0.9 ± 0.5

3.4 ± 1.6

5.0 ± 0.9 *

Luminal occlusion (%) Muscularization - % of vessels that is totally muscularized - % of vessels that is partially muscularized

Diameters, wall thicknesses, occlusion and muscularization of the larger and smaller pulmonary vessels. CON = healthy control animals, AV = animals with increased pulmonary blood flow due to an aortocaval shunt, MC = animals with increased pulmonary arterial pressure due to monocrotaline injections and MC + AV = animals with both increased pulmonary arterial pressure and increased pulmonary blood flow, receiving both monocrotaline and an aortocaval shunt. * = p < 0.05 vs. control.

70

1,0

0,6 0,4

0,0

†

*

Lung weight was significantly increased in both the MC and MC + AV group compared to control animals, with no significant additional effect of the AV-shunt (lung weight: 1.35 ± 0.06 g in CON, 1.72 ± 0.09 g in AV, ns; 2.44 ± 0.34 g in MC, p = 0.001 vs. CON and 2.36 ± 0.12 g in MC + AV, p < 0.001 vs. CON). Histology Pre-acinar pulmonary arteries (> 50 micrometer): Larger pulmonary arteries increased in number and dilated in the MC + AV group (see table 3). Wall thickness increased both in the MC and MC + AV group. No intimal proliferation could be demonstrated in the pre-acinar arteries of either group. Intra-acinar pulmonary vessels (< 50 micrometer): In contrast to the CON and AV group, increased peripheral muscularization and luminal occlusion due to neointimal formation were observed to the same extent in the MC group and in the MC + AV group (table 3, and figure 3, A and B). With immunohistochemistry, this cellular neointimal formation stained positive for both eNOS and for alfa-smooth muscle actin (figure 3, C and D). Relating clinical parameters to hemodynamics and vascular histopathology Rats with thoracic fluid had a significantly lower body weight (348 ± 9 vs. 398 ± 9 gram, p = 0.001), higher systolic pulmonary arterial pressures (59 ± 6 vs. 38 ± 3 mmHg, p = 0.006) a higher cardiac to body weight ratio (4.2 ± 0.1 vs. 3.2 ± 0.1 g/kg, p < 0.001) and right ventricular weight ratio (0.67 ± 0.03 vs. 0.33 ± 0.02, p < 0.001) and more luminal occlusion of the intra-acinar vessels (31.3 ± 2.0 vs. 11.4 ± 2.3 %, p < 0.001) compared to rats without thoracic fluid. A significant correlation was observed between luminal occlusion of the intra-acinar pulmonary vessels and right ventricular hypertrophy (expressed as RV/LV+IVS; Pearson correlation coefficient 0.78; p < 0.001).

71


0,2

CON AV MC MC + AV

Chapter 4

RV/(LV+IVS)

0,8

Figure 2. Futton index. Right ventricular (RV)/left ventricular (LV) + interventricular septum (IVS) weight ratio in healthy control animals (CON), animals with increased pulmonary blood flow due to an aortocaval shunt (AV), animals with increased pulmonary arterial pressure due to monocrotaline injections (MC), and animals with increased pulmonary arterial pressure and increased pulmonary blood flow, receiving monocrotaline and an aortocaval shunt (MC + AV). *: p < 0.05 versus controls; †: p < 0.05 versus all other groups.

A

B

C

D

Discussion

Figure 3. Examples of pulmonary vascular sections. Resorcin-fuchsin elastin staining in a pulmonary intra-acinar vessel in A) control animal and B) an animal that both received monocrotaline and an aortocaval shunt. Immunohistochemical staining of neo-intimal formation in the smaller pulmonary vessels of an animal that received both monocrotaline and an aortocaval shunt, C) staining for endothelial nitric oxide synthase and D) smooth muscle actin. Scale bar = 50 µm.

Aim of the present study was to investigate the role of increased pulmonary blood flow on pulmonary vascular remodeling in pulmonary arterial hypertension. Therefore, an aortacaval shunt was created in monocrotaline-treated rats. Major findings were that, compared to nonshunted monocrotaline-treated rats, shunted monocrotaline-rats showed increased morbidity and mortality. This was associated with increased pulmonary-to-systemic arterial pressure ratios, increased right ventricular hypertrophy and dilatation, and a higher incidence of tricuspid valve regurgitation. Pulmonary vascular histopathology and morphometry revealed no additional effects of flow on the intra-acinar pulmonary vessel remodeling. These findings suggest that the effects of an aortocaval shunt on morbidity and mortality could be attributed to more pronounced right heart failure rather than to altered intra-acinar pulmonary vessel remodeling. Pre-acinar pulmonary arteries did increase in number and size compared to both isolated increased pressure as well as isolated increased flow. The present study, however, does not allow to differentiate between a secondary dilatatory effect of increased flow or an intrinsic remodeling process of these arteries as a cause for this observation. 72


73

Chapter 4

Effects of increased pulmonary flow on pulmonary vascular remodeling In our study, rats with isolated increased pulmonary blood flow did not develop changes in pulmonary arterial pressure and showed a balanced increase in weight of all cardiac compartments. Pulmonary vascular morphometry after 5-6 weeks did not show significant changes compared to control animals. This is congruent with previous reports, where vascular changes usually occur only after much longer periods of exposure to high flow conditions 8;16. Monocrotaline-treated animals without shunt displayed increased pulmonary arterial pressures and right ventricular hypertrophy, while morphometry revealed increased wall thickness and increased muscularization in the pre-acinar pulmonary arteries, as expected from earlier studies 3-5. Interestingly, also occlusion of the intra-acinar vessels was found in monocrotaline-treated rats. These findings are in contrast with previous studies reporting that intima proliferation is caused by the addition of flow in the monocrotaline-treated rats. In these studies luminal occlusion was not reported in the monocrotaline-treated rats without increased pulmonary flow 9;11. On the other hand, our results are in accordance with Nishimura et al 10, who recently described luminal occlusion in pulmonary arterioles in the monocrotaline rat model. In most of these studies 10;11;17;18 a visual scoring system was used to assess the severity of neointimal formation in the smaller pulmonary arteries or the examination was limited to larger pulmonary arteries 9;19-21, whereas the present study provides qualitative and quantitative morphological characterization of the pulmonary vasculature. Animals that received both monocrotaline and a shunt displayed an increased morbidity and mortality compared to all other groups. In this respect, our results contrast to the conclusion of Nishimura and coworkers 10, who suggested a salvage effect of additional flow in monocrotaline-treated rats using the same model. However, in their experimental design, monocrotaline was injected one week after the creation of the aortocaval shunt. Studies in our laboratory showed less pronounced disease development when Nishimura’s procedural order was used (data not shown). In our opinion, this can be explained by the fact that monocrotaline is metabolized in the liver into toxic but unstable metabolites 22. These toxic metabolites have a half-life of a few seconds or less. They therefore have to exert their toxic effect in the initial passage through the lungs. Increased flow by an aortocaval shunt will lower the concentration of the metabolites transported to the lung. This may explain why induction of a shunt before the administration of monocrotaline will lead to a diminished effect of monocrotaline and less advanced pulmonary vascular disease. The nature and severity of the histological changes in the present study is comparable to those reported in other combination models of high pulmonary pressure and flow in the rat 6;9;11. However, the origin of the luminal occlusion of intra-acinar vessels, which is often referred to as neointima, is less clear. In our study, the intraluminal occlusion consisted of cellular material. We concluded that both endothelial cells and vascular smooth muscle cells were present in this neointima, since

it consisted both of cells that stained positive for eNOS and of cells that stained positive for alfa-smooth muscle actin. Effects of increased pulmonary flow on the heart Although pulmonary arterial pressure in shunted monocrotaline-treated rats was comparable to values in non-shunted monocrotaline-treated rats, systemic blood pressure was lower. The lower systemic blood pressures could be attributed to a general decrease in cardiac output at the time of sacrifice. The pronounced right ventricular hypertrophy and increased right-to-left atrial weight ratios do suggest that right ventricular failure rather than biventricular high output failure was the major determinant of heart failure. Echocardiography in rats was established as a useful diagnostic tool for the cardiac assessment of abnormal pulmonary hemodynamics, studying right ventricular wall thickness and ventricular dimensions. The echocardiographical findings of progressive right ventricular dilatation and the development of tricuspid regurgitation in the shunted monocrotaline-treated animals support the diagnosis of right ventricular failure in these animals. Progression of clinical deterioration and right ventricular hypertrophy were correlated with increased luminal occlusion of the small pulmonary vessels, indicating that the development of right ventricular failure is aggravated by the detrimental combination of increased volume load and increased afterload of the right ventricle. Taken together, results suggest that increased morbidity and mortality in the shunted monocrotaline-treated rats could be attributed to effects on the heart rather than to altered pulmonary vascular remodeling. Limitations of the study In the present model, monocrotaline could be regarded as a confounding factor to flow, because its metabolites induce direct pulmonary endothelial cell damage that might possibly obscure the effects of flow on these endothelial cells. However, neointimal formation, a key feature in pulmonary vascular remodeling in pulmonary arterial hypertension, is induced in this model. Other models, creating left-to-right shunts in young animals 16;23;24 might have advantages with respect to affecting flow and pressure in the pulmonary arteries comparable to the situation in congenital heart disease. However, the increase in pulmonary arterial pressure in these models is moderate and until now, they failed to display the more advanced lesions of pulmonary arterial hypertension. These lesions distinguish pulmonary arterial hypertension from other forms of pulmonary hypertension and therefore probably form an important clue in the pathophysiology of pulmonary arterial hypertension. Furthermore, our study does not allow to answer the question whether increased pulmonary flow induced specific vascular cell responses at a molecular level, that might explain why in congenital heart defects the advanced pulmonary vascular lesions of pulmonary arterial hypertension occur almost exclusively in the presence of increased pulmonary blood flow. 74


75

Chapter 4

Conclusion The present study aimed to investigate the role of increased flow in flow-associated pulmonary arterial hypertension. Detrimental effects of increased pulmonary blood flow in the aortacaval-shunted monocrotaline rat model were demonstrated by increased morbidity and mortality. These effects could, however, not be attributed to histopathological aggravation of pulmonary vascular remodeling. In contrast to earlier reports, the neointimal reaction described in the shunted monocrotaline-treated rats in our study was not identified as a specific effect of the increased pulmonary flow, as it was demonstrated to be present also in rats treated with monocrotaline solely. Hemodynamic, echocardiographical and pathological data suggested pronounced right ventricular failure to be the cause for the increased morbidity and mortality, rather than altered pulmonary vascular remodeling. Further research on the specific role of increased pulmonary blood flow in the development of advanced pulmonary vascular lesions in pulmonary arterial hypertension, associated with congenital heart defects, is needed to understand the pathogenesis of this progressive pulmonary vascular disease.

References 1.

Geiger R, Berger RM, Hess J, Bogers AJ, Sharma HS, Mooi WJ. Enhanced expression of vascular endothelial growth factor in pulmonary plexogenic arteriopathy due to congenital heart disease. J Pathol. 2000;191:202-207.

2.


3.

Van Suylen RJ, Smits JF, Daemen MJ. Pulmonary artery remodeling differs in hypoxia- and monocrotaline-induced pulmonary hypertension. Am J Respir Crit Care Med. 1998;157:1423-1428.

4.

Todorovich-Hunter L, Dodo H, Ye C, McCready L, Keeley FW, Rabinovitch M. Increased pulmonary artery elastolytic activity in adult rats with monocrotaline-induced progressive hypertensive pulmonary vascular disease compared with infant rats with nonprogressive disease. Am Rev Respir Dis. 1992;146:213-223.

5.

Guzowski DE, Salgado ED. Changes in main pulmonary artery of rats with monocrotaline-induced pulmonary hypertension. Arch Pathol Lab Med. 1987;111:741-745.

6.

Botney MD. Role of hemodynamics in pulmonary vascular remodeling: implications for primary pulmonary hypertension. Am J Respir Crit Care Med. 1999;159:361-364.

7.

Qi J, Du J, Tang X, Li J, Wei B, Tang C. The upregulation of endothelial nitric oxide synthase and urotensin-II is associated with pulmonary hypertension and vascular diseases in rats produced by aortocaval shunting. Heart Vessels. 2004;19:81-88.

8.

Dai ZK, Tan MS, Chai CY, Chen IJ, Jeng AY, Wu JR. Effects of increased pulmonary flow on the expression of endothelial nitric oxide synthase and endothelin-1 in the rat. Clin Sci (Lond). 2002;103 Suppl 48:289S-293S.

9.

Tanaka Y, Schuster DP, Davis EC, Patterson GA, Botney MD. The role of vascular injury and hemodynamics in rat pulmonary artery remodeling. J Clin Invest. 1996;98:434-442.

10. Nishimura T, Faul JL, Berry GJ, Kao PN, Pearl RG. Effect of a surgical aortocaval fistula on monocrotaline-induced pulmonary hypertension. Crit Care Med. 2003;31:1213-1218. 11. Okada K, Tanaka Y, Bernstein M, Zhang W, Patterson GA, Botney MD. Pulmonary hemodynamics modify the rat pulmonary artery response to injury. A neointimal model of pulmonary hypertension. Am J Pathol. 1997;151:1019-1025. 12. Garcia R, Diebold S. Simple, rapid, and effective method of producing aortocaval shunts in the rat. Cardiovasc Res. 1990;24:430-432. 13. Kato Y, Iwase M, Kanazawa H, Kawata N, Yoshimori Y, Hashimoto K, Yokoi T, Noda A, Takagi K, Koike Y, Nishizawa T, Nishimura M, Yokota M. Progressive development of pulmonary hypertension leading to right ventricular hypertrophy assessed by echocardiography in rats. Exp Anim. 2003;52:285-294.

76

14. Rabinovitch M, Gamble W, Nadas AS, Miettinen OS, Reid L. Rat pulmonary circulation after chronic hypoxia: hemodynamic and structural features. Am J Physiol. 1979;236:H818-H827. 15. Proctor GB, Horobin RW. Chemical structures and staining mechanisms of Weigert’s resorcinfuchsin and related elastic fiber stains. Stain Technol. 1988;63:101-111.

18. Faul JL, Nishimura T, Berry GJ, Benson GV, Pearl RG, Kao PN. Triptolide attenuates pulmonary arterial hypertension and neointimal formation in rats. Am J Respir Crit Care Med. 2000;162:22522258. 19. Colice GL, Hill N, Lee YJ, Du H, Klinger J, Leiter JC, Ou LC. Exaggerated pulmonary hypertension with monocrotaline in rats susceptible to chronic mountain sickness. J Appl Physiol. 1997;83:25-31. 20. Stenmark KR, Morganroth ML, Remigio LK, Voelkel NF, Murphy RC, Henson PM, Mathias MM, Reeves JT. Alveolar inflammation and arachidonate metabolism in monocrotaline-induced pulmonary hypertension. Am J Physiol. 1985;248:H859-H866. 21. Todd L, Mullen M, Olley PM, Rabinovitch M. Pulmonary toxicity of monocrotaline differs at critical periods of lung development. Pediatr Res. 1985;19:731-737. 22. Huxtable RJ. Activation and pulmonary toxicity of pyrrolizidine alkaloids. Pharmacol Ther. 1990;47:371-389. 23. Black SM, Fineman JR, Steinhorn RH, Bristow J, Soifer SJ. Increased endothelial NOS in lambs with increased pulmonary blood flow and pulmonary hypertension. Am J Physiol. 1998;275: H1643-H1651. 24. Jouannic JM, Roussin R, Hislop AA, Lanone S, Martinovic J, Boczkowski J, Dumez Y, Dinh-Xuan AT. Systemic arteriovenous fistula leads to pulmonary artery remodeling and abnormal vasoreactivity in the fetal lamb. Am J Physiol Lung Cell Mol Physiol. 2003;285:L701-L709.

77


17. Nishimura T, Faul JL, Berry GJ, Vaszar LT, Qiu D, Pearl RG, Kao PN. Simvastatin attenuates smooth muscle neointimal proliferation and pulmonary hypertension in rats. Am J Respir Crit Care Med. 2002;166:1403-1408.

Chapter 4

16. Rondelet B, Kerbaul F, Motte S, van Beneden R, Remmelink M, Brimioulle S, McEntee K, Wauthy P, Salmon I, Ketelslegers JM, Naeije R. Bosentan for the prevention of overcirculation-induced experimental pulmonary arterial hypertension. Circulation. 2003;107:1329-1335.

Chapter 5 Gene expression profiling in a rat model of flow-associated pulmonary hypertension: effects of pulmonary blood flow and prostacyclin treatment

Mirjam E. van Albada, Beatrijs Bartelds, Hans Wijnberg, Saffloer Mohaupt, Regien G. Schoemaker, Krista Kooi, Frans Gerbens, Rolf M.F. Berger

Manuscript in preparation

Abstract Introduction: Pulmonary arterial hypertension is a disease with high morbidity and mortality. Increased pulmonary blood flow can trigger pulmonary arterial hypertension, but the pathophysiological mechanisms are unclear. We employed a rat model of flow-associated pulmonary arterial hypertension to explore the pathophysiological mechanisms at molecular level and to test the effects of a commonly used treatment: the prostacyclin analogue iloprost. Methods: Male Wistar rats were injected with monocrotaline (60 mg/kg) followed by sham surgery or the creation of an abdominal aortocaval shunt one week later. Rats that were injected with saline and sham operated served as healthy controls. Part of the rats with the combination of monocrotaline and a shunt was treated with the prostacyclin analogue iloprost (72 µg/kg/day in osmotic minipumps). A semirandomized cross-over experiment was performed with lung mRNA microarray. Important results were verified by RT-PCR. Results: Clustering of significantly regulated genes revealed expression profiles for each group. Monocrotaline-treated rate had increased mast cell proliferation, which was diminished by iloprost treatment. Increased pulmonary blood flow specifically led to increased expression of activating transcription factor 3 and early growth re sponse protein 1. Wnt-signaling was altered both by monocrotaline and by the induction of increased pulmonary blood flow. Moreover, iloprost treatment increased several genes from the Wnt-signaling pathway. Conclusion: Monocrotaline and increased pulmonary blood flow each contribute to specific changes in pulmonary gene expression that could be of importance in the pathogenesis of pulmonary arterial hypertension. Treatment with iloprost partly reverses these changes. Interesting new pathobiological pathways emerged from this analysis.

80

Introduction

We compared pulmonary gene expression levels in four animal groups using a cross-over designed microarray experiment. Rats that were administered monocrotaline (MC) were compared to healthy controls (CON) and to rats that received both monocrotaline and an abdominal aortocaval shunt (MC + AV). Finally, iloprost treated MC+AV rats were compared to saline treated MC + AV rats. Animal model Twenty-four male Wistar rats (Harlan, the Netherlands) weighing 250-300g were used. Animal care and experiments were conducted according to the Dutch Animal Experimental Act. The Erasmus University and the University of Groningen Animal Care and Use Committees approved the experimental protocols. Rats were randomly assigned to the four experimental groups: 1) control (CON; n 81

Gene expression profiling in a rat model of flow-associated pulmonary hypertension: effects of pulmonary blood flow and prostacyclin treatment

Methods

Chapter 5

Pulmonary arterial hypertension is a disease with high morbidity and mortality. It is caused by progressive pulmonary vascular obliteration and often occurs in patients with large cardiac left-to-right shunts 1. The pathological mechanism at a molecular level is still poorly understood. Interestingly, the presence of increased pulmonary blood flow appears to be a predisposing factor in a large number of patients 2. Treatment with prostacyclin analogues is effective in diminishing disease severity 3-6. However, the mechanism behind this therapy is also poorly understood. Several animal models for pulmonary arterial hypertension (PAH) have been developed. The monocrotaline rat model is a classical rat model for PAH associated with increased pulmonary pressures, but these animals do not develop advanced pulmonary vascular lesions and this model lacks the component of increased pulmonary blood flow as is present in patients with congenital heart defects 7. Secondly, animal models using solely increased flow were explored. These models usually show increased medial wall thickness of the pulmonary vessels without further associated remodeling 8-10. Finally, combination models with both an increase in pulmonary blood flow and in pressure were developed 11-14. In our laboratory, we employ a rat model using monocrotaline in combination with an abdominal aortacaval shunt. This rat model displays severely increased pulmonary arterial pressures, advanced pulmonary vascular lesions and progressive right ventricular failure 14. We used this model to identify pathways that are important in the pathogenesis of flow-associated PAH and to test whether these pathways are involved in mediating the effects of iloprost treatment. For that purpose, we performed a semi-randomized cross-over designed microarray experiment with mRNA isolated from total lung tissue. We verified the most important results histopathologically and using RT-PCR.

= 6), 2) monocrotaline-treated rats (MC; n = 6; single dose of monocrotaline 60 mg/kg sc, Sigma Chemical Co, St. Louis, MO, USA), 3) monocrotaline plus aortocaval shunt (MC + AV; n = 6; monocrotaline injection followed by the creation of an abdominal aortocaval shunt one week later 14, 4) MC + AV treated with the prostacyclin analogue iloprost (ILO; n = 6). Rats were weighed, daily watched for dyspnea, defined as the use of accessory respiratory muscles and/or gasping, and sacrificed when a 15% weight loss or debilitating dyspnea occurred. Matched rats in the other experimental groups were sacrificed simultaneously. Treatment protocols Osmotic minipumps (model 2004, Alzet, Palo Alto, CA, USA) with iloprost (72 µg/kg/day; a generous gift of Schering, the Netherlands) were implanted subcutaneously in the same operative session as the creation of the abdominal aortocaval shunt. Hemodynamic measurements The mean day of sacrifice was 36.5 ± 0.6 days after the administration of monocrotaline. At the time of sacrifice, rats were anesthetized with pentobarbital (60 mg/kg intraperitoneally) and ventilated with room air. Pulmonary arterial pressures were measured with a technique described by Rabinovitch 15 that is routinely used in our laboratory 14. If pulmonary arterial pressure could not be obtained, right ventricular systolic pressure was recorded as being equal to systolic pulmonary arterial pressure. By introducing a catheter via the left carotid artery into the aorta, systemic arterial pressures as well as heart rate were measured. RNA isolation and experimental design of the microarray experiment RNA was isolated from total frozen lung tissue using a Qiagen RNeasy kit (Qiagen, Venlo, The Netherlands). A DNase treatment step (RNase free DNase, Qiagen) was included in the protocol. Integrity and concentration of RNA was controlled using the Agilent 2100 Bioanalyzer (Agilent, Palo Alto, CA, USA). The microarray experiment was designed to meat the MIAME criteria for microarray data 16. To minimize biases due to biological variation of the individual rats, each sample for microarray analysis contained equal amounts of pooled RNA from 2 rat lungs from one of the experimental groups, yielding a total of 3 pooled samples per group or 12 samples in total. Each pooled sample was analyzed in two-fold either being labeled with Cyanine 3 or Cyanine 5 in a semi-randomized cross-over design, where in 2 cases samples served as their own controls on one microarray slide to determine variation due to dye type, while the other samples were hybridized in a random way. Microarrays Microarrays contained 26,962 oligonucleotides available in the Operon-Rat Array list (V3.0, available at http://microarray.uc.edu/) representing genes from a diverse range of functionalities. Positive and negative controls were also represented on the 82

arrays. Microarrays were obtained from the Genomics and Microarray laboratory (University of Cincinatti, Cincinatti, OH, USA).

83


Microarray analysis To account for dye bias, signal data were log-transformed and normalized by intensity-dependent regression (Lowess). After filtering of empty spots, control spots, spots with high between-pixel-intensity variability and spots designated as bad by eye, a scatterplot for the median signal intensity of both fluorescent labels was constructed. Moreover, a multivariate permutation test was applied to account for a false discovery rate of maximal 10% in the set of significantly differentially expressed genes. Genes that showed a significant (p < 0.005) change, taking into account both dyes and 3 samples per group, were considered candidates. Analyses were performed using BRB ArrayTools developed by Dr. Richard Simon and Amy Peng Lam (http:// linus.nci.nih.gov/BRB-ArrayTools.html). Clustering of the significantly regulated genes was performed on the basis of their differences as they appeared in different pairwise comparisons, according to a method described by Buermans et al 17. If the expression level of a gene was significantly different between the control rats and the monocrotaline-treated rats, it was denoted with a ‘1’, and if there was no difference observed as a ‘0’. This was also done for monocrotaline versus MC + AV and for MC + AV versus control rats. With three pair wise comparisons, 7 combinations are possible. A gene with no significant difference between controls and monocrotaline-treated rats (0), a significant difference between monocrotaline-treated rats and MC + AV rats (1) and a significant difference between MC + AV rats and control rats (1) would then be assigned to cluster 0-1-1. In the remainder of the article, these clusters will be addressed as cluster

Chapter 5

Probe construction For each RNA sample, first strand amino-modified cDNA was synthesized by LinAmp oligo dT primed reverse transcription of 2 ug RNA using Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA, USA). Doublestranded cDNA was synthesized by E. Coli DNA polymerase I (Invitrogen) and purified with a PCR purification kit (Qiagen). Subsequent in vitro transcription of the cDNA was performed employing the T7 Megascript kit (Ambion, Austin, TX, USA). The reaction was stopped after 16 hours at 37°C by purification of the amplified RNA (Qiagen, RNeasy mini). Five µg of the amplified aminoallyl-RNA was fluorescently labeled with Cyanine 3 or Cyanine 5 fluorophores (Amersham Biosciences, Buckinghamshire, UK). Labeled RNA was purified using Microcon YM-30 columns (Millipore, Billerica, MA, USA). Hybridization was performed after mixing the labeled RNA samples from the appropriate samples with 15 μg poly-dA DNA (Qiagen). Hybridizations were performed under liftersslips (Erie Scientific, Portsmouth, NH, USA) within hybridization chambers (Telechem, Sunnyvale, CA, USA). After hybridization the slides were washed, dried and scanned at 10 µm resolution in a GMS 428 laser scanner (Affymetrix, Santa Clara, CA, USA). Image intensity data for each spot were extracted by ImaGene version 5.6 software (BioDiscovery, El Segundo, CA, USA).

Table 1. Gene cluster classification.

Cluster

CON vs. MC

CON vs. MC + AV

MC vs. MC + AV

Number of genes

Up-/downregulatiuon

number regulated by iloprost-treatment

0 1 0 1 0 1 1

1 1 0 0 1 1 0

1 0 1 0 0 1 1

9 18 69 75 38 1 15 Total 225

5/4 16/2 18/51 67/8 22/16 1/0 13/2 Total 142/83

5 1 24 4 6 1 6 Total 47

I II III IV V VI VII

Table 2. Primer sequences. Gene

Primer sequence

Tryptase

F 5’- CTGACCGTGAGCCAGATCAT -3’ R 5’- GTGGACGTTGTCACCTGTGT -3’

IgE-Fc receptor

F 5’- GTGAGTGCCACCATTCAAGA -3’ R 5’- TGGTAGCTGCCACTGTCATT -3’

ATF3

F 5’- AACATCCAGGCCAGGTCTCT -3’ R 5’- GGATGGCGAATCTCAGCTCT -3’

Il-9 receptor

F 5’- GGAGATGTCTCCGAGTTCAG -3’ R 5’- CGATGTCGTCTCATCAGTGT -3’

PreproEndothelin-1

F 5’- TTGCTCCTGCTCCTCCTTGA -3’ R 5’- AGCACACTGGCATCTGTTCC -3’

Wnt 5a

F 5’- ATTGGAGAAGGCGCGAAGAC -3’ R 5’- ATTCCTTGGCGAAGCGGTAG -3’

Wnt inhibitory factor

F 5’- ACTCCTGGCTTCTGCATCTG -3’ R 5’- GGCACTTGCTGAGTTCACAC-3’

Carboxypeptidase Z

F 5’- CCTGCCACCTACCTTCATTC -3’ R 5’- ACCTCAGGCTCCATCAGTTC -3’

84

I-VII (table 1). Note that in this method, the direction of change is not taken into account.

Statistical analysis Data are presented as mean ± standard error of the mean (SEM). Group differences were analyzed using one-way ANOVA testing with Fisher’s protected LSD post-hoc testing. Correlation analysis was performed with Pearson’s correlation test. Alpha was chosen to be 0.05.

85


Pulmonary histopathology Heart and lungs were weighed and fixed in 3.6% formalin. Pulmonary sections (5 µm thickness) were stained with resorcin-fuchsin elastin stain for morphometric analysis of vascular dimensions according to a previously described protocol 14. In lung sections, 40 randomly chosen vessels (10 in each left lung quadrant) with a diameter less than 50 micrometer (intra-acinar vessels) were assessed at 200 and 400 times magnification using an image analysis system (CZ KS400, Imaging Associates, Bicester, UK) 14. Data from the gene array revealed elevated mast cell marker genes. Therefore, the amount of mast cells in the pulmonary tissue of the rats was determined. To localize and quantify mast cells in the lungs, toluidin blue stained lung sections were counted for their presence. One section of each rat lung was counted. The lungs were divided into four structural categories: 1) parenchyma, 2) peribronchial, 3) small artery (diameter < 50 micrometer), 4) large artery (diameter > 50 micrometer). Per section mast cells in five views per category were counted with a magnification of 400 times.

Chapter 5

Real time PCR analysis Gene specific PCR primers were designed with Clone Manager v.5 to generate amplification products with a length of 75-250 bp spanning at least one exon-exon junction. Primers were purchased from Biolegio (Nijmegen, The Netherlands). Primer pairs were checked for a linear response and for nonspecific products with dissociation curves and agarose gel electrophoresis after specific enzymatic digestion. Primer sequences for the different genes are provided in table 2. Changes in expression of mentioned genes were confirmed with real time two-step quantitative RT-PCR. First, 1 µg RNA was reversely transcribed into cDNA in a 20 µl reaction volume. Then quantification was performed with SYBR Green PCR reagents (Molecular Probes, Leiden, The Netherlands) in an ABI PRISM 5700 Sequence Detection System (Applied Biosystems, Nieuwerkerk, The Netherlands), as previously described 18. The PCR profile consisted of 5 min at 95°C, followed by 40 cycles with heating to 95°C for 15 sec and cooling to 60°C for 1 min.


A

Figure 1. Hemodynamic and (histo)pathological characteristics of the rats. A) Mean pulmonary arterial pressure B) Right ventricular hypertrophy (RV/(LV + IVS)) C)Intra-acinar vascular occlusion * = p < 0.05 vs. CON, † = p < 0.05 vs. MC + AV.

70 60

CON MC MC + AV ILO

*

50

*

40 30 20 10 0

Right ventricular hypertrophy

B

0,8

0,6

CON MC MC + AV ILO

*

* * †

0,4

0,2

0,0

C

Intra-acinar vessel occlusion

35 30 25 20 15 10 5 0

86

*

CON MC MC + AV ILO

*

*

Results

Classifation in clusters Seven different clusters were formed based on the difference in expression profiles between the experimental groups (table 1). Changes in the different clusters are presented in graphs in figure 2. Cluster I contains 9 genes that were altered only by increased pulmonary blood flow. They were not influenced by monocrotaline treatment, but were altered in the MC + AV group both compared to CON rats and compared to MC rats. Five of these genes were also influenced by iloprost therapy. Two genes from this cluster warrant further discussion. Both are transcription factors. Activating transcription factor 3 (ATF3) is a gene which is linked to stress-induced apoptosis 19. It is upregulated in the combination model, and downregulated in the iloprost treated rats compared to the pulmonary hypertensive group. Early growth response protein 1 (Egr-1), a zinc finger transcription factor, is also upregulated in the MC + AV group, and again downregulated in the iloprost group. Egr-1 has a role in atherosclerosis, neointima formation and angiogenesis 20. In contrast to cluster I, cluster II contains genes that were altered only by monocrotaline, without an effect of the aortocaval shunt. This cluster contains 18 genes, of which only 1 was also affected by therapy. Seven genes play a role in inflammation. Immunoglobulin J chain precursor isoform 2, IgE-Fc receptor high affinity I alpha polypeptide, complement component 1, heme oxygenase 1 and the immunoglobulin 4G6 heavy chain variable region were all uniformly upregulated by monocrotaline. Moreover, two mast cell markers, chymase 1 and tryptase beta 1 were found to be upregulated due to monocrotaline. Furthermore, growth differentiation factor 87


Microarray analysis 9559 Of the 22012 genes (43%) passed the criteria for further analysis. Of these genes, 387 showed significant changes in the analysis.

Chapter 5

Animal model Monocrotaline treatment and the creation of an abdominal aortocaval shunt induced pulmonary arterial hypertension as described previously 14. Briefly, mean pulmonary arterial pressure was increased in the MC and MC + AV rats, and decreased in the ILO-group (figure 1A). Right ventricular hypertrophy, presented as right ventricular to left ventricular plus septal weight ratio, was present in both the MC and the MC + AV group, and was not altered by treatment (figure 1B). All three experimental groups showed increased pulmonary vascular muscularization as compared with CON (percentage non-muscularized vessels 94 ± 3% in CON, 63 ± 10% in MC, 74 ± 4% in MC + AV and 60 ± 4% in the ILO group, all p < 0.05 vs. CON). The same was true for luminal occlusion due to neo-intima formation (figure 1C). Moreover, in all three experimental groups, body weights decreased (body weight 404 ± 10 g in CON, 359 ± 8 in MC, 343 ± 10 in MC + AV and 352 ± 8 in ILO, all p < 0.01 vs. CON).

CLUSTER I

CLUSTER V

4

2

2

Log2 ratio

Log2 ratio

*

4

*†

0

-2

0

-2

-4

-4 CON

MC

MC + AV

ILO

CON

MC

MC + AV

ILO

CLUSTER VI CLUSTER II

*

4

*

2

Log2 ratio

2

Log2 ratio

‡

4

*

0

*† 0

-2

-2

-4

-4

CON

MC

MC + A

ILO

CON

CLUSTER III

MC + AV

ILO

CLUSTER VII

4

4

*

†

2

2

Log2 ratio

Log2 ratio

MC

0

-2

†

0

-2

-4

-4

CON

MC

MC + AV

ILO

CON

MC

MC + AV

ILO

CLUSTER IV

*

4

Log2 ratio

2

Figure 2. Gene expression plots for the 7 separate clusters. Y-axis: log2 gene expression ratios of the 4 groups. The expression in the CON group is set to zero. * = significant vs. CON group, † = significant vs. MC group, ‡ = significant vs. MC + AV group.

0

-2

-4 CON

88

MC

MC + AV

ILO


89

Chapter 5

15, from the BMP/GDF-family, and the potassium channel Kcnk1 were also increased in the monocrotaline-treated rats. Cluster III contains genes that are influenced by pulmonary blood flow, while in the MC + AV group there are no differences in expression of these genes compared to the CON group, suggesting a partially counteracting effect of monocrotaline administration. This cluster contains 69 genes, of which the majority was downregulated. Thirty-five percent of these genes (n = 24) were also influenced by iloprost treatment, mostly in the opposite direction of the effect of the shunt. The negative regulator of programmed cell death ‘defender against cell death 1’ (Dad1) and the pro-proliferative platelet-derived growth factor receptor-like (Pdgfrl), pleiotrophin (Ptn) and the heparin-binding growth-associated molecule were all downregulated as effect of the shunt. The 5-hydroxytryptamine 1B receptor (Htr1b) and the potassium voltage-gated channel from the shaker-related subfamily were both upregulated as effect of the shunt. Interestingly, endothelin-1, an important mediator of pulmonary arterial hypertension in patients, was also upregulated as effect of the shunt. However, this change was not significant compared to control rats. Cluster IV contains genes that are influenced by monocrotaline, while the increase of pulmonary blood flow renders these changes non-significant in the MC + AV group, suggesting a partially counteracting effect. This cluster contains a total of 75 genes, most of which increase under the influence of monocrotaline. Only 4 of these genes were also influenced by iloprost treatment. A disintegrin-like and metalloprotease with thrombospondin type 1, fibronectin 1 (Fn1) and connective tissue growth factor, that all play a role in matrixremodeling, were increased, as were coagulation factor 2, the interleukin 9 receptor and annexin A5, which binds to phosphatidylserine, one of the “eat me” signals on the surface of a cell in apoptosis. Finally, the expression of the potassium inwardly-rectifying channel Kcnj8 was also increased. The regulation of genes in cluster V is complex, since these 38 genes are solely altered in the MC + AV group compared to the CON group. Thus, they need both stressors to be either activated or inactivated. Six of these genes were also influenced by treatment with iloprost. Five of these genes were related to inflammation, and all of them were increased in the model. Several genes that can be related to cellular proliferation were also altered in this cluster. Frizzled-related protein (Frzb), a protein from the Wnt-signaling cascade, was increased. The fibroblast growth factor intracellular binding protein (Fibp), with a role in matrix remodeling, was also increased, while the neuropeptide Y receptor Y2 (Npy2r), that plays a role in the migration, proliferation and tube formation of endothelial cells was decreased. The oxidized low density lipoprotein receptor 1 (Oldlr1), that mediates the recognition, internalization and degradation of the atherosclerotic marker oxidized low density lipoprotein (ox-LDL) by vascular endothelial cells was increased. The 5-hydroxytryptamine receptor type 2B (Htr2b), however, was decreased in rats that received the combination of monocrotaline and a shunt. Cluster VI was designed to contain genes that were altered by monocrotaline, by increased pulmonary blood flow and in the MC + AV group compared to controls.

CON MC MC + AV PGI2

16

Fold regulation compared to control

14

*

12 10 8

*

6

*

*

4 2

IgE-Fc receptor

B

*

100

*

80 60

10

*

0

0

Gene array

C

*

120


Tryptase

A

Gene array

PCR

ATF3

18

D

*†

12

PCR

Il - 9 receptor

14 12 10 8 6

*

‡

4 2

10



16

8

6

4

2

0

0

Gene array

E

Gene array

PCR

F

Endothelin-1

3,0

2,5



* *

2,0

1,5

1,0

0,5

‡ 2,5 2,0 1,5 1,0 0,5 0,0

0,0

Gene array

PCR

Gene array

Wnt inhibitory factor

H

3,0

Carboxypeptidase Z

6



7

‡

1,5

1,0

0,5

5

* *

4

‡ 3 2 1 0

0,0

Gene array

PCR

Gene array

Figure 3. Comparison of gene array and PCR-data. A) Tryptase, B) IgE-Fc receptor, C) ATF3, D Il-9 receptor, E) Endothelin-1, F) Wnt 5a, G) Wnt inhibitory factor, H) Carboxypeptidase Z. * = p < 0.05 vs. CON, † = p < 0.05 vs. MC, ‡ = p < 0.05 vs MC + AV.

90

PCR

‡ ‡

2,5

2,0

PCR

Wnt 5a

3,5

3,0

G

*

PCR

Figure 4. Mast cell count in the lungs of the different rat groups. * = p < 0.05 vs. CON, ‡ = p < 0.05 vs. MC + AV.

30

25

CON MC MC + AV ILO

*

Chapter 5

15

10

‡

* * 5 *

*

‡ ‡

0 Intra-acinar vessel

Pre-acinar vessel

Parenchyma

Peri-bronchial

After analysis of the data, it revealed 1 gene that changed under all circumstances, including therapy. This sequence was similar to DEAD (Asp-Glu-Ala-Asp) box polypeptide 41, one of the helicases which play a role in RNA metabolism. Cluster VII represents the genes that are changed by monocrotaline, but counter regulated by the addition of increased blood flow. They are changed both in MC rats compared to CON rats and in the MC + AV group compared to the MC rats, without difference between the MC + AV group and CON rats. This cluster contained 15 genes. Carboxypeptidase Z, an enzyme which contains a Cys-rich domain that has homology to Wnt-binding proteins, and caspase 6 were upregulated in the monocrotaline model, and downregulated to control levels after addition of the shunt. Six of these 15 genes were also influenced by iloprost treatment. All 6 were increased after iloprost treatment compared to the MC + AV group. In general, a total of 209 genes were altered due to iloprost treatment. Forty-seven of these genes were also regulated by the model (cluster 1 to 7). Among the genes regulated by iloprost treatment were several that are involved in Wnt-signaling, namely Wnt-inhibitory factor 1, Wnt5a, catenin alfa 1, secreted frizzled related protein (sfrp2) and frizzled homolog 5. PCR confirmation The expression of eight genes that caught our interest because of their possible importance in the pathogenesis of PAH was verified using real-time PCR. 91


Number of mast cells per field

* 20

In all eight genes tested (100%; figure 3), changes were in a similar direction as predicted from the microarray data. In 3 of the 8 genes, PCR confirmation led to the finding of additional significant comparisons, while in two cases, PCR data did not result in significant differences but showed a trend in a similar direction. In the three remaining genes, the significance of the changes was identical. Mast cell count We wanted to confirm the gene array and PCR findings of increased expression of the mast cell markers chymase 1 and tryptase beta 1. Therefore, the actual presence of mast cells was verified by counting their numbers in pulmonary sections. The number of mast cells increased around the vessels and in the parenchyma in the monocrotaline-treated rats (figure 4). In rats from the MC + AV group, similar changes were found. Iloprost treatment decreased the number of mast cells both in the perivascular area and in the parenchyma.

Discussion In this model for PAH in rats, we identified several pathways important in the development of monocrotaline-induced pulmonary hypertension, as well as in the additional effect of increased pulmonary blood flow. Further, we addressed those genes that were affected by iloprost therapy, a previously proven effective therapy in humans. Monocrotaline-induced pulmonary hypertension was associated with alterations in Wnt-signaling and with mast cell proliferation. Increased pulmonary blood flow specifically leads to increased expression of ATF3 and Egr-1. Furthermore, treatment with iloprost affected both genes from the Wnt-signaling pathway as mast cell proliferation. In order to obtain statistically important results, the array was performed in a crossover design, which provides outcomes according to the MIAME agreements 16. To be absolutely sure of the validity of our data, we verified some key genes by real-time PCR. Indeed, all genes were regulated in similar ways when PCR and gene array data were compared. Our array analysis yielded several genes that were already known to be involved in the pathophysiology from patient studies. Examples are the upregulation of endothelin-1 after induction of increased pulmonary blood flow 21. Changes in potassium channel expression, serotonin signaling and in pro-inflammatory and pro-apoptotic activation have also been described in patients 22. In a gene array in patients with pulmonary hypertension, similar, although not identical patterns of altered gene expression were discovered. For example, alterations in a DEAD box polypeptide and in several types of potassium channels 23 were described before. However, this gene array also yielded several pathways that have not been previously connected with the development of PAH.

92

93


Wnt-signaling The Wnt pathway deserves further attention as components of this pathway are induced in flow-associated PAH and reduced by iloprost therapy (figure 3 F-H). The Wnt family controls a variety of processes including proliferation and migration 32 and is important in pulmonary development, but also in pulmonary inflammation and oncology. Signaling is complex and occurs via at least three signaling pathways. Signaling is further modulated by several regulatory molecules, of which Wnt5a is an example. Target genes of the Wnt pathways include matrix metalloproteinases, cyclo-oxygenase-2 and the VEGF-receptor. All of these substances have their own contribution to the pathogenesis of PAH. For example, the WNT5a-null mice display increased expression of BMP4 33, a gene of which the receptor has been shown to be involved in patients with PAH 34. In this study, we found several components of the Wnt system to be regulated. Frizz led related protein B (FrzB), an inhibitor of Wnt-signaling, and carboxypeptidase Z were increased in the MC + AV group and in the MC-group respectively. Carboxypeptidase Z was downregulated to control levels after addition of the shunt. This enzyme also recently has been discovered to play a stimulating role in Wnt signaling 35. Additionally, Wnt-inhibitory factor 1, Wnt5a, catenin alfa 1, secreted frizzled related protein 2 (sfrp2) and frizzled homolog 5 were all upregulated after treatment with iloprost. Sofar, an effect of iloprost therapy on Wnt-signaling has not been described in literature. The net effect of iloprost intervention on the Wnt

Chapter 5

ATF3 and Egr-1 One of the new factors emerging from our array is activating transcription factor 3 (ATF3). ATF3 is part of the ATF/CREB family of transcription factors. It is a gene that is induced in stress conditions, for example in myocardial ischemia 19, which in its homodimeric form acts as a transcription repressor, while it can act as a transcription activator in a heterodimeric configuration with c-Jun. Although it is not exactly clear what the inducers, target genes and responses of ATF3 are, its activation does seem to contribute to organ dysfunction, as was illustrated by liver and cardiac malfunctioning after induction 24;25. In our model, ATF3 is highly induced by increased pulmonary blood flow (figure 3C), suggesting a specific role in flowassociated PAH. Another gene specifically induced by increased blood flow is early growth response protein 1 (Egr-1). Egr-1 is a master regulator that controls the expression of a variety of genes. It plays a role in several cardiovascular processes such as atherosclerosis, intimal thickening and angiogenesis 26. Its activation is regulated by many different stimuli, amongst which mechanical injury 27, angiotensin II 28 and shear stress 29. Under hypoxic conditions, it has been described that Egr-1 expression is increased in pulmonary adventitial fibroblasts 30. Interestingly, Egr-1 apparently is involved in the Il-13 and tumor necrosis factor production by mast cells 31. It is conceivable that both ATF3 as well as Egr-1 contribute considerably to the pathogenesis of PAH. Therefore, research on animals with gain of function mutations, as described for ATF3 in the heart 24 might add to our expanding knowledge on the disease.

pathway remains difficult to predict, because although Wnt5a is an activator of one of the signaling pathways of Wnt and frizzled 5 is its receptor, the frizzled related proteins and the Wnt-inhibitory factor antagonize Wnt-signaling 36. Since activation of Wnt-signaling leads to pulmonary inflammation and the induction of tumor formation, it could be hypothesized that in a similar way activation of Wnt-signaling contributes to pulmonary vascular remodeling in PAH and that iloprost interferes in this process 32. Mast cell involvement Genes that were selectively regulated by monocrotaline were mainly associated with inflammation (heme oxygenase 1), and more specifically, with the presence of mast cells (IgE-Fc receptor, tryptase beta 1, chymase 1). This confirms that inflammation is important in the vascular remodeling that occurs as a consequence of monocrotaline administration. To address the question whether mast cells contribute to the pathofysiological process, a toluidine blue staining was performed and the amount of mast cells was counted. An increased number of mast cells was present in the lungs of the monocrotalinetreated rats. It had been previously shown by Vaszar et al that mast cells and their related protein expression levels started to rise significantly 21 days after moncrotaline injection, and not earlier 37. Hence, the increased mast cell count in our model probably reflects the pulmonary vascular remodeling, rather than inflammation due to monocrotaline itself. Increased mast cell counts are also present in patients with PAH due to a CHD 38. The addition of a shunt to the monocrotaline rat model did not affect the amount of mast cells and mast cell markers in the lungs. However, a trial in patients showed that also patients with a sole increase in pulmonary blood flow due to an atrial septal defect 38 display increased numbers of mast cells. We probably do not see an additional effect of the shunt because of the strong pro-inflammatory effects of monocrotaline. A longer trial without monocrotaline might show that there also is a flow inducible effect on the presence of mast cells in rats. The involvement of mast cells in the development of PAH has received little attention. They are known as potent angiogenic stimulators 39;40 and play a role in angiotensin II mediated vasoconstriction 41. Literature states that activated mast cells can contribute to vessel remodeling using specific serine proteases from their granules 42;43. Furthermore, chymase has been connected to the conversion of angiotensin I to the vasoconstrictor angiotensin II 41 and blockade of angiotensin II prevents the development of arteriolar hypertrophy. Together, this suggests that the excessive mast cells present in arteries of PAH patients and models are enhancing the development of the disease. Treatment with iloprost led to a decrease in the number of mast cells, although it did not appear to alter the presence of mast cell markers on PCR. This may be due to the fact that iloprost is known to inhibit mast cell degranulation, through calcium influx and elevation of cAMP levels 44. Possibly, the introduction of iloprost inhibits mast

94

cells to secrete histamine, secondary also inhibiting chymase and tryptase secretion. Chymase and tryptase may be accumulating in the mast cell under influence of hemodynamic stress, but the inability to release them possibly prevents the proliferation of additional mast cells.

95


In conclusion, in this rat model of flow-associated PAH, we used a cross-over designed microarray to identify novel pathways in the pathogenesis of PAH and in the therapeutic effects of iloprost. We showed that both monocrotaline and increased pulmonary blood flow each contribute to specific changes in pulmonary gene expression. Treatment with iloprost partly reverses these changes. New pathobiological pathways that emerged from this analysis were ATF3 and Egr-1, both induced by increased pulmonary blood flow, and Wnt-signaling and mast cell proliferation, both affected by iloprost therapy. All these pathways can be targets for new therapeutic options.

Chapter 5

Effects of therapy Evaluating the effect of iloprost in this model, it appeared that genes that were mostly affected by iloprost treatment were those genes that changed specifically after the addition of increased pulmonary blood flow. Less often, ilopost was able to antagonize the effects of monocrotaline. Interestingly, iloprost seems therefore particularly effective in antagonizing the effects of increased flow.

References 1.


2.


3.

Barst RJ, Rubin LJ, McGoon MD, Caldwell EJ, Long WA, Levy PS. Survival in primary pulmonary hypertension with long-term continuous intravenous prostacyclin. Ann Intern Med. 1994;121:409415.

4.

Barst RJ, Rubin LJ, Long WA, McGoon MD, Rich S, Badesch DB, Groves BM, Tapson VF, Bourge RC, Brundage BH. A comparison of continuous intravenous epoprostenol (prostacyclin) with conventional therapy for primary pulmonary hypertension. The Primary Pulmonary Hypertension Study Group. N Engl J Med. 1996;334:296-302.

5.

Rubin LJ, Mendoza J, Hood M, McGoon M, Barst R, Williams WB, Diehl JH, Crow J, Long W. Treatment of primary pulmonary hypertension with continuous intravenous prostacyclin (epoprostenol). Results of a randomized trial. Ann Intern Med. 1990;112:485-491.

6.

Higenbottam T, Wheeldon D, Wells F, Wallwork J. Long-term treatment of primary pulmonary hypertension with continuous intravenous epoprostenol (prostacyclin). Lancet. 1984;1:1046-1047.

7.

Meyrick B, Gamble W, Reid L. Development of Crotalaria pulmonary hypertension: hemodynamic and structural study. Am J Physiol. 1980;239:H692-H702.

8.

Rondelet B, Kerbaul F, Motte S, van Beneden R, Remmelink M, Brimioulle S, McEntee K, Wauthy P, Salmon I, Ketelslegers JM, Naeije R. Bosentan for the prevention of overcirculation-induced experimental pulmonary arterial hypertension. Circulation. 2003;107:1329-1335.

9.

Dai ZK, Tan MS, Chai CY, Chen IJ, Jeng AY, Wu JR. Effects of increased pulmonary flow on the expression of endothelial nitric oxide synthase and endothelin-1 in the rat. Clin Sci (Lond). 2002;103 Suppl 48:289S-293S.

10. Lam CF, Peterson TE, Croatt AJ, Nath KA, Katusic ZS. Functional adaptation and remodeling of pulmonary artery in flow-induced pulmonary hypertension. Am J Physiol Heart Circ Physiol. 2005;289: H2334-H2341. 11. Tanaka Y, Schuster DP, Davis EC, Patterson GA, Botney MD. The role of vascular injury and hemodynamics in rat pulmonary artery remodeling. J Clin Invest. 1996;98:434-442. 12. Nishimura T, Faul JL, Berry GJ, Kao PN, Pearl RG. Effect of a surgical aortocaval fistula on monocrotaline-induced pulmonary hypertension. Crit Care Med. 2003;31:1213-1218. 13. Okada K, Tanaka Y, Bernstein M, Zhang W, Patterson GA, Botney MD. Pulmonary hemodynamics

96

modify the rat pulmonary artery response to injury. A neointimal model of pulmonary hypertension. Am J Pathol. 1997;151:1019-1025. 14. Van Albada ME, Schoemaker RG, Kemna M, Cromme-Dijkhuis AH, van Veghel R, Berger RMF. The role of increased pulmonary blood flow in pulmonary arterial hypertension. Eur Respir J. 2005;26:487-493. 15. Rabinovitch M, Gamble W, Nadas AS, Miettinen OS, Reid L. Rat pulmonary circulation after chronic hypoxia: hemodynamic and structural features. Am J Physiol. 1979;236:H818-H827.

18. Sandovici M, Henning RH, Hut RA, Strijkstra AM, Epema AH, van Goor H, Deelman LE. Differential regulation of glomerular and interstitial endothelial nitric oxide synthase expression in the kidney of hibernating ground squirrel. Nitric Oxide. 2004;11:194-200. 19. Hai T, Wolfgang CD, Marsee DK, Allen AE, Sivaprasad U. ATF3 and stress responses. Gene Expr. 1999;7:321-335. 20. Khachigian LM. Early growth response-1 in cardiovascular pathobiology. Circ Res. 2006;98:186191. 21. Vincent JA, Ross RD, Kassab J, Hsu JM, Pinsky WW. Relation of elevated plasma endothelin in congenital heart disease to increased pulmonary blood flow. Am J Cardiol. 1993;71:1204-1207. 22. McLaughlin VV, McGoon MD. Pulmonary arterial hypertension. Circulation. 2006;114:1417-1431. 23. Geraci MW, Moore M, Gesell T, Yeager ME, Alger L, Golpon H, Gao B, Loyd JE, Tuder RM, Voelkel NF. Gene expression patterns in the lungs of patients with primary pulmonary hypertension: a gene microarray analysis. Circ Res. 2001;88:555-562. 24. Okamoto Y, Chaves A, Chen J, Kelley R, Jones K, Weed HG, Gardner KL, Gangi L, Yamaguchi M, Klomkleaw W, Nakayama T, Hamlin RL, Carnes C, Altschuld R, Bauer J, Hai T. Transgenic mice with cardiac-specific expression of activating transcription factor 3, a stress-inducible gene, have conduction abnormalities and contractile dysfunction. Am J Pathol. 2001;159:639-650. 25. Allen-Jennings AE, Hartman MG, Kociba GJ, Hai T. The roles of ATF3 in glucose homeostasis. A transgenic mouse model with liver dysfunction and defects in endocrine pancreas. J Biol Chem. 2001;276:29507-29514. 26. Khachigian LM. Early growth response-1 in cardiovascular pathobiology. Circ Res. 2006;98:186191.

97


17. Buermans HP, Redout EM, Schiel AE, Musters RJ, Zuidwijk M, Eijk PP, van Hardeveld C, Kasanmoentalib S, Visser FC, Ylstra B, Simonides WS. Microarray analysis reveals pivotal divergent mRNA expression profiles early in the development of either compensated ventricular hypertrophy or heart failure. Physiol Genomics. 2005;21:314-323.

Chapter 5

16. Brazma A, Hingamp P, Quackenbush J, Sherlock G, Spellman P, Stoeckert C, Aach J, Ansorge W, Ball CA, Causton HC, Gaasterland T, Glenisson P, Holstege FC, Kim IF, Markowitz V, Matese JC, Parkinson H, Robinson A, Sarkans U, Schulze-Kremer S, Stewart J, Taylor R, Vilo J, Vingron M. Minimum information about a microarray experiment (MIAME)-toward standards for microarray data. Nat Genet. 2001;29:365-371.

27. Khachigian LM, Lindner V, Williams AJ, Collins T. Egr-1-induced endothelial gene expression: a common theme in vascular injury. Science. 1996;271:1427-1431. 28. Day FL, Rafty LA, Chesterman CN, Khachigian LM. Angiotensin II (ATII)-inducible platelet-derived growth factor A-chain gene expression is p42/44 extracellular signal-regulated kinase-1/2 and Egr-1-dependent and mediated via the ATII type 1 but not type 2 receptor. Induction by ATII antagonized by nitric oxide. J Biol Chem. 1999;274:23726-23733. 29. Khachigian LM, Anderson KR, Halnon NJ, Gimbrone MA, Jr., Resnick N, Collins T. Egr-1 is activated in endothelial cells exposed to fluid shear stress and interacts with a novel shear-stress-response element in the PDGF A-chain promoter. Arterioscler Thromb Vasc Biol. 1997;17:2280-2286. 30. Banks MF, Gerasimovskaya EV, Tucker DA, Frid MG, Carpenter TC, Stenmark KR. Egr-1 antisense oligonucleotides inhibit hypoxia-induced proliferation of pulmonary artery adventitial fibroblasts. J Appl Physiol. 2005;98:732-738. 31. Li B, Power MR, Lin TJ. De novo synthesis of early growth response factor-1 is required for the full responsiveness of mast cells to produce TNF and IL-13 by IgE and antigen stimulation. Blood. 2006;107:2814-2820. 32. Pongracz JE, Stockley RA. Wnt signalling in lung development and diseases. Respir Res. 2006;7:15. 33. Weaver M, Dunn NR, Hogan BL. Bmp4 and Fgf10 play opposing roles during lung bud morphogenesis. Development. 2000;127:2695-2704. 34. Roberts KE, McElroy JJ, Wong WP, Yen E, Widlitz A, Barst RJ, Knowles JA, Morse JH. BMPR2 mutations in pulmonary arterial hypertension with congenital heart disease. Eur Respir J. 2004;24:371374. 35. Moeller C, Swindell EC, Kispert A, Eichele G. Carboxypeptidase Z (CPZ) modulates Wnt signaling and regulates the development of skeletal elements in the chicken. Development. 2003;130:51035111. 36. Kawano Y, Kypta R. Secreted antagonists of the Wnt signalling pathway. J Cell Sci. 2003;116:26272634. 37. Vaszar LT, Nishimura T, Storey JD, Zhao G, Qiu D, Faul JL, Pearl RG, Kao PN. Longitudinal transcriptional analysis of developing neointimal vascular occlusion and pulmonary hypertension in rats. Physiol Genomics. 2004;17:150-156. 38. Hamada H, Terai M, Kimura H, Hirano K, Oana S, Niimi H. Increased expression of mast cell chymase in the lungs of patients with congenital heart disease associated with early pulmonary vascular disease. Am J Respir Crit Care Med. 1999;160:1303-1308. 39. Coussens LM, Raymond WW, Bergers G, Laig-Webster M, Behrendtsen O, Werb Z, Caughey GH, Hanahan D. Inflammatory mast cells up-regulate angiogenesis during squamous epithelial carcinogenesis. Genes Dev. 1999;13:1382-1397. 40. Muramatsu M, Katada J, Hayashi I, Majima M. Chymase as a proangiogenic factor. A possible involvement of chymase-angiotensin-dependent pathway in the hamster sponge angiogenesis model. J Biol Chem. 2000;275:5545-5552.

98

41. Kishi K, Jin D, Takai S, Muramatsu M, Katayama H, Tamai H, Miyazaki M. Role of chymase-dependent angiotensin II formation in monocrotaline-induced pulmonary hypertensive rats. Pediatr Res. 2006;60:77-82. 42. Leskinen MJ, Heikkila HM, Speer MY, Hakala JK, Laine M, Kovanen PT, Lindstedt KA. Mast cell chymase induces smooth muscle cell apoptosis by disrupting NF-kappaB-mediated survival signaling. Exp Cell Res. 2006;312:1289-1298. 43. Johnson JL, Jackson CL, Angelini GD, George SJ. Activation of matrix-degrading metalloproteinases by mast cell proteases in atherosclerotic plaques. Arterioscler Thromb Vasc Biol. 1998;18:1707-1715. Chapter 5

44. Kay LJ, Yeo WW, Peachell PT. Prostaglandin E2 activates EP2 receptors to inhibit human lung mast cell degranulation. Br J Pharmacol. 2006;147:707-713.


99

Chapter 6 Prostacyclin therapy increases right ventricular capillarisation in a model for flow-associated pulmonary hypertension

Mirjam E. van Albada, Rolf M.F. Berger, Marnix Niggebrugge, Richard van Veghel, Adri H. Cromme-Dijkhuis, Regien G. Schoemaker

European Journal of Pharmacology 2006 Nov 7;549(1-3):107-16.

Abstract Introduction: Pulmonary arterial hypertension, and consequently right ventricular failure, complicates several congenital heart defects. Although intervention in the prostacyclin-thromboxane ratio is known to improve outcome, the underlying mechanism is not clear. Therefore, effects of acetyl salicylic acid and iloprost are studied in an animal model for flow-associated pulmonary hypertension. Methods: Male Wistar rats with flow-associated pulmonary arterial hypertension: an aortocaval shunt in addition to monocrotaline-induced pulmonary hypertension, were treated with low-dose aspirin (25 mg/kg/day) or iloprost (72 µg/kg/day). Effects on pulmonary hemodynamics and pulmonary vascular remodeling as well as right ventricular hemodynamics and remodeling were evaluated. Results: Ninety percent (n = 7/8) of the untreated pulmonary hypertensive rats developed dyspnea and pleural fluid, whereas this was seen in 50% (n = 4/8, ns) and 10% (n = 1/8, p < 0.05 vs. untreated animals) of the aspirin and iloprost treated rats, respectively. This could not be attributed to changes in pulmonary arterial pressure, wall-lumen ratio of the pulmonary vasculature or right ventricular hypertrophy. However, both therapies restored reduced right ventricular capillary to myocyte ratio in pulmonary hypertensive rats (0.95 ± 0.10 in untreated rats vs. 1.38 ± 0.18 in control animals; p < 0.05, and 1.32 ± 0.11 in aspirin-treated and 1.29 ± 0.9 in iloprost-treated rats; both p < 0.05 vs. non-treated animals), which was associated with improved right ventricular contractility (iloprost). Conclusion: Thus, interventions in the prostacyclin-thromboxane metabolism improve outcome in rats with flow-associated pulmonary arterial hypertension. However, these effects may be attributed to effects on cardiac rather than on pulmonary vascular remodeling.

102

Introduction

Animals and design of the study Thirty-two male Wistar rats, weighing 250-350 gram, were housed under 12h/12h light/dark conditions and fed ad libitum. Animal care and experiments were conducted according to the Dutch Animal Experimental Act and the investigation therefore conforms with the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health. The Erasmus University and the University of Groningen Animal Care and Use Committees approved the experimental protocols. Rats were randomly assigned to four experimental groups: 1) control (n = 8), 2) untreated pulmonary hypertension (n = 8), in which a model for flow-associated PAH was created as previously used in our laboratory, with a combination of monocrotaline injections (60 mg/kg, Sigma Chemical Co, St. Louis, MO, USA) followed by the creation of an abdominal aortocaval shunt one week later 11, 3) pulmonary hypertension treated with acetyl salicylic acid (n = 8) and 4) pulmonary hypertension treated with the prostacyclin analogue iloprost (n = 8). Three weeks after the start of treatment, rats were placed in a metabolic cage for 24h 103

Prostacyclin therapy increases right ventricular capillarisation in a model for flow-associated pulmonary hypertension

Methods

Chapter 6

Pulmonary arterial hypertension (PAH) is a progressive and often fatal disease. It is characterized by a disturbed vasodilator-vasoconstrictor balance, associated with medial hypertrophy, muscularization of normally non-muscularized arteries and endothelial and smooth muscle cell proliferation 1-4. Consequently, pulmonary vascular resistance increases, leading to right ventricular hypertrophy and eventually right ventricular failure. Patients with PAH have an increased ratio of urinary thromboxane to prostacyclin metabolites 5. Both thromboxane and prostacyclin are metabolites from the cyclooxygenase pathway of arachidonic acid degradation. Prostacyclin has vasodilator and antiproliferative actions and is a potent inhibitor of platelet aggregation, whereas thromboxane has vasoconstrictive, smooth muscle mitogenic and pro-coagulant activities 6. No curative therapy for PAH is available. However, therapy with prostacyclins has beneficial effects on exercise tolerance and survival in patients 7-10, indicating that an altered balance of cyclo-oxygenase metabolites in favour of the vasodilatating prostacyclin at the expense of the vasoconstrictor thromboxane is associated with improved clinical outcome. The underlying mechanism is largely unknown. We recently developed a rat model for flow-associated pulmonary hypertension, showing advanced pulmonary vascular disease 11. The effects of inhibition of thromboxane production by low-dose aspirin and the administration of a prostacyclin analogue were investigated in a rat model for flow-associated PAH, with regard to hemodynamics as well as cardiac and pulmonary vascular remodeling.

to collect urine for measurements of thromboxane B2 and 6-keto-prostaglandin F1α levels. Animals were weighed three times a week, daily watched for dyspnea, defined as the use of accessory respiratory muscles and/or gasping, and sacrificed when a 15% weight loss or debilitating dyspnea occurred. Matched rats in the other groups were sacrificed simultaneously. Treatment protocols Osmotic minipumps (model 2004, Alzet, Palo Alto, CA, USA) with iloprost (72 µg/kg/day; a generous gift of Schering, the Netherlands) were implanted subcutaneously in the same operative session as the creation of the abdominal aortocaval shunt. Aspirin (acetyl salicylic acid) was given via intraperitoneal injections in a dosage of 25 mg/kg/day once daily. We previously validated this aspirin dosage to inhibit thromboxane production by approximately 60% without affecting prostacyclin production 12. Control animals underwent sham surgery and sham implantation of a minipump. Echocardiography In 4 rats of each group, echocardiographic studies were performed under pentobarbital anesthesia 4 weeks after the administration of monocrotaline using a 12 MHz phased array transducer (Sonos 5500, Hewlett-Packard Inc, Andover, MA, USA). Ventricular dimensions and the presence of tricuspid insufficiency were assessed in standard views 11;13. Hemodynamic measurements At the time of sacrifice, animals were anesthetized with pentobarbital (60 mg/kg intraperitoneally) and ventilated with room air. Pulmonary arterial pressures were measured with a technique described by Rabinovitch 14 routinely used in our laboratory 11. If pulmonary arterial pressures could not be obtained, right ventricular systolic pressure was recorded as being equal to systolic pulmonary pressure (n = 2 control animals). By introducing a catheter via the left carotid artery into the aorta, systemic arterial pressures as well as heart rate were measured. Pulmonary vascular remodeling After completion of hemodynamic measurements, the thorax was opened and the presence of pleural fluid was noted. The lungs were weighed and fixed in 3.6% formalin. Pulmonary sections (5 µm thickness) were stained with resorcin-fuchsin elastin stain for morphometric analysis of vascular dimensions according to a previously described protocol 11. In lung sections all transversally cut arteries with a diameter equal to or more than 50 micrometer (pre-acinar arteries) and 40 randomly chosen vessels (10 in each left lung quadrant) with a diameter less than 50 micrometer (intra-acinar vessels) were assessed at 200 and 400 times magnification using an image analysis system (CZ KS400, Imaging Associates, Bicester, UK) 11.

104

Right ventricular function and gene expression In an additional experiment, including control (n = 12), untreated (n = 14) and iloprost-treated (n = 13) groups, effects of iloprost administration on right ventricular hemodynamics and gene expression of angiogenetic factors were investigated in more detail. Iloprost-treated, but not aspirin-treated rats were used for this experiment, since beneficial effects of these treatments appeared qualitatively similar, but most pronounced in the iloprost group. In contrast to the previous experiment, rats were sacrificed at exactly four weeks after monocrotaline administration. Pulmonary arterial pressure measurements were performed as described, while a Microtip pressure transducer (Millar Instr. Inc., Houston, TX, USA) was inserted into the right ventricular cavity to determine right ventricular systolic pressure and right ventricular end-diastolic pressure. As index of contractility, the maximal rate of increase in right ventricular pressure (dP/dtmax) was taken and corrected for right ventricular systolic pressure (dP/dtmax ind). In order to look at angiogenic activity in the myocardium, real-time PCR was performed on right ventricular material for the expression of known angiogenic factors as vascular endothelial growth factor (VEGF), its two receptor subtypes VEGF-receptor type 1 (VEGF-R1 or flt-1) and VEGF-receptor type 2 (VEGF-R2 or flk-1), basic fibroblast growth factor (bFGF), angiopoietin-1 and angiopoietin-2. RNA was 105


Arachidonic acid metabolites After three weeks of treatment, 24h urinary samples were collected. At sacrifice, 2 ml of blood was collected in an EDTA-tube. Urine and plasma were used to measure the stable metabolites of thromboxane and prostacyclin, thromboxane B2 and 6keto-prostaglandin F1α respectively, using radioimmunoassay (antibodies: Advanced Magnetics, USA; standards: Sigma) as described in detail by Zijlstra et al 16.

Chapter 6

Cardiac remodeling The heart was divided into atria, ventricles and septum. Sections were weighed separately and fixed in 3.6% formalin. Deparaffinized 5 µm thick transverse cardiac sections at midventricular level were stained with Gomori silver staining for analysis of myocyte size and with lectin GSL staining (Sigma) to stain endothelial cells for analysis of capillary density. In the right ventricle, myocyte size and capillary density were measured as described in detail before 15. Myocyte cross-sectional area was measured in transversally cut myocytes showing a nucleus. Myocyte density was calculated as total myocyte area divided by average myocyte area per myocyte, corrected for total tissue area in a field, and therefore expressed as the number of myocytes per mm². In consecutive slices in the same tissue area, capillary density was obtained by counting the number of capillaries per total tissue area (capillaries/mm²). The capillary to myocyte ratio was calculated by dividing capillary density by myocyte density. Sirius Red staining was used to determine collagen content, as described previously 15. Percentage of collagen was corrected for hypertrophy of the right ventricle by multiplying collagen percentage by right ventricular weight, to obtain collagen content.

Table 1. Primer sequences. Primer sequences used for experiments on gene expression levels of angiogenetic factors in the right ventricular myocardium. Gene

Primer sequence

VEGF

F 5’-GTACCTCCACCATGCCAAGT-3’ R 5’-AATAGCTGCGCTGGTAGACG-3’

VEGF R1 (flt-1)

F 5’-GACCTGCGAAGCCACAGTTA-3’ R 5’-GTCAATCCGCTGCCTGATAG-3’

VEGF R2 (flk-1)

F 5’-GCCTTATGATGCCAGCAAGT- 3’ R 5’-GCCAATGTGGATGAGGATCT- 3’

bFGF (1)

F 5’-AAGGATCCCAAGCGGCTCTA-3’ R 5’-TGCCCAGTTCGTTTCAGTGC-3’

Angiop. 1

F 5’-CCTTCAAGGCTTGGTTACTC-3’ R 5’-ATCTAGGCTTCCATCCTCAC-3’

Angiop. 2 (2)

F 5’-GCTGGGCAACGAGTTTGTCT-3’ R 5’-CAGTCCTTCAGCTGGATCTTCA-3’

(1) Primer designed by Jensen et al, Angiogenesis. 2004;7(3):255-67. (2) Primer designed by Sarlos et al, Am J Pathol. 2003 Sep;163(3):879-87.

extracted from right ventricular tissue using the Qiagen RNeasy Mini Kit (Qiagen, Frankfurt, Germany). Real-time PCR experiments were performed on a Gene Amp 5700 Sequence detector (Applied Biosystems, Nieuwerkerk a/d IJssel, the Netherlands) as described previously 17(for primer sequences see table 1). RTQ-PCR results were obtained from a dilution standard curve. Statistical analysis Data are represented as mean ± standard error of the mean(SEM). Morbidity data (the presence of pleural fluid) were analyzed using a Fisher’s exact test with Bonferroni correction. Mortality data were analyzed with a logrank test with Bonferroni correction to compare between the untreated and the treated animals. Other differences between healthy control animals and untreated pulmonary hypertensive animals were analyzed using student’s t-test or a Mann-Whitney test when data were not normally distributed. Thereafter, the effect of therapeutic intervention was analyzed using a one-way ANOVA on the three groups with pulmonary hypertension with 2-sided Dunnett’s post-hoc testing using the untreated group as reference, or a Kruskall-Wallis test when data were not normally distributed. Alfa was chosen as 0.05. 106

60

*

dPAP mPAP sPAP

50

*

40 30

†

20 Chapter 6

Pulmonary arterial pressures (mmHg)

70

10 0

Results

PAH

PAH + ASA

PAH + ILO

Figure 1. Pulmonary arterial pressures (mean ± SEM). dPAP = diastolic pulmonary arterial pressure, mPAP = mean pulmonary arterial pressure and sPAP = systolic pulmonary arterial pressure. CON = control animals (n = 6), PAH = untreated experimental group (n = 3), PAH + ASA = experimental animals treated with acetyl salicylic acid (n = 7) and PAH + ILO = experimental animals treated with the prostacyclin analogue iloprost (n = 7). * = p < 0.05 vs. control, †= p < 0.05 vs. PAH.

Morbidity and mortality All pulmonary hypertensive animals displayed weight loss (table 2), lethargy and severe dypsnea in the 5th and 6th week after monocrotaline administration, leading to preliminary death in 4 rats of the untreated group. Consequently, hemodynamic data could not be obtained in these animals. Seven out of eight untreated animals determined the moment of sacrifice of the other matched animals, where this was 1 aspirin-treated animal (log-rank test on survival curves p = 0.054 vs. untreated animals; table 2). None of the iloprost-treated animals determined the moment of sacrifice of the other animals (log-rank test on survival curves p < 0.05). At sacrifice, seven out of eight untreated animals displayed an excessive volume of intra-thoracic fluid (>10 ml), versus 4 out of 8 aspirin-treated and 1 out of 8 iloprost-treated animals (p = 0.01 vs. EXP, table 2).

Echocardiography Tricuspid insufficiency was mostly present in the untreated group, and less present in both treatment arms (table 2). Right ventricular wall thickness and internal right ventricular diameter during diastole increased in the untreated animals, although wall to lumen ratios were preserved. Because of low numbers of rats, statistical significance was not reached except for right ventricular wall thickness in the aspirintreated animals, but both interventions tended to reverse these effects (table 2).

107


CON

Table 2. Animal characteristics at time of sacrifice. Number of animals displaying a symptom versus the total number of animals in that group. Percentages are given between brackets. Body weight, heart rate and systolic systemic arterial pressure are shown as mean ± SEM. Bpm = beats per minute. * = p < 0.05 vs. control, † = p < 0.05 vs. untreated group. Control

Untreated

Aspirin-treated Iloprost-treated

Animals with thoraxfluid (>12 ml)

0/8 (0%)

7/8 (87.5%)

4/8 (50%)

1/8 (12.5%) †

Animals determining the time of sacrifice

0/8 (0%)

7/8 (87.5%)

1/8 (12.5%)

0/8 (0%) †

403 ± 8

338 ± 13 *

352 ± 13

350 ± 7

Tricuspid insufficiency at echocardiography

0/4

3/4

1/4

2/4

RV wall thickness (mm)

0.75 ± 0.03

1.25 ± 0.10 * 0.90 ± 0.08 †

0.95 ± 0.06

RV internal diastolic diameter (mm)

4.15 ± 0.33

5.73 ± 0.46 *

4.60 ± 0.68

RV wall-lumen ratio

0.019 ± 0.002

0.022 ± 0.002

379 ± 11

277 ± 44 *

284 ± 20

288 ± 17

117 ± 7

93 ± 16

86 ± 5

105 ± 9

General

Body weight at sacrifice (g) Echocardiography

4.80 ± 0.41

0.019 ± 0.002 0.022 ± 0.004

Systemic hemodynamics Heart rate (bpm) Systolic systemic arterial pressure (mmHg)

Hemodynamic measurements Systolic as well as diastolic pulmonary arterial pressure were significantly increased in the pulmonary hypertensive rats, whereas heart rate was significantly reduced. Systemic arterial pressure was slightly lower in pulmonary hypertensive rats. No major effects of therapy were observed (figure 1, table 2). Arachidonic acid metabolism Whereas urinary levels of prostaglandin F1α were not changed in the untreated animals, thromboxane B2 displayed a non-significant increase (40%) in this group compared to the control animals. The ratio between prostacyclin and thromboxane metabolites was decreased in untreated animals without any obvious effect of therapy (figure 2A). 108

Urinary excretion (pg/24 hour)

A

1,4e+5 1,2e+5

2,0

CON PAH PAH + ASA PAH + ILO

1,5

*

1,0

1,0e+5

0,5 0,0

8,0e+4

Ratio PGF1alpha/TxB2

6,0e+4 4,0e+4 2,0e+4 0,0 6-keto-PGF1alpha

B

2,0

CON PAH PAH + ASA PAH + ILO

1,5

*

1,0 0,5

8000

0,0 Ratio PGF1alpha/TxB2

6000 4000

† †

2000 0 6-keto-PGF1alpha

Thromboxane B2

In contrast, plasma prostaglandin F1α increased more than tenfold in untreated animals and was reduced by both therapeutic interventions. Plasma levels of thromboxane B2 increased in untreated animals, while therapy with aspirin or iloprost decreased plasma thromboxane B2 to near normal levels (figure 2B). Cardiac and pulmonary weights Untreated pulmonary hypertensive rats showed increased heart weights (heart to body weight ratio 4.41 ± 0.22 g/kg in untreated vs. 2.66 ± 0.07g/kg in control animals, p < 0.001), which could be attributed to the right part of the heart (figure 3). Therapy did not influence this (heart to body weight ratio 4.18 ± 0.13 g/kg in aspirin-treated animals, ns vs. untreated animals, and 4.08 ± 0.22 g/kg in iloprosttreated animals, ns vs. untreated animals). Right ventricular to left ventricular plus septal weight ratio increased in the untreated animals (0.617 ± 0.040 in untreated animals compared to 0.273 ± 0.004 in control animals, p < 0.001 vs. CON), while no effects of therapy could be demonstrated (0.584 ± 0.016 in aspirin-treated and 109


Plasmalevels (pg/ml)

Thromboxane B2

12000 10000

Chapter 6

Figure 2. Levels of 6-ketoprostaglandin F1α and thromboxane B2 A) Urinary levels of 6keto-prostaglandin F1α and thromboxane B2 in pg/24h and B) Plasma levels of 6keto-prostaglandin F1α and thromboxane B2 in pg/ml. The inserts are showing the ratio of 6-keto-prostagladin F1α to thromboxane B2. CON = control animals, PAH = untreated experimental group, PAH + ASA = experimental animals treated with acetyl salicylic acid and PAH + ILO = experimental animals treated with the prostacyclin analogue iloprost. * = p < 0.05 vs. control, † = p < 0.05 vs. PAH.

Table 3. Pulmonary vascular morphometry. Data are shown as mean ± SEM. * = p < 0.05 vs. control. Control

Untreated

Aspirin-treated Iloprost-treated

Pre-acinar pulmonary arteries (> 50 µm) Number Outer diameter (µm) Luminal diameter (µm) Wall thickness (µm) Wall-lumen ratio

21 ± 3 101.1 ± 4.3 82.7 ± 4.3 9.2 ± 0.4 0.13 ± 0.01

43 ± 4 * 139.8 ± 6.0 * 108.8 ± 5.1 * 15.5 ± 0.8 * 0.16 ± 0.01 *

45 ± 5 125.9 ± 10.0 99.0 ± 8.6 13.5 ± 1.6 0.15 ± 0.02

33 ± 2 125.7 ± 7.5 99.8 ± 7.2 12.9 ± 1.0 0.15 ± 0.02

Intra-acinar pulmonary arteries (< 50 µm) Outer diameter (µm) Luminal diameter (µm) Wall thickness (µm) Wall-lumen ratio Occlusion (%) Muscularization (% of vessels) - % of vessels that is totally muscularized - % of vessels that is partially muscularized - % of vessels that is non-muscularized

33.3 ± 0.5 32.0 ± 0.8 32.4 ± 0.6 25.7 ± 0.8 * 0.4 ± 0.1 3.1 ± 0.3 * 0.015 ± 0.007 0.180 ± 0.022 * 3.9 ± 1.2 32.6 ± 2.0 *

32.2 ± 0.7 32.1 ± 0.8 26.4 ± 0.7 26.8 ± 0.9 2.9 ± 0.3 2.7 ± 0.2 0.158 ± 0.022 0.150 ± 0.019 29.5 ± 2.7 27.2 ± 2.4

6.9 ± 2.4

28.1 ± 2.6 *

33.3 ± 2.8

30.0 ± 4.2

0.9 ± 0.7

5.0 ± 1.3 *

6.2 ± 1.5

7.5 ± 2.6

92.2 ± 3.0

66.9 ± 1.9 *

60.4 ± 3.3

62.5 ± 3.1

0.561 ± 0.043 in iloprost-treated rats, both ns vs. the untreated animals). Similarly, lung weight to body weight ratio increased significantly in the untreated animals, and was not significantly affected by therapy (7.4 ± 0.5 g/kg in untreated animals compared to 3.3 ± 0.2 in control animals, p < 0.001, and 5.8 ± 0.5 in aspirin-treated and 6.7 ± 0.5 in iloprost-treated animals, both ns vs. the untreated animals). Pulmonary vascular remodeling Pre-acinar pulmonary arteries (>50 micrometer): Larger pulmonary arteries increased in number and size in the untreated group. Luminal diameter, wall thickness and wall to lumen ratio increased in these animals, suggesting outward remodeling of the larger pulmonary arteries. No intimal proliferation could be demonstrated in the pre-acinar arteries of the untreated animals. Treatment did not change either of these parameters (table 3). 110

1,6 1,4

Cardiac weights (gram)

1,2

RV IVS LV RA LA

* *

1,0 0,8 0,6 Chapter 6

0,4

*

0,2

CON

PAH

PAH + ASA

PAH + ILO

Intra-acinar pulmonary vessels ( 50 micrometer (pre-acinar arteries) and 40 randomly chosen vessels (10 in each left lung quadrant) with a diameter < 50 micrometer (intra-acinar vessels) were assessed using an image analysis system (CZ KS400, Imaging Associates, Bicester, UK) by measuring three different vascular areas: outer vessel area, inner vessel area and luminal area. Outer vessel area was defined as the area within the lamina elastica externa. The area within the lamina elastica interna was denoted 128

as inner vessel area. Wall area was calculated by subtracting luminal area from outer vessel area. Medial area was defined as outer vessel area minus inner vessel area. Intimal area was calculated by subtracting luminal area from the inner vessel area and expressed as a percentage of inner vessel area. Vessels < 50 micrometer usually do not have a clearly discernible internal elastic lamina. Therefore, a vascular occlusion score was calculated in these vessels as opposed to the calculation of a medial wall thickness to lumen ratio in the larger pulmonary arteries. Occlusion was calculated in the intra-acinar pulmonary vessels according to the following formula: (outer vessel area – luminal area)/(outer vessel area). Pulmonary arteries were excluded from measurement if they had a longest/shortest diameter of more than 2, an incomplete circular shape or a collapse of more than one quarter of the vessel wall. Muscularization of the intra-acinar arteries was scored separately 14.

Abdominal aortocaval shunt surgery was performed successfully in all but one rat, in the treated group, that died from post-operative complications. Weight loss and dyspnea were observed in the PAH-animals (both treated and untreated) in the 5th and 6th week after monocrotaline administration. This led to the sacrifice of most rats within this period (median survival after monocrotaline injection: 35 days). Symptoms appeared earliest and most severe in the untreated rats, leading to preliminary death in 1 out of 9 of these rats. Consequently, hemodynamic data could not be obtained in this animal. Once was the moment of sacrifice determined by a rat from the treated group, versus eight times by rats from the untreated group (table 1, logrank-test on survival curves p = 0.02). Thoracic fluid was observed in 8 of the 9 untreated rats and in 5 of the 8 treated rats (table 1). 129

Treprostinil in Advanced Experimental Pulmonary Hypertension: beneficial outcome without reversed pulmonary vascular remodeling

Results

Chapter 7

Statistical analysis Power analysis prior to the study revealed that in order to be able to demonstrate a 25% reduction in mean pulmonary arterial pressure, right ventricular hypertrophy or pulmonary vascular occlusion score, with a power of 0.8 and an alpha of 0.05, a sample size of 7 to 8 rats per group was needed. Data were analyzed using SPSS version 12.0.2. Mortality data were analyzed with a logrank test. Morbidity data (the presence of pleural fluid) were analyzed using Fisher’s exact test. Other differences between healthy control animals and untreated animals and between the untreated and treated animals were analyzed using one-way ANOVA-testing with Fisher’s protected LSD post-hoc testing. Non-parametric testing was performed when data were not normally distributed. Alfa was chosen to be 0.05.

130

0/8 (0%)

8/9 (89%)

5/8 (63%)

Control

Untreated

Treated

Animals with excessive thoraxfluid (>12 ml)

1/8 (13%)†

8/9 (89%) *

0/8 (0%)

Animals that determined the moment of sacrifice

401 ± 24

373 ± 20

428 ± 14

Body weight at sacrifice

281 ± 14 *

273 ± 22 *

371 ± 11

Heart rate (bpm)

0.459 ± 0.039 *

0.497 ± 0.010 *

0.240 ± 0.013

RV (g)

0.083 ± 0.011 *

0.112 ± 0.014 *

0.030 ± 0.004

RA (g)

Cardiac pathology

0.591 ± 0.061 *

0.629 ± 0.036 *

0.284 ± 0.013

RV/LV+IVS

Table 1. Animal characteristics and heart weights. Body weight is shown as mean ± SEM. * = p < 0.05 vs. control animals, † = p < 0.05 vs. untreated. RV = right ventricular weight in grams, RA = right atrial weight in grams, RV/LV + IVS = right ventricular to left ventricular plus inter ventricular septal weight ratio.

160 140

control untreated treated

Pressures in mmHg mPAP/mSAP ratio in %

120 100 *

80

*

*

*

60 * 40

*†

20

Chapter 7

0 mPAP

mSAP

mPAP/mSAP

Hemodynamics Hemodynamic data are shown in figure 1. Mean pulmonary arterial pressure (mPAP) was significantly increased in the untreated animals compared to control animals, whereas mean systemic arterial pressure (mSAP), the ratio of mPAP to mSAP and heart rate (273 ± 22 bpm in untreated rats vs. 371 ± 11 bpm in control animals, p = 0.001) were significantly reduced in these animals compared to controls. In the animals treated with treprostinil, mPAP decreased compared to the non-treated animals (treatment effect – 8 mmHg, p = 0.04). No differences could be demonstrated for 131


Echocardiography Increased pulmonary blood flow due to the presence of the aortocaval shunt was confirmed echocardiographically by an increased stroke volume at 4 weeks in the PAH-animals compared to the nonshunted control rats (0.48 ± 0.04 ml in PAH-animals vs. 0.29 ± 0.02 ml in nonshunted control rats, p = 0.03). Right ventricular wall thickness, as indication for increased right ventricular load, increased non-significantly in the untreated animals compared to control animals (1.09 ± 0.08 mm vs. 0.79 ± 0.09 in control, p = 0.086). In this sample, therapy did not alter right ventricular wall thickness (1.06 ± 0.13 mm in treated animals, ns vs. untreated). The internal diastolic diameter of the right ventricle was increased in PAH-animals (6.43 ± 0.68 mm in untreated vs. 3.87 ± 0.04 in control, p = 0.04). In this small number of animals, treprostinil treatment did not alter right ventricular diameter significantly (5.31 ± 0.57 mm in treated, ns vs. untreated). Figure 1. Mean pulmonary arterial pressure, mean systemic arterial pressure and the ratio between these parameters in the three animal groups. * = p < 0.05 vs. control. † = p < 0.05 vs. untreated. mPAP = mean pulmonary arterial pressure, mSAP = mean systemic arterial pressure, mPAP/mSAP = ratio between mean pulmonary arterial pressure and mean systemic arterial pressure.

Pre-acinar pulmonary arteries 16 14

*

*

B

50

* *

40

12 10

30

Number

Medial wall thickness (micrometer)

A

8 6

20

4

10

2 0

0 control untreated treated

Intra-acinar pulmonary vessels D 35

Luminal occlusion (%)

30 25 20 15 10 5 0

*

*

Muscularization (% of vessels)

C

140 120

Totally muscularized Partially muscularized Non-muscularized

100 80

*

60

20

*

0 Control

E

132

*

40

Untreated

* Treated

the other hemodynamic parameters between treated and untreated animals (figure 1, heart rate 281 ± 14 bpm in treated animals, ns vs. untreated animals). Pathology Right ventricular and atrial weights are shown in table 1. Right ventricular hypertrophy, expressed as right ventricular to left ventricular plus septal weight ratio, did not differ between untreated and treated animals (table 1).


133

Chapter 7

Pulmonary vascular remodeling Pre-acinar pulmonary arteries (> 50 micrometer): Compared to control rats, the total number of pre-acinar pulmonary arteries was augmented in the PAH-animals (figure 2B). Both the inner- and outer diameter of the larger pulmonary arteries increased significantly (inner vessel diameter 121.4 ± 7.0 µm in untreated vs. 82.7 ± 4.3 µm in control animals and outer vessel diameter 148.1 ± 7.0 μm in untreated vs. 101.1 ± 4.3 µm in control animals, both p < 0.05). Furthermore, medial wall thickness was increased (figure 2A). Neointimal formation was not found in these pre-acinar arteries (data not shown). Treprostinil treatment did not change any of the described morphologic parameters of vascular remodeling (inner vessel diameter 113.2 ± 3.8 µm and outer vessel diameter 140.4 ± 4.6 µm, both ns vs. untreated animals, figure 2A and B). Intra-acinar pulmonary vessels (< 50 micrometer): In contrast to control rats, the intra-acinar vessels of PAH-rats showed increased muscularization and luminal occlusion (figure 2C, D and E). In these rats, the outer diameter of the intra-acinar vessels did not change (outer vessel diameter 32.2 ± 0.8 μm in untreated vs. 33.3 ± 0.5 µm in control animals). However, the luminal diameter decreased significantly (luminal diameter 26.3 ± 0.7 µm in untreated vs. 32.4 ± 0.6 µm in control animals; p < 0.05 vs. control). Thus, wall thickness was increased in the animal model (2.98 ± 0.20 μm in untreated vs. 0.42 ± 0.13 μm in controls, p < 0.001). Additionally, the percentage of intra-acinar pulmonary vessels that was completely muscularized was increased (20.6 ± 2.4% in untreated vs. 6.9 ± 2.4 in controls, p = 0.002, figure 2D). No alterations in this morFigure 2. Pulmonary vascular remodelphologic pattern of vascular ing in the different animal groups. remodeling could be demonA) Medial wall thickness of the pre-acinar pulmonary arteries. B) Number of pre-acinar arteries. C) Luminal strated after treatment with occlusion score of the intra-acinar pulmonary vestreprostinil (outer vessel diamsels. D) Muscularization of the intra-acinar pulmonary eter 30.9 ± 0.9 µm, luminal vessels. E) Examples of intra-acinar pulmonary vessel diameter 26.2 ± 0.9 µm, wall remodeling. To the left an unobstructed intra-acinar thickness 2.35 ± 0.39 μm and vessel in healthy control animal, hematoxylin-eosin stain. In the middle the vessel of an untreated animal percentage of vessels that was with intra-acinar vessel obstruction, and to the right totally muscularized 18.2 ± a treated animal showing an unchanged pattern of 3.5%, all ns vs. untreated anipulmonary vascular remodeling. * = p < 0.05 vs. control. mals, figure 2C, D and E).

Discussion Our findings demonstrate that continuous subcutaneous treatment with the prostacyclin analogue treprostinil has a beneficial effect on morbidity, mortality and hemodynamics in a rat model of PAH associated with advanced pulmonary vascular lesions. Mean pulmonary arterial pressure decreased after treprostinil treatment by 8 mmHg. In this model of advanced pulmonary vascular disease, no beneficial effects of treprostinil therapy on the structural remodeling of the diseased pulmonary arteries could be demonstrated. To our knowledge this is the first study that investigates the effects of continuous, subcutaneous administration of treprostinil on structural pulmonary vascular remodeling in an in vivo situation. In our study we started treatment one week after the administration of monocrotaline, when severe pulmonary vascular lesions are already present 20. Thus, this study was designed as a regression study in a model with advanced pulmonary vascular disease, including occlusion of small pulmonary vessels by neointima formation, because this mimics the stage of disease progression in which patients with PAH present in clinical practice. The data on hemodynamics and outcome from this study closely resemble the effects of prostacyclin treatment in patients with PAH. Intravenous epoprostenol has been shown to improve quality of life, symptoms, exercise tolerance, hemodynamics and survival in patients with PAH in a randomized clinical trial 12. Treprostinil is a tricyclic benzidene prostacyclin analogue, with a half life of 3 - 4 hours, which is suitable for subcutaneous administration 10;11;21. Its major advantage is therefore that it eliminates the need for continuous intravenous access and its complications as the occurrence of infections, thrombosis and acute discontinuation of the drug. In a recent trial the clinical effects of treprostinil in patients with PAH were reported by Simonneau and co-investigators 12. The primary end-point in this 12 week, double blind, placebo-controlled study consisted of the 6-minute walking test, reinforced by indices of dyspnea and fatigue. These improved significantly in patients treated with treprostinil compared to placebo-treated patients. Hemodynamic parameters, as secondary end-point, also improved with treprostinil treatment compared to placebo. However, this improvement of hemodynamics was rather modest, as was illustrated by a treatment effect on mean pulmonary arterial pressure of 8 mmHg. This is consistent with findings in trials with other prostacyclin analogues, in which improved functional outcome parameters, including survival, were also associated with relatively modest effects on pulmonary hemodynamics 7. With respect to the improved clinical outcome as well as to the modest improvement in hemodynamic parameters, our findings in this rat model are congruent to the findings in these human studies. Considering the observed effects of prostanoid treatment, theories about the mechanism of action of these drugs have emerged. The major activities of prostacyclin analogues are mediated by cell surface prostanoid receptors, the IP recep134

135


Taking together the results of our study and the observations in patients treated with prostacyclin analogues, the mechanism for the improved clinical outcome after prostanoid therapy is unlikely to be fully explained by the modest reduction in pulmonary arterial pressure or by regression of structural pulmonary vascular remodeling 12. Speculating on a mechanism, one could think of prostacyclin analogues having positive inotropic properties 28;29 or increasing vascular capacitance. Indeed, Castelain et al demonstrated that prostacyclin altered the relation between cardiac

Chapter 7

tors, that increase cell cAMP 22, leading to pulmonary vascular dilatation 23. Further experimental evidence exists that prostacyclin analogues actually decrease vascular smooth muscle cell proliferation 13;24;25. This was supported by the findings of Schermuly and coworkers who found that inhaled iloprost induced regression of medial hypertrophy in the monocrotaline rat model. It should be noted however, that these animals did not have advanced pulmonary vascular lesions 26. The mechanisms by which cell proliferation is inhibited, still have to be determined. In vitro data have demonstrated that treprostinil induces a larger and more sustained increase in cAMP compared to other analogues 13. Moreover, treprostinil appeared to be a particular potent inhibitor of smooth muscle cell proliferation 13. Additionally, treprostinil was shown to mediate anti-proliferative effects on lung fibroblasts 27. Taken together, these observations suggest that treprostinil could exert its effects in patients with PAH by reversing remodeling of the pulmonary vascular lesions. This hypothesis has not been tested in an in vivo situation before. Moreover, it has not been tested in pulmonary hypertension associated with advanced vascular lesions, such as neointimal lesions, as is the case in patients with PAH. In this study, using a rat model for advanced pulmonary vascular disease, however, we found no support for this hypothesis: the extensive morphological analysis of the pulmonary vascular bed, performed in this study, could not demonstrate any changes in pulmonary vascular histopathology induced by treprostinil treatment. We studied the animals in an advanced stage of pulmonary vascular disease. In the used design, the time of sacrifice of the trio’s of rats was determined by a significant clinical deterioration of one of the three animals. It is important to realise that the two matched animals from the other study-groups, that were sacrificed simultaneously, had not clinically deteriorated yet. In other words, our study suggests that the observed better clinical condition of the treated animals at this timepoint apparently was not due to a delayed or reversed pulmonary vascular remodeling process. Several factors may have contributed to the differences found between the in vitro and the in vivo effects of prostanoids. Due to the design of this study, cell proliferation is already present in the studied animal model before the start of treprostinil treatment. This is similar to the situation in patients with advanced pulmonary vascular disease. Therefore, a limitation in cellular proliferation rate by treprostinil might not be sufficient to reduce the vascular lesions that are already present. Furthermore, in the pathobiology of vascular remodeling multiple mechanisms and cell types are involved. It is a process that is not restricted to vascular smooth muscle cell proliferation alone.

index and pulmonary arterial pressures during exercise 30. The current study does not provide data to address this hypothesis. More detailed hemodynamic evaluation, including exercise testing, would be required to study this issue. Limitations of the study The dose of treprostinil administered in this study was 50 ng/kg/min. This dose was chosen to create a plasma concentration in rats that matches plasma concentrations that are effective in humans 12. Furthermore, we tried to avoid a dose that would have significant effects on systemic hemodynamics. Since patient data suggest a strong dose-dependency of the effects of treprostinil 12, it can not be excluded that a higher dosage could lead to effects on pulmonary vascular remodeling. As stated previously, this study was powered to detect a 25% reduction in pulmonary vascular occlusion score, mean pulmonary arterial pressure or right ventricular hypertrophy. We can therefore not rule out that smaller changes in the pulmonary vascular remodeling process may have occurred that may have contributed to the observed beneficial clinical effect in this experiment. No ideal animal model for PAH exists. Although our rat model mimics the human disease with respect to clinical symptoms, hemodynamics and pulmonary vascular lesions, the presence of interspecies differences or the use of monocrotaline may induce response patterns to treatment that differ from those in humans with PAH. Finally, one should be cautious to extrapolate the results of this study to other prostacyclin analogues. In vitro work showed that different analogues might act as agonists for different receptors and activate different adenylyl cyclase isoforms 13;22;27. Moreover, clinical research suggests differences between prostacyclin and its analogues: when the transition from treatment with epoprostanol to treatment with intravenous treprostinil was studied, pulmonary hemodynamics appeared to alter in adverse direction, showing an increase in pulmonary arterial pressure and a decrease in cardiac index 31. Whether these differences between prostacyclin and its analogues are of clinical importance requires further research. Conclusion Our findings demonstrate that continuous subcutaneous treatment with the prostacyclin analogue treprostinil reduces morbidity and mortality in a rat model for advanced pulmonary vascular disease while hemodynamics improved modestly. These observations closely resemble the beneficial effects of subcutaneous treprostinil treatment in patients with PAH. The mechanism of action of treprostinil has been assumed to include reversal of pulmonary vascular lesions. However, in this model of advanced pulmonary vascular disease, we could not demonstrate treprostinil to improve structural pulmonary vascular remodeling.

136

References

2.


3.

Pietra GG, Capron F, Stewart S, Leone O, Humbert M, Robbins IM, Reid LM, Tuder RM. Pathologic assessment of vasculopathies in pulmonary hypertension. J Am Coll Cardiol. 2004;43:25S-32S.

4.

Humbert M, Sitbon O, Simonneau G. Treatment of pulmonary arterial hypertension. N Engl J Med. 2004;351:1425-1436.

5.

Geiger R, Berger RM, Hess J, Bogers AJ, Sharma HS, Mooi WJ. Enhanced expression of vascular endothelial growth factor in pulmonary plexogenic arteriopathy due to congenital heart disease. J Pathol. 2000;191:202-207.

6.

Barst RJ, Rubin LJ, McGoon MD, Caldwell EJ, Long WA, Levy PS. Survival in primary pulmonary hypertension with long-term continuous intravenous prostacyclin. Ann Intern Med. 1994;121:409415.

7.

Barst RJ, Rubin LJ, Long WA, McGoon MD, Rich S, Badesch DB, Groves BM, Tapson VF, Bourge RC, Brundage BH. A comparison of continuous intravenous epoprostenol (prostacyclin) with conventional therapy for primary pulmonary hypertension. The Primary Pulmonary Hypertension Study Group. N Engl J Med. 1996;334:296-302.

8.

Rubin LJ, Mendoza J, Hood M, McGoon M, Barst R, Williams WB, Diehl JH, Crow J, Long W. Treatment of primary pulmonary hypertension with continuous intravenous prostacyclin (epoprostenol). Results of a randomized trial. Ann Intern Med. 1990;112:485-491.

9.

Higenbottam T, Wheeldon D, Wells F, Wallwork J. Long-term treatment of primary pulmonary hypertension with continuous intravenous epoprostenol (prostacyclin). Lancet. 1984;1:1046-1047.

10. Wade M, Baker FJ, Roscigno R, DellaMaestra W, Arneson CP, Hunt TL, Lai AA. Pharmacokinetics of treprostinil sodium administered by 28-day chronic continuous subcutaneous infusion. J Clin Pharmacol. 2004;44:503-509. 11. Laliberte K, Arneson C, Jeffs R, Hunt T, Wade M. Pharmacokinetics and steady-state bioequivalence of treprostinil sodium (Remodulin) administered by the intravenous and subcutaneous route to normal volunteers. J Cardiovasc Pharmacol. 2004;44:209-214. 12. Simonneau G, Barst RJ, Galie N, Naeije R, Rich S, Bourge RC, Keogh A, Oudiz R, Frost A, Blackburn SD, Crow JW, Rubin LJ. Continuous subcutaneous infusion of treprostinil, a prostacyclin analogue, in patients with pulmonary arterial hypertension: a double-blind, randomized, placebo-controlled trial. Am J Respir Crit Care Med. 2002;165:800-804. 13. Clapp LH, Finney P, Turcato S, Tran S, Rubin LJ, Tinker A. Differential effects of stable prostacyclin

137


Wagenvoort CA. Lung-Biopsy Specimens in the Evaluation of Pulmonary Vascular-Disease. Chest. 1980;77:614-625.

Chapter 7

1.

analogs on smooth muscle proliferation and cyclic AMP generation in human pulmonary artery. Am J Respir Cell Mol Biol. 2002;26:194-201. 14. Van Albada ME, Schoemaker RG, Kemna M, Cromme-Dijkhuis AH, van Veghel R, Berger RMF. The role of increased pulmonary blood flow in pulmonary arterial hypertension. Eur Respir J. 2005;26:487-493. 15. Tanaka Y, Schuster DP, Davis EC, Patterson GA, Botney MD. The role of vascular injury and hemodynamics in rat pulmonary artery remodeling. J Clin Invest. 1996;98:434-442. 16. Okada K, Tanaka Y, Bernstein M, Zhang W, Patterson GA, Botney MD. Pulmonary hemodynamics modify the rat pulmonary artery response to injury. A neointimal model of pulmonary hypertension. Am J Pathol. 1997;151:1019-1025. 17. Jones JE, Mendes L, Rudd MA, Russo G, Loscalzo J, Zhang YY. Serial noninvasive assessment of progressive pulmonary hypertension in a rat model. Am J Physiol Heart Circ Physiol. 2002;283:H364H371. 18. Kato Y, Iwase M, Kanazawa H, Kawata N, Yoshimori Y, Hashimoto K, Yokoi T, Noda A, Takagi K, Koike Y, Nishizawa T, Nishimura M, Yokota M. Progressive development of pulmonary hypertension leading to right ventricular hypertrophy assessed by echocardiography in rats. Exp Anim. 2003;52:285-294. 19. Rabinovitch M, Gamble W, Nadas AS, Miettinen OS, Reid L. Rat pulmonary circulation after chronic hypoxia: hemodynamic and structural features. Am J Physiol. 1979;236:H818-H827. 20. Wilson DW, Segall HJ, Pan LC, Lame MW, Estep JE, Morin D. Mechanisms and pathology of monocrotaline pulmonary toxicity. Crit Rev Toxicol. 1992;22:307-325. 21. Steffen RP, de la Mata M. The effects of I5AU8I, a chemically stable prostacyclin analog, on the cardiovascular and renin-angiotensin systems of anesthetized dogs [corrected]. Prostaglandins Leukot Essent Fatty Acids. 1991;43:277-286. 22. Turcato S, Clapp LH. Effects of the adenylyl cyclase inhibitor SQ22536 on iloprost-induced vasorelaxation and cyclic AMP elevation in isolated guinea-pig aorta. Br J Pharmacol. 1999;126:845-847. 23. McLaughlin VV, Genthner DE, Panella MM, Rich S. Reduction in pulmonary vascular resistance with long-term epoprostenol (prostacyclin) therapy in primary pulmonary hypertension. N Engl J Med. 1998;338:273-277. 24. Tuder RM, Zaiman AL. Prostacyclin analogs as the brakes for pulmonary artery smooth muscle cell proliferation: is it sufficient to treat severe pulmonary hypertension? Am J Respir Cell Mol Biol. 2002;26:171-174. 25. Li RC, Cindrova-Davies T, Skepper JN, Sellers LA. Prostacyclin induces apoptosis of vascular smooth muscle cells by a cAMP-mediated inhibition of extracellular signal-regulated kinase activity and can counteract the mitogenic activity of endothelin-1 or basic fibroblast growth factor. Circ Res. 2004;94:759-767. 26. Schermuly RT, Yilmaz H, Ghofrani HA, Woyda K, Pullamsetti S, Schulz A, Gessler T, Dumitrascu R,

138

Weissmann N, Grimminger F, Seeger W. Inhaled iloprost reverses vascular remodeling in chronic experimental pulmonary hypertension. Am J Respir Crit Care Med. 2005;172:358-363. 27. Ali FY, Egan K, Fitzgerald GA, Desvergne B, Wahli W, Bishop-Bailey D, Warner TD, Mitchell JA. Role of Prostacyclin Versus PPAR beta receptors in prostacyclin sensing by lung filioblasts.. Am J Respir Cell Mol Biol. 2006;34:242-246. 28. Sebbag I, Rudski LG, Therrien J, Hirsch A, Langleben D. Effect of chronic infusion of epoprostenol on echocardiographic right ventricular myocardial performance index and its relation to clinical outcome in patients with primary pulmonary hypertension. Am J Cardiol. 2001;88:1060-1063. 29. Rich S, McLaughlin VV. The effects of chronic prostacyclin therapy on cardiac output and symptoms in primary pulmonary hypertension. J Am Coll Cardiol. 1999;34:1184-1187.

31. Gomberg-Maitland M, Tapson VF, Benza RL, McLaughlin VV, Krichman A, Widlitz AC, Barst RJ. Transition from Intravenous Epoprostenol to Intravenous Treprostinil in Pulmonary Hypertension. Am J Respir Crit Care Med. 2005;172:1586-1589.

Chapter 7

30. Castelain V, Chemla D, Humbert M, Sitbon O, Simonneau G, Lecarpentier Y, Herve P. Pulmonary artery pressure-flow relations after prostacyclin in primary pulmonary hypertension. Am J Respir Crit Care Med. 2002;165:338-340.


139

Chapter 8 Dual endothelin receptor antagonism improves both pulmonary vascular and cardiac remodeling in experimental flow-associated pulmonary hypertension

Mirjam E. van Albada, G.J. du Marchie Sarvaas, J. Koster, R.G Schoemaker, R.M.F. Berger

Manuscript in preparation

Abstract Background: Pulmonary arterial hypertension (PAH) is a common complication of large left-to-right shunts in patients with congenital heart defects. Endothelin receptor antagonism has been shown to improve hemodynamics and exercise tolerance in these patients. In a rat model for flow-associated PAH, we studied the cardiovascular effects of non-selective endothelin receptor blockade at functional, pathological and molecular level . Methods: Flow-associated PAH was created in 28 adult male Wistar rats by the injection of monocrotaline (60 mg/kg) combined with an abdominal aortocaval shunt one week later. Immediately afterwards, rats were randomized to treatment with bosentan in rat chow (300 mg/kg/day; n = 14, PAH + BOS) or normal chow (n = 14, PAH) for three weeks. Rats subjected to saline injections and sham surgery served as control (n = 12). Results: Systolic pulmonary arterial pressure (sPAP) and right ventricular hypertrophy (RVH) were increased in the model (PAH), while right ventricular contractility (+dP/dt) was decreased compared to controls (all p < 0.01). Treatment with bosentan improved hemodynamics (sPAP 48 ± 3 in PAH + BOS vs. 59 ± 2 mmHg in PAH, p = 0.003), attenuated RVH and improved right ventricular contractility. Intraacinar pulmonary vessel occlusion (16.7 ± 1.3 in PAH vs. 3.3 ± 1.0% in control, p < 0.001) was partly reversed by bosentan treatment (10.1 ± 1.4 in PAH + BOS, p < 0.001 vs. PAH). Reduced myocardial capillary density (2100 ± 63 in PAH vs. 2892 ± 109 capillaries/mm2 in control, p < 0.001) also increased after treatment (2438 ± 65 in PAH + BOS, p < 0.001 vs. PAH). Capillary density correlated with right ventricular contractility. Bosentan treatment induced differential patterns of endothelin receptor expression in heart and lung tissue, resulting, however, in a decreased endothelin-B to endothelin-A receptor expression ratio in both tissues. Conclusion: In this rat model of advanced flow-associated PAH, dual endothelin receptor antagonism improved both pulmonary vascular and cardiac remodeling and was associated with improved cardiovascular function. Bosentan induced a decreased endothelin-B to endothelin-A receptor mRNA expression ratio in both heart and lungs.

142

Introduction

Dual endothelin receptor antagonism improves both pulmonary vascular and cardiac remodeling in experimental flow-associated pulmonary hypertension

143

Chapter 8

Pulmonary arterial hypertension (PAH) is a progressive vasoproliferative disorder and an important determinant of morbidity and mortality in patients with congenital cardiac defects 1;2. Endothelin-1, a potent endothelial vasoconstricting peptide that regulates blood pressure 3 and possesses mitogenic properties, is a key pathogenetic mediator in PAH 4;5. Patients with PAH, including those with congenital heart defects, display increased pulmonary and circulating endothelin-1 levels 4;6-8. This increase in endothelin has been shown to be inversely correlated with disease severity and survival in these patients 9. Endothelin receptor antagonism has been demonstrated to improve hemodynamics and exercise tolerance in patients with idiopathic PAH 10-12 and recently also in patients with congenital heart disease (CHD) and flow-associated PAH 13. However, the mechanisms of these clinically beneficial effects of endothelin receptor antagonism in PAH are poorly defined. The endothelin signaling pathway is complex. Endothelin-1 is produced after cleavage of its precursor protein by the endothelin converting enzyme and activates two types of receptors 14. In the pulmonary vasculature, the endothelin-A receptor is primarily located on vascular smooth muscle cells, while the endothelin-B receptor is expressed both on vascular smooth muscle cells and on endothelial cells. Endothelin-A receptor activation is thought to primarily induce vasoconstriction and cell proliferation. The effects of endothelin-B receptor activation, however, depend on the localisation of the receptor. The endothelin-B receptors located on the pulmonary endothelial cell induce vasodilasation, anti-proliferative effects and are important in the clearance of endothelin-1 from the pulmonary circulation. In contrast, activation of the endothelin-B receptors located at the vascular smooth muscle cell induces vasoconstriction and proliferation. In pathological conditions, both the distribution and the effects of activation of especially the endothelin-B receptor may change in favor to a net constrictive/proliferative profile 15-17. Furthermore, activation of the endothelin-B receptor has been suggested to induce inflammation and fibrosis in specific conditions 18. In the heart, cardiomyocytes contain both A and B type receptors, that both lead to hypertrophic and positive inotropic effects 19. The extreme end of the spectrum of PAH in patients with congenital systemic-topulmonary shunts is a condition known as the Eisenmenger syndrome 20. In these patients, shunt reversal occurs due to extremely increased pulmonary vascular resistance. It is regarded as the most advanced form of PAH. The exact mechanisms of chronic endothelin receptor antagonism in such a pathological condition as flow-associated PAH and its functional and histopathological effects on heart and lungs are largely unknown. We previously described a rat model for flow-associated PAH that, in contrast to other models, is associated with advanced pulmonary vascular remodeling, including neointimal lesions 21;22. In the present study, we investigated in this rat model for advanced, flow-associated PAH the effects of non-selective endothelin receptor blockade on the heart and the pulmonary vasculature in terms of hemodynamics and function, structural remodeling and mRNA expression of the endothelin system.

Methods Animals and design of the study Forty-two male Wistar rats, weighing 315-380 gram, were obtained from Harlan (Zeist, the Netherlands). The experimental protocol was approved by the institutional Animal Care and Use Committee. Rats were randomly assigned to three experimental groups: 1) a control group (CON, n = 13), 2) an experimental group (PAH, n = 14) in which flow-associated PAH was created as previously in our laboratory, with a combination of monocrotaline injections (60 mg/kg, Sigma Chemical Co, St. Louis, MO, USA) followed by the creation of an abdominal aortocaval shunt one week later 22, 3) an experimental group that received treatment with bosentan in rat chow (concentration 5 g/kg chow, in order to achieve a dose of 300 mg/kg rat (PAH + BOS, n = 15). Metabolic cage Two weeks after the start of treatment, rats were placed in a metabolic cage for 24 hours to measure food intake. Echocardiography Two weeks after the beginning of the treatment, but at least two days apart from the metabolic cage period, echocardiographic studies were performed under isoflurane anesthesia (Vivid 7, GE Healthcare, Chalfont St.Giles, United Kingdom; equipped with a 10-Mhz phase array linear transducer). Flow profiles over the aortic valve were assessed to estimate shunt size 22;23. Hemodynamic measurements At sacrifice, animals were anesthetized with isoflurane (2.0%) in a mixture of N2O and O2 (2:1). Pulmonary arterial pressures were measured using a silastic tube with a technique described by Rabinovitch 24 that is routinely used in our laboratory 22. If pulmonary arterial pressure could not be obtained, right ventricular systolic pressure was recorded as being equal to systolic pulmonary arterial pressure. A Microtip pressure transducer (Millar Instr. Inc., Houston, TX, USA) was inserted into the right ventricular cavity to determine right ventricular systolic pressure (RVSP) and right ventricular end-diastolic pressure (RVEDP). As index of contractility, the maximal rate of increase in RVP (dP/dtmax) was taken and corrected for RVSP (dP/dtmax ind). By introducing a catheter via the left carotid artery into the aorta, systemic arterial pressures as well as heart rate were measured. Pulmonary vascular remodeling After completion of hemodynamic measurements, the thorax and abdomen were opened. Blood samples were drawn from the upper abdominal aorta and caval vein and oxygen saturation was determined to calculate the aortocaval saturation difference. The lungs and heart were removed and the left lung was fixed by filling the airways with 3.6% formalin at a pressure of 20 cm H2O. Pulmonary sections (5 µm thickness) were stained with hematoxylin-eosin and Verhoef elastin stain for 144

morphometric analysis of vascular dimensions according to a previously described protocol 22. In lung sections all transversally cut arteries with a diameter equal to or more than 50 micrometer (pre-acinar arteries) and 40 randomly chosen vessels (10 in each left lung quadrant) with a diameter less than 50 micrometer (intra-acinar vessels) were assessed at 200 and 400 times magnification using an image analysis system (Image-pro plus for windows, version 4.5) 22. Vessels < 50 micrometer usually do not have a clearly discernible internal elastic lamina. Therefore, a vascular occlusion score was calculated in these vessels as opposed to the calculation of a medial wall to lumen ratio in the larger pulmonary arteries. Occlusion was calculated in the intra-acinar pulmonary vessels according to the following formula: (outer vessel area – luminal area)/(outer vessel area). Pulmonary arteries were excluded from measurement if they had a longest/shortest diameter of more than 2, an incomplete circular shape or a collapse of more than one quarter of the vessel wall. Muscularization of 40 small pulmonary vessels was assessed according to Van Suylen and coworkers. Vessels were classified as being muscularized, partly muscularized and non-muscularized 25.

Statistical analysis Data are presented as mean ± standard error of the mean (SEM). Group differences were analyzed with one-way ANOVA using Fisher’s protected LSD post-hoc testing. The non-parametric Kruskall-Wallis test was used when data were not normally distributed, followed by Mann-Whitney post-hoc testing with Bonferroni correction. Correlation analysis was performed with Pearson’s correlation tests. Alfa was chosen to be 0.05.

145


Relative gene expression in the endothelin system RNA was extracted from total lung tissue using the Qiagen RNeasy Mini Kit (Qiagen, Frankfurt, Germany) and from right ventricular tissue at midventricular level using Trizol (Invitrogen Life Technologies, Carlsbad, CA, USA). Real-time PCR experiments were performed on a Gene Amp 5700 Sequence detector (Applied Biosystems, Nieuwerkerk a/d IJssel, the Netherlands) as described previously 28 (primer sequences are provided in table 1). RTQ-PCR results were obtained from a dilution standard curve.

Chapter 8

Cardiac remodeling The heart was divided into atria, ventricles and septum. Sections were weighed separately and fixed in 3.6% formalin. Deparaffinized 5 µm thick transverse right ventricular sections at midventricular level were stained with Gomori silver staining for analysis of myocyte size and Lectin GSL staining (Sigma) to stain endothelial cells for analysis of capillary density 26;27 using image analysis (Image-Pro). Concentric hypertrophy was measured as cross-sectional area of transversally cut myocytes showing a nucleus. Myocyte density was calculated as average number of myocytes per tissue area.

Table 1. Primer sequences. Gene

Primer sequence

Prepro Endothelin-1

F 5’- TTGCTCCTGCTCCTCCTTGA -3’ R 5’- AGCACACTGGCATCTGTTCC -3’

Endothelin-A receptor

F 5’- GAACGCCACTCTCCTAAGAA -3’ R 5’- ACACTGAGAGCGCAGAGATT -3’

Endothelin-B receptor

F 5’- CTAGCCATCACTGCGATCTT - 3’ R 5’- CAGAATCCTGCTGAGGTGAA -3’

Alpha-myosin heavy chain

F 5’-GGCCAATAGAATAGCCTCCAG-3’ R 5’-TCCACGATGGGCGATGTTCTC-3’

Beta-myosin heavy chain

F 5’-AGTGAAGAGCCTCCAGAGTT-3’ R 5’-TCCACGATGGGCGATGTTCTC-3’

Table 2. Animal characteristics at time of sacrifice. Body weight, heart rate and systolic systemic arterial pressure are shown as mean ± SEM. CON = control animals, PAH = experimental group, PAH + BOS = experimental animals treated with bosentan, RV = right ventricle, bpm = beats per minute. * = p < 0.05 vs. CON, † = p < 0.05 vs. PAH. CON

PAH

PAH + BOS

Start weight (g)

340 ± 4

344 ± 4

348 ± 4

Body weight at sacrifice (g)

398 ± 6

371 ± 6 *

366 ± 5 *

23.2 ± 2.8

6.4 ± 1.0 *

6.4 ± 1.5 *

Arterio-venous saturation difference (%) Echocardiography VTI aortic valve (cm)

5.82 ± 0.21 7.68 ± 0.27 * 7.69 ± 0.49 *

Hemodynamics Systolic pulmonary arterial pressure (mmHg)

28 ± 1

59 ± 2 *

48 ± 3 *†


20 ± 1

41 ± 2 *

36 ± 2 *

Diastolic pulmonary arterial pressure (mmHg)

13 ± 1

24 ± 2 *

23 ± 1 *

3.1 ± 0.7

6.2 ± 1.0 *

5.5 ± 0.7

125 ± 5

102 ± 4 *

109 ± 3 *

384 ± 10

309 ± 13 *

342 ± 8 *†

RV End diastolic pressure (mmHg) Systolic systemic arterial pressure (mmHg) Heart rate (bpm)

146

Results Animal model and treatment Shunt surgery was performed successfully in all but two rats (one assigned to the control group and one assigned to the bosentan group), that died from post-operative complications. Mean food intake in the bosentan group in the metabolic cage was 23.3 g/rat/day. The mean achieved dose of bosentan calculated according to this food intake was 337 mg/kg/day. There were no differences in food intake between the different animal groups. The aortacaval saturation difference was decreased in the shunted animal groups, but not different between treated and untreated animals (table 2), indicating similar shunt sizes. This was supported by findings on echocardiography, since the volume time integral across the aortic valve was increased in the PAH group, while there were no differences between treated and untreated animals (table 2). PAH animals gained less body weight at the end of the protocol. Bosentan did not alter body weight (table 2).

Pulmonary vascular remodeling Pre-acinar pulmonary arteries (> 50 micrometer): In the PAH model, pre-acinar arterial wall thickness and wall to lumen ratio increased, while luminal diameters decreased in these animals. No intimal proliferation could be demonstrated in the pre-acinar arteries of the PAH animals. Treatment did not significantly alter these parameters (table 3). Intra-acinar pulmonary vessels (< 50 micrometer): In the PAH model, the small intra-acinar vessels showed a decreased luminal diameter, while outer diameter remained similar to control animals. Concomitantly, wall thicknesses, wall to lumen ratios and occlusion score increased, as did the percentage of muscularized vessels. Therapeutic intervention with bosentan dramatically altered 147


Cardiac hypertrophy PAH rats showed increased cardiac weights, as demonstrated by increased organ weight to body weight ratios (CON 2.77 ± 0.05 g/kg, PAH 4.19 ± 0.11; p < 0.001 vs. CON and PAH + BOS 4.04 ± 0.11; p = 0.29 vs. PAH). Right ventricular hypertrophy, expressed as right ventricular to left ventricular plus septal weight ratio, almost doubled in the PAH group, while bosentan reduced this ratio by 30% (figure 1B).

Chapter 8

Hemodynamics and cardiac function Systolic as well as diastolic pulmonary arterial pressure was significantly increased in the PAH rats, as was right ventricular end diastolic pressure. Systemic arterial pressure, heart rate and contractility decreased in the PAH rats. Treatment with bosentan resulted in decreased systolic pulmonary arterial pressure and increased heart rate (table 2). Moreover, bosentan treated animals showed an improved contractility compared to the PAH group (figure 1A).

A 0,5

CON PAH PAH + BOS

+ dP/dt max ind (1/s)

100

*† 80

*

60

0

Right ventricular hypertrophy (rv/lv+ivs)

120

B CON PAH PAH + BOS

* *†

0,4

0,3

0,2

0,1

0,0

Figure 1. Right ventricular contractility and hypertrophy. A) Right ventricular contractility shown as dP/dt max corrected for right ventricular pressure. B) Bar graphs representing right ventricular hypertrophy calculated as right ventricular to left ventricular plus septal weight ratio. CON = control animals, PAH = experimental group, PAH + BOS = experimental animals treated with bosentan. * = p < 0.05 vs. control, † = p < 0.05 vs. PAH.

Table 3. Pulmonary vascular morphometry. CON = control animals, PAH = experimental group, PAH + BOS = experimental animals treated with bosentan. * = p < 0.05 vs. CON, † = p < 0.05 vs. PAH. CON

PAH

PAH + BOS

42 ± 2

64 ± 7 *

57 ± 4 *

130 ± 10

118 ± 7

107 ± 5


111 ± 8

91 ± 6 *

84 ± 5 *

Wall thickness (µm)

9 ± 1

14 ± 1 *

11 ± 1

Pre-acinar pulmonary arteries (> 50 µm) Number Outer diameter (µm)

Wall-lumen ratio

0.09 ± 0.01 0.17 ± 0.01 *

0.16 ± 0.01 *

Intra-acinar pulmonary arteries (< 50 µm) Outer diameter (µm)

26.2 ± 0.8

26.8 ± 0.6

27.0 ± 1.0


25.0 ± 0.7

21.8 ± 0.7 *

23.8 ± 1.0

0.6 ± 0.2

2.5 ± 0.2 *

1.6 ± 0.2 *†

Wall thickness (µm) Wall-lumen ratio Occlusion (%)

0.02 ± 0.01 0.14 ± 0.01 * 0.08 ± 0.01 *† 3.3 ± 1.0

16.7 ± 1.3 *

10.0 ± 1.4 *†

- % of vessels that is totally muscularized

7.9 ± 2.5

38.2 ± 2.7 *

24.1 ± 2.7 *†

- % of vessels that is partially muscularized

4.8 ± 0.9

12.3 ± 1.3 *

14.6 ± 1.5 *

- % of vessels that is non-muscularized

87.3 ± 3.0

49.3 ± 2.4 *

61.3 ± 3.2 *†

Muscularization (% of vessels)

148

A

CON

PAH

PAH + BOS C

CON PAH PAH + BOS

Capillary density (no/mm 2)

3500

3000

*†

2500

* 2000

1000

800

*

*

600

400

Chapter 8

Myocyte cross-sectional area (um 2)

B

1500 0

Figure 2. Right ventricular remodeling. A) Examples of lectin stained tissue sections of the right ventricular wall to determine capillary density of the three different groups. B) Actual measurements for capillary density in number of capillaries per mm2. C) Bar graphs representing the myocyte crosssectional area. CON = control animals, PAH = experimental group, PAH + BOS = experimental animals treated with bosentan. * = p < 0.05 vs. control, † = p < 0.05 vs. PAH.

Cardiac remodeling Right ventricular hypertrophy was further examined determining myocyte size. In the PAH model, myocyte crosssectional area increased by 50%. Although treatment decreased right heart to left heart weight ratios, we could not demonstrate a significant decrease in myocyte size (figure 2C). Capillaries stained with lectin could be discriminated clearly within the myocardium and representative examples from each group are shown in figure 2A. Capillary density was decreased in the PAH group, largely due to the increase in the size of the myocytes. Capillary density was partly restored after bosentan treatment (p < 0.01, figure 2B) and this result remained significant after correction for myocyte size (p < 0.05). In all pulmonary hypertensive animals, treated and untreated grouped together, capillary density was correlated with myocardial contractilily (R = 0.522; p = 0.005, figure 3). 149


these parameters. Wall thickness, wall to lumen ratio and occlusion score decreased, as did the percentage of muscularized vessels (table 3).

0

Figure 3. The relation of right ventricular capillary density and contractility. R = 0.522, p = 0.005. PAH = experimental group, PAH + BOS = experimental animals treated with bosentan.

100

dP/dt

max

ind (1/s)

90

80

70

60 PAH PAH + BOS

50 1600

1800

2000

2200

2400

2600

2800

3000

Capillary density (no/mm2)

Ratio of beta-MHC over alfa-MHC expression

2,5

2,0

1,5

CON PAH PAH + BOS

* *

Figure 4. Ratio of beta-myosin heavy chain expression over alfa-myosin heavy chain expression. CON = control animals, PAH = experimental group, PAH + BOS = experimental animals treated with bosentan. * = p < 0.05 vs. control.

1,0

0,5

0,0

MHC isoform composition The relative proportions of cardiac α-MHC and β-MHC were compared with realtime PCR between the different groups. The induction of pulmonary hypertension caused an 8-fold increase in the ratio between β- and α-MHC expression. Bosentan treatment non-significantly reduced this ratio by 15% (p = 0.13, figure 4). Endothelin receptor expression Pulmononary endothelin-1 and endothelin-A receptor expression levels decreased in the PAH model, although not significantly. No effect of bosentan treatment was demonstrated on this expression levels (figure 5A). Pulmonary endothelin-B recep150

LUNG

A

Expression endothelin system

2,0 CON PAH PAH + BOS

1,5

*† 1,0

* * 0,5

Figure 5. Expression of the endothelin system. A) pulmonary expression and B) right ventricular expression compared to controls. Receptor-ratio is the ratio of the expression of the endothelin-A receptor to the expression of the endothelin-B receptor. CON = control animals, PAH = experimental group, PAH + BOS = experimental animals treated with bosentan. * = p < 0.05 vs. control, † = p < 0.05 vs. PAH.

0,0

Endothelin-1

B

ET-A

ET-B

Receptor ratio

RIGHT VENTRICLE

4

3

CON PAH PAH + BOS

*

Chapter 8

* *†

2

*†

* * *

1

0

Endothelin-1

ET-A

ET-B

Receptor ratio

tor levels significantly decreased in both the PAH group and the PAH + BOS group compared to control animals. Bosentan treatment increased the endothelin-A / endothelin-B receptor expression ratio in lung tissue (figure 5A). Right ventricular endothelin-1 expression and endothelin-A receptor expression increased in the pulmonary hypertensive animals. Treatment did not affect these expression levels (figure 5B). Right ventricular endothelin-B receptor expression was increased in the PAH animals. Bosentan treatment attenuated this increase (figure 5B). Consequently, in the PAH animals, endothelin-A / endothelin-B receptor expression ratio decreased in right ventricular tissue. Treatment with bosentan increased this ratio in right ventricular myocardium (figure 5B). In the pulmonary hypertensive animals, treated and untreated pooled together, both right ventricular endothelin-1 levels and endothelin-B receptor levels were closely related to the β- over α-MHC ratio (R = 0.592, p = 0.003 and R = 0.477, p = 0.021 respectively) and to right ventricular contractility (R = -0.468, p = 0.024 and R = -0.503, p = 0,014 respectively).

151


Expression endothelin system

*

Discussion The present study demonstrates that dual endothelin receptor antagonism with bosentan in a model for advanced flow-associated PAH 1) improved pulmonary hemodynamics and attenuated pulmonary structural vascular remodeling and 2) induced beneficial right ventricular remodeling, including increased myocardial capillarisation, associated with restoration of right ventricular function. Furthermore, this study showed differential patterns of mRNA expression at the level of the endothelin receptors in cardiac and pulmonary tissue during flow-associated PAH and in response to bosentan. However, in both tissues bosentan treatment resulted in an increased endothelin-A / endothelin-B receptor expression ratio. Endothelin-1 is a powerful vasoactive substance with pleiotropic effects that is involved in a variety of processes in the human body. Endothelin-1 has been demonstrated to play a key role in the pathophysiology of PAH. However, the endothelin pathway is a complex system, including endothelin-A and endothelin-B receptors which induce differential effects, not only depending on the type of the receptor, but also on the localisation of the receptor in terms of cell type and organ, and on the presence of a physiological or pathological state. Endothelin-1 and its receptors are present in heart and lungs. Endothelin receptor antagonism is therefore likely to have its effects in both organs. The pulmonary circulation In this study we used a model for flow-associated PAH, because, in contrast to other models, this model has been demonstrated to induce advanced vascular lesions. These lesions are analogue to the hallmark lesions in human PAH, such as intimal proliferation and fibrosis, leading to vascular occlusion. The characteristic lesions are known to occur exclusively in the small, intra-acinar pulmonary vessels. Our study demonstrates that, in this model, dual endothelin receptor antagonism attenuated remodeling of the pulmonary vessels specifically at this level and that this was associated with a decrease in pulmonary arterial pressure at preserved cardiac output. The heart In our model, endothelin receptor antagonism also induced beneficial effects on the heart. The present study showed bosentan treatment to reduce the right ventricular hypertrophy induced by the model. Moreover, histopathological assessment of right ventricular myocardium suggested an optimized myocardial adaptation to its abnormal loading conditions by an increase in myocardial capillarisation. In ventricular hypertrophy, cardiomyocytes tend to outgrow their capillary supply, which leads to relative myocardial hypoxia 29;30. In experimental myocardial infarction, myocardial adaptation by increasing capillarisation has been shown to be associated with restoration of left ventricular function 31. Endothelin receptor antagonism has previously been demonstrated to increase capillarisation of the left ventricle in uremic rats 32. Moreover, in left ventricular failure, endothelin receptor antagonism has been shown to reduce left ventricular dilatation after experimental myocardial infarction 33;34 and 152

153


The endothelin system Endothelin signaling pathways are complex and the mechanisms through which dual endothelin receptor antagonism exerts its beneficial effects in patients with PAH remains to be elucidated. Vigorous debates are ongoing as whether dual or selective endothelin receptor antagonism (both of which have demonstrated bene ficial clinical effects) should be preferable in treating PAH. The exact roles of the two endothelin receptors in PAH and the effects of its functional blockade, both in heart and lung, are poorly understood. In the present study, we determined mRNA expression levels of endothelin-1 and its A and B receptors both in pulmonary and right ventricular tissue. The lungs In the normal pulmonary circulation external endothelin-1 leads to pulmonary vasodilatation, whereas in pulmonary hypertensive conditions it induces a further increase in pulmonary arterial pressure, indicating altered receptor signaling processes 42;43. Pulmonary endothelin-A receptors, localized on the vascular media on vascular smooth muscle cells (VSMC), induce the vasoconstrictor and mitogenic effects of endothelin-1. In contrast, pulmonary endothelin-B receptors are localised on both endothelial cells and vascular smooth muscle cells and induce cell specific effects. The endothelin-B receptor localized on endothelial cells induces vasorelaxation through NO and prostacyclin whereas the endothelin-B receptor localized on the VSMC induces vasoconstriction, cell proliferation, fibrosis and inflammation 44. Furthermore, the endothelial endothelin-B receptor is responsible for the clearance of circulating endothelin-1 45. In vascular disease states like PAH, a quantitative shift

Chapter 8

to reduce left ventricular hypertrophy provoked by aortic banding 35. In consistency with these data, the right ventricular systolic dysfunction, present in our experimental PAH model and expressed by decreased dP/dt, improved with bosentan treatment. In this context it is important to realise that dP/dt max is known to be a load-dependent measure of ventricular contractility and because bosentan treatment attenuated pulmonary vascular remodeling, the increased dP/ dt max might have been the result of reduced right ventricular afterload. However, right ventricular contractility correlated strongly with capillary density, suggesting that beneficial ventricular remodeling contributed to the improvement of intrinsic ventricular contractility. Nevertheless, the role of the endothelin pathway in angiogenesis is unclear. Although a pro-angiogenic role for endothelin-1 has been described 36;37, endothelin receptor antagonists seem to stimulate capillary synthesis in various conditions 32;38-40. An improved adaptation of the right ventricle in our PAH model, induced by dual endothelin receptor antagonism, could also be observed at the molecular level by a decrease in the ratio of the slower beta-MHC to the faster alpha-MHC expression in the bosentan treated group. Although this decrease did not reach statistical significance in our study, it is in congruency with data of Ichikawa et al, who found a decreased right ventricular beta-MHC expression after selective endothelin-A receptor antagonism in the monocrotaline rat model 41.

has been shown from endothelial-bound to vascular smooth muscle cell-bound endothelin-B receptors, that may contribute to the pathological vascular changes 17;42. Nevertheless, infusion of an endothelin-B receptor agonist in pulmonary hypertensive conditions decreased pulmonary arterial pressure, indicating that vasodilating endothelin-B signaling still occurs 43. Also, contradictory data exist, where infusion of endothelin-1 in the monocrotaline rat model leads to vasodilatation as opposed to constriction 46;47. Pulmonary endothelin-1 mRNA expression tended to decrease in our flow-associated PAH model compared to control animals. This was not altered by bosentan treatment. These findings are similar to those of Hill et al in the isolated monocrotaline rat model 48. In the latter model, Miyauchi and coworkers reported a gradual decrease in pulmonary tissue levels of endothelin-1 peptide and preproendothelin-1 mRNA expression, whereas circulating endothelin-1 levels increased after monocrotaline-injection 46. In contrast, in the fawn-hooded rat, a rat strain prone to develop idiopathic pulmonary hypertension, overexpression of endothelin-1 mRNA has been demonstrated compared to normotensive Sprague-Dawley rats 49. Also, in a pig model with systemic-to-pulmonary shunting associated with moderate pulmonary hypertension, increased levels of circulating endothelin-1 and increased expression of pulmonary endothelin-1 mRNA have been reported 50. These seemingly contradictory data might be associated with different species or the different nature of the disease models and temporospatial variation. However, also differences in endothelin-receptor function and activity may play a role. In the present study, we found a decreased pulmonary endothelin-B receptor mRNA expression as is described in the isolated monocrotaline rat model 51;52. A decreased endothelin-B receptor expression could decrease pulmonary clearance of endothelin-1, previously described in the monocrotaline model 53, thereby increasing circulating endothelin-1 levels. In contrast again, in the pig model with pulmonary overcirculation an increased expression of endothelin-B receptor mRNA in the lungs of these piglets was reported, which might be due to differences between early and advanced stages of pulmonary arterial hypertension 50. The heart Endothelin-1 is produced by cardiomyocytes, has positive inotropic and chronotropic effects and is obligatory for myocyte survival 54-56. However, increased endothelin-1 is known to induce cardiac hypertrophy 57;58, myocardial ischemia and edema 59 and collagen turnover in cardiac fibroblasts 60. In our model of flow-associated PAH, there was an increase of cardiac endothelin1, endothelin-A and endothelin-B receptor mRNA expression compared to control rats. The ratio of endothelin-A to endothelin-B receptor expression decreased significantly, because the increase in endothelin-B receptor expression was more pronounced than that of the endothelin-A receptor. These findings are in concordance with different models of abnormal cardiac loading conditions, including chronic left heart failure due to experimental myocardial infarction, combined right and left ventricular volume overload and ventricular pressure overload, in which in154

creased cardiac mRNA expression of endothelin-1 and both receptors have been reported 51;61-63. In the present study, bosentan treatment did not affect endothelin-1 and endothelin-A receptor expression, but significantly reduced endothelin-B receptor mRNA expression and consequently increased the ratio of endothelin-A to endothelin-B receptor expression, although not to control levels.

155


Conclusion In the present study, we demonstrate that dual endothelin receptor antagonism in a model for advanced flow-associated PAH resulted in improved pulmonary hemodynamics and attenuated pulmonary structural vascular remodeling. Additionally, in this model, dual endothelin receptor antagonism induced beneficial structural right ventricular remodeling, including increased myocardial capillarisation, associated with restoration of right ventricular function. We further showed differential patterns of mRNA expression at the level of the endothelin receptors in cardiac and pulmonary tissue during flow-associated PAH and in response to bosentan. However, in both tissues bosentan treatment resulted in an increased endothelin-A to endothelin-B receptor expression ratio. Further functional receptor studies are required

Chapter 8

In our model, mRNA-expression patterns of endothelin-1, endothelin-A and endothelin-B receptors differed in heart and lung tissue, both after induction of the model and in response to bosentan treatment. However, bosentan treatment induced an increased ratio of endothelin-A to endothelin-B receptor mRNA expression in both organs. The meaning of this finding is difficult to explain. In this context it is of interest that dual endothelin-receptor antagonism has been suggested to be more effective in reducing right ventricular hypertrophy compared to selective endothelin-A receptor antagonism. Jasmin and coworkers reported a decrease in right ventricular hypertrophy only after dual receptor blockade, while right ventricular pressures were decreased equally in both selective and nonselective endothelin receptor antagonism 64. These data suggest that endothelin-B-receptor mediated activity is associated with the development of cardiac hypertrophy. Most reports studying the endothelin pathway in PAH describe mRNA or peptide expression patterns of endothelin-1 and its receptors. However, these expression patterns obviously are not synonymous for functional activity of these receptors and its interactions with endothelin-1. To understand the complexity of the endothelin pathway, future studies should focus on the functional activity of the endothelin receptors, including mechanisms like interreceptor cross-talk, receptorheterodimerization and endothelin-stimulated-desensitization, which are thought to play important roles in the pathologic condition of PAH. Endothelin-1 is generally recognized to form a key factor in the pathogenesis of PAH. The current study demonstrates that endothelin receptor antagonism induces beneficial structural and functional effects on both heart and lungs in the presence of advanced pulmonary vascular disease, induced experimentally by flow-associated PAH. These findings stress the need for such functional endothelin-receptor studies in order to optimize endothelin receptor antagonistic therapy in patients with PAH.

to unravel the complex endothelin pathway and the consequences of differential endothelin receptor antagonism in pulmonary arterial hypertension.

156

References

2.

Hoffman JI, Rudolph AM, Heymann MA. Pulmonary vascular disease with congenital heart lesions: pathologic features and causes. Circulation. 1981;64:873-877.

3.

Yanagisawa M, Kurihara H, Kimura S, Tomobe Y, Kobayashi M, Mitsui Y, Yazaki Y, Goto K, Masaki T. A novel potent vasoconstrictor peptide produced by vascular endothelial cells. Nature. 1988;332:411-415.

4.

Stewart DJ, Levy RD, Cernacek P, Langleben D. Increased plasma endothelin-1 in pulmonary hypertension: marker or mediator of disease? Ann Intern Med. 1991;114:464-469.

5.

Cacoub P, Dorent R, Nataf P, Carayon A, Riquet M, Noe E, Piette JC, Godeau P, Gandjbakhch I. Endothelin-1 in the lungs of patients with pulmonary hypertension. Cardiovasc Res. 1997;33:196200.

6.

Giaid A, Yanagisawa M, Langleben D, Michel RP, Levy R, Shennib H, Kimura S, Masaki T, Duguid WP, Stewart DJ. Expression of endothelin-1 in the lungs of patients with pulmonary hypertension. N Engl J Med. 1993;328:1732-1739.

7.

Cacoub P, Dorent R, Nataf P, Carayon A. Endothelin-1 in pulmonary hypertension. N Engl J Med. 1993;329:1967-1968.

8.

Yoshibayashi M, Nishioka K, Nakao K, Saito Y, Matsumura M, Ueda T, Temma S, Shirakami G, Imura H, Mikawa H. Plasma endothelin concentrations in patients with pulmonary hypertension associated with congenital heart defects. Evidence for increased production of endothelin in pulmonary circulation. Circulation. 1991;84:2280-2285.

9.

Galie N, Grigioni L, Bacchi-Reggian, L, Ussia G, Parlangeli R, and Catanzariti P. Relation of Endothelin-1 to Survival in Patients With Primary Pulmonary Hypertension. Eur J Clin Invest 26, 12S. 2006.

10. Barst RJ, Ivy D, Dingemanse J, Widlitz A, Schmitt K, Doran A, Bingaman D, Nguyen N, Gaitonde M, van Giersbergen PL. Pharmacokinetics, safety, and efficacy of bosentan in pediatric patients with pulmonary arterial hypertension. Clin Pharmacol Ther. 2003;73:372-382. 11. Rubin LJ, Badesch DB, Barst RJ, Galie N, Black CM, Keogh A, Pulido T, Frost A, Roux S, Leconte I, Landzberg M, Simonneau G. Bosentan therapy for pulmonary arterial hypertension. N Engl J Med. 2002;346:896-903. 12. Channick RN, Simonneau G, Sitbon O, Robbins IM, Frost A, Tapson VF, Badesch DB, Roux S, Rainisio M, Bodin F, Rubin LJ. Effects of the dual endothelin-receptor antagonist bosentan in patients with pulmonary hypertension: a randomised placebo-controlled study. Lancet. 2001;358:1119-1123.

157


Hopkins RA, Bull C, Haworth SG, de Leval MR, Stark J. Pulmonary hypertensive crises following surgery for congenital heart defects in young children. Eur J Cardiothorac Surg. 1991;5:628-634.

Chapter 8

1.

13. Galie N, Beghetti M, Gatzoulis MA, Granton J, Berger RM, Lauer A, Chiossi E, Landzberg M. Bosentan therapy in patients with Eisenmenger syndrome: a multicenter, double-blind, randomized, placebo-controlled study. Circulation. 2006;114:48-54. 14. Levin ER. Endothelins. N Engl J Med. 1995;333:356-363. 15. Abraham DJ, Vancheeswaran R, Dashwood MR, Rajkumar VS, Pantelides P, Xu SW, du Bois RM, Black CM. Increased levels of endothelin-1 and differential endothelin type A and B receptor expression in scleroderma-associated fibrotic lung disease. Am J Pathol. 1997;151:831-841. 16. Shichiri M, Kato H, Marumo F, Hirata Y. Endothelin-1 as an autocrine/paracrine apoptosis survival factor for endothelial cells. Hypertension. 1997;30:1198-1203. 17. Bauer M, Wilkens H, Langer F, Schneider SO, Lausberg H, Schafers HJ. Selective upregulation of endothelin B receptor gene expression in severe pulmonary hypertension. Circulation. 2002;105:1034-1036. 18. Motte S, McEntee K, Naeije R. Endothelin receptor antagonists. Pharmacol Ther. 2006;110:386-414. 19. Galie N, Manes A, Branzi A. The endothelin system in pulmonary arterial hypertension. Cardiovasc Res. 2004;61:227-237. 20. Hopkins WE. Severe pulmonary hypertension in congenital heart disease: a review of Eisenmenger syndrome. Curr Opin Cardiol. 1995;10:517-523. 21. Okada K, Tanaka Y, Bernstein M, Zhang W, Patterson GA, Botney MD. Pulmonary hemodynamics modify the rat pulmonary artery response to injury. A neointimal model of pulmonary hypertension. Am J Pathol. 1997;151:1019-1025. 22. Van Albada ME, Schoemaker RG, Kemna M, Cromme-Dijkhuis AH, van Veghel R, Berger RMF. The role of increased pulmonary blood flow in pulmonary arterial hypertension. Eur Respir J. 2005;26:487-493. 23. Kato Y, Iwase M, Kanazawa H, Kawata N, Yoshimori Y, Hashimoto K, Yokoi T, Noda A, Takagi K, Koike Y, Nishizawa T, Nishimura M, Yokota M. Progressive development of pulmonary hypertension leading to right ventricular hypertrophy assessed by echocardiography in rats. Exp Anim. 2003;52:285-294. 24. Rabinovitch M, Gamble W, Nadas AS, Miettinen OS, Reid L. Rat pulmonary circulation after chronic hypoxia: hemodynamic and structural features. Am J Physiol. 1979;236:H818-H827. 25. Van Suylen RJ, Smits JF, Daemen MJ. Pulmonary artery remodeling differs in hypoxia- and monocrotaline-induced pulmonary hypertension. Am J Respir Crit Care Med. 1998;157:1423-1428. 26. Van Kerckhoven R, van Veghel R, Saxena PR, Schoemaker RG. Pharmacological therapy can increase capillary density in post-infarction remodeled rat hearts. Cardiovasc Res. 2004;61:620-629. 27. Kalkman EA, van Suylen RJ, van Dijk JP, Saxena PR, Schoemaker RG. Chronic aspirin treatment affects collagen deposition in non-infarcted myocardium during remodeling after coronary artery ligation in the rat. J Mol Cell Cardiol. 1995;27:2483-2494.

158

28. Sandovici M, Henning RH, Hut RA, Strijkstra AM, Epema AH, van Goor H, Deelman LE. Differential regulation of glomerular and interstitial endothelial nitric oxide synthase expression in the kidney of hibernating ground squirrel. Nitric Oxide. 2004;11:194-200. 29. Rakusan K, Moravec J, Hatt PY. Regional capillary supply in the normal and hypertrophied rat heart. Microvasc Res. 1980;20:319-326. 30. De Boer RA, Pinto YM, Van Veldhuisen DJ. The imbalance between oxygen demand and supply as a potential mechanism in the pathophysiology of heart failure: the role of microvascular growth and abnormalities. Microcirculation. 2003;10:113-126. 31. Van der Meer P, Lipsic E, Henning RH, Boddeus K, van der Velden J, Voors AA, Van Veldhuisen DJ, van Gilst WH, Schoemaker RG. Erythropoietin induces neovascularization and improves cardiac function in rats with heart failure after myocardial infarction. J Am Coll Cardiol. 2005;46:125-133. 32. Amann K, Munter K, Wessels S, Wagner J, Balajew V, Hergenroder S, Mall G, Ritz E. Endothelin A receptor blockade prevents capillary/myocyte mismatch in the heart of uremic animals. J Am Soc Nephrol. 2000;11:1702-1711.

35. Ito H, Hiroe M, Hirata Y, Fujisaki H, Adachi S, Akimoto H, Ohta Y, Marumo F. Endothelin ETA receptor antagonist blocks cardiac hypertrophy provoked by hemodynamic overload. Circulation. 1994;89:2198-2203. 36. Salani D, Taraboletti G, Rosano L, Di Castro V, Borsotti P, Giavazzi R, Bagnato A. Endothelin-1 induces an angiogenic phenotype in cultured endothelial cells and stimulates neovascularization in vivo. Am J Pathol. 2000;157:1703-1711. 37. Matsuura A, Yamochi W, Hirata K, Kawashima S, Yokoyama M. Stimulatory interaction between vascular endothelial growth factor and endothelin-1 on each gene expression. Hypertension. 1998;32:89-95. 38. Herbert KJ, Hickey MJ, Lepore DA, Knight KR, Morrison WA, Stewart AG. Effects of the endothelin receptor antagonist Bosentan on ischaemia/reperfusion injury in rat skeletal muscle. Eur J Pharmacol. 2001;424:59-67. 39. Iglarz M, Silvestre JS, Duriez M, Henrion D, Levy BI. Chronic blockade of endothelin receptors improves ischemia-induced angiogenesis in rat hindlimbs through activation of vascular endothelial growth factor-no pathway. Arterioscler Thromb Vasc Biol. 2001;21:1598-1603. 40. Egidy G, Juillerat-Jeanneret L, Jeannin JF, Korth P, Bosman FT, Pinet F. Modulation of human colon tumor-stromal interactions by the endothelin system. Am J Pathol. 2000;157:1863-1874.

159


34. Mulder P, Richard V, Thuillez C. Endothelin antagonism in experimental ischemic heart failure: hemodynamic, structural and neurohumoral effects. Heart Fail Rev. 2001;6:295-300.

Chapter 8

33. Mulder P, Richard V, Derumeaux G, Hogie M, Henry JP, Lallemand F, Compagnon P, Mace B, Comoy E, Letac B, Thuillez C. Role of endogenous endothelin in chronic heart failure: effect of long-term treatment with an endothelin antagonist on survival, hemodynamics, and cardiac remodeling. Circulation. 1997;96:1976-1982.

41. Ichikawa KI, Hidai C, Okuda C, Kimata SI, Matsuoka R, Hosoda S, Quertermous T, Kawana M. Endogenous endothelin-1 mediates cardiac hypertrophy and switching of myosin heavy chain gene expression in rat ventricular myocardium. J Am Coll Cardiol. 1996;27:1286-1291. 42. Black SM, Mata-Greenwood E, Dettman RW, Ovadia B, Fitzgerald RK, Reinhartz O, Thelitz S, Steinhorn RH, Gerrets R, Hendricks-Munoz K, Ross GA, Bekker JM, Johengen MJ, Fineman JR. Emergence of smooth muscle cell endothelin B-mediated vasoconstriction in lambs with experimental congenital heart disease and increased pulmonary blood flow. Circulation. 2003;108:1646-1654. 43. Okada M, Yamashita C, Okada M, Okada K. Role of endothelin-1 in beagles with dehydromonocrotaline-induced pulmonary hypertension. Circulation. 1995;92:114-119. 44. De Nucci G, Thomas R, D’Orleans-Juste P, Antunes E, Walder C, Warner TD, Vane JR. Pressor effects of circulating endothelin are limited by its removal in the pulmonary circulation and by the release of prostacyclin and endothelium-derived relaxing factor. Proc Natl Acad Sci U S A. 1988;85:9797-9800. 45. Dupuis J, Goresky CA, Fournier A. Pulmonary clearance of circulating endothelin-1 in dogs in vivo: exclusive role of ETB receptors. J Appl Physiol. 1996;81:1510-1515. 46. Miyauchi T, Yorikane R, Sakai S, Sakurai T, Okada M, Nishikibe M, Yano M, Yamaguchi I, Sugishita Y, Goto K. Contribution of endogenous endothelin-1 to the progression of cardiopulmonary alterations in rats with monocrotaline-induced pulmonary hypertension. Circ Res. 1993;73:887897. 47. Sakai S, Miyauchi T, Hara J, Goto K, Yamaguchi I. Hypotensive effect of endothelin-1 via endothelin-B-receptor pathway on pulmonary circulation is enhanced in rats with pulmonary hypertension. J Cardiovasc Pharmacol. 2000;36:S95-S98. 48. Hill NS, Warburton RR, Pietras L, Klinger JR. Nonspecific endothelin-receptor antagonist blunts monocrotaline-induced pulmonary hypertension in rats. J Appl Physiol. 1997;83:1209-1215. 49. Zamora MR, Stelzner TJ, Webb S, Panos RJ, Ruff LJ, Dempsey EC. Overexpression of endothelin-1 and enhanced growth of pulmonary artery smooth muscle cells from fawn-hooded rats. Am J Physiol. 1996;270:L101-L109. 50. Rondelet B, Kerbaul F, Motte S, van Beneden R, Remmelink M, Brimioulle S, McEntee K, Wauthy P, Salmon I, Ketelslegers JM, Naeije R. Bosentan for the prevention of overcirculation-induced experimental pulmonary arterial hypertension. Circulation. 2003;107:1329-1335. 51. Jasmin JF, Cernacek P, Dupuis J. Activation of the right ventricular endothelin (ET) system in the monocrotaline model of pulmonary hypertension: response to chronic ETA receptor blockade. Clin Sci (Lond). 2003;105:647-653. 52. Yorikane R, Sakai S, Miyauchi T, Sakurai T, Goto K. Possible involvement of endothelin-1 in cardiac hypertrophy. Arzneimittelforschung. 1994;44:412-415. 53. Dupuis J, Jasmin JF, Prie S, Cernacek P. Importance of local production of endothelin-1 and of the ET(B)Receptor in the regulation of pulmonary vascular tone. Pulm Pharmacol Ther. 2000;13:135-140.

160

54. Ishikawa T, Yanagisawa M, Kimura S, Goto K, Masaki T. Positive inotropic action of novel vasoconstrictor peptide endothelin on guinea pig atria. Am J Physiol. 1988;255:H970-H973. 55. Kasai H, Takanashi M, Takasaki C, Endoh M. Pharmacological properties of endothelin receptor subtypes mediating positive inotropic effects in rabbit heart. Am J Physiol. 1994;266:H2220H2228. 56. McClellan G, Weisberg A, Winegrad S. Endothelin regulation of cardiac contractility in absence of added endothelin. Am J Physiol. 1995;268:H1621-H1627. 57. Ito H, Hirata Y, Hiroe M, Tsujino M, Adachi S, Takamoto T, Nitta M, Taniguchi K, Marumo F. Endothelin-1 induces hypertrophy with enhanced expression of muscle-specific genes in cultured neonatal rat cardiomyocytes. Circ Res. 1991;69:209-215. 58. Ito H, Hirata Y, Adachi S, Tanaka M, Tsujino M, Koike A, Nogami A, Murumo F, Hiroe M. Endothelin-1 is an autocrine/paracrine factor in the mechanism of angiotensin II-induced hypertrophy in cultured rat cardiomyocytes. J Clin Invest. 1993;92:398-403.

60. Guarda E, Katwa LC, Myers PR, Tyagi SC, Weber KT. Effects of endothelins on collagen turnover in cardiac fibroblasts. Cardiovasc Res. 1993;27:2130-2134.

62. Brown LA, Nunez DJ, Brookes CI, Wilkins MR. Selective increase in endothelin-1 and endothelin A receptor subtype in the hypertrophied myocardium of the aorto-venacaval fistula rat. Cardiovasc Res. 1995;29:768-774. 63. Ueno M, Miyauchi T, Sakai S, Kobayashi T, Goto K, Yamaguchi I. Effects of physiological or pathological pressure load in vivo on myocardial expression of ET-1 and receptors. Am J Physiol. 1999;277:R1321-R1330. 64. Jasmin JF, Lucas M, Cernacek P, Dupuis J. Effectiveness of a nonselective ET(A/B) and a selective ET(A) antagonist in rats with monocrotaline-induced pulmonary hypertension. Circulation. 2001;103:314-318.

161


61. Kobayashi N, Hara K, Higashi T, Matsuoka H. Effects of imidapril on endothelin-1 and ACE gene expression in failing hearts of salt-sensitive hypertensive rats. Am J Hypertens. 2000;13:1088-1096.

Chapter 8

59. Filep JG, Fournier A, Foldes-Filep E. Effects of the ETA/ETB receptor antagonist, bosentan on endothelin-1-induced myocardial ischaemia and oedema in the rat. Br J Pharmacol. 1995;116:1745-1750.

Chapter 9 Erythropoietin improves advanced pulmonary vascular remodeling in a rat model

Mirjam E. van Albada, Gideon J. du Marchie Sarvaas, Johan Koster, Martin C. Houwertjes, Rolf M.F. Berger, Regien G. Schoemaker

Submitted

Abstract Introduction: Erythropoietin (EPO) mobilizes endothelial progenitor cells and promotes neovascularisation in heart failure. We studied the effects of EPO on pulmonary vascular and cardiac remodeling in a model for flow-associated pulmonary arterial hypertension (PAH). Methods: PAH was created in adult male Wistar rats by the injection of monocrotaline combined with an abdominal aortocaval shunt one week later. Immediately afterwards, rats were randomized to treatment with EPO or control treatment. Three weeks later, pulmonary and systemic hemodynamics, and right ventricular and pulmonary vascular remodeling were evaluated. Results: Vascular occlusion of the intra-acinar pulmonary vessels (13.4 ± 0.7% in PAH + EPO vs. 16.7 ± 1.3% in PAH, p = 0.038) and medial wall thickness of the pre-acinar arteries (wall to lumen ratio 0.13 ± 0.01 in PAH + EPO vs. 0.17 ± 0.01 in PAH, p = 0.01) decreased after treatment with EPO. Moreover, right ventricular capillary density was increased by therapy (2322 ± 61 capillaries/mm2 in PAH + EPO vs. 2100 ± 63 in PAH, p = 0.02). Increased mean pulmonary arterial pressure and decreased right ventricular contractility in the model were not altered by EPO treatment. Conclusion: In this rat model of flow-associated PAH, EPO treatment beneficially affected pulmonary vascular and cardiac remodeling. These histopathological effects were not accompanied by significantly improved hemodynamics.

.

164

Introduction

Animals and design of the study Forty-five male Wistar rats, weighing 315-370 gram, were obtained from Harlan (Zeist, the Netherlands). The experimental protocol was approved by the institutional Animal Care and Use Committee. The investigation conforms to the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH publication No. 85-23, revised 1996). Rats were randomly assigned to three experimental groups: 1) An experimental group (PAH, n = 14) in which flow-associated PAH was created as previously described 9. Shortly, rats were subjected to a monocrotaline injection to increase pulmonary arterial pressure (60 mg/kg, Sigma Chemical Co, St. Louis, MO, USA) followed by induction of increased pulmonary blood flow through the creation of an abdominal aortocaval shunt one week later. 2) An experimental group that received treatment with EPO 10 μg/kg (Darbepoetin-alpha, Aranesp®, Amgen Inc., Thousand Oaks, CA, USA) via a single intraperitoneal injection on the day of the abdominal 165

Erythropoietin improves advanced pulmonary vascular remodeling in a rat model

Methods

Chapter 9

Erythropoietin (EPO) is best known for its role in hematopoiesis as a hypoxiainduced hormone that leads to the proliferation and differentiation of erythroid precursor cells. More recently, EPO has shown to exert pleiotropic effects. It displays cytoprotective properties in acute brain and cardiac ischemia, associated with inhibition of apoptosis 1-4. Moreover, in experimental heart failure, it has been demonstrated that improved cardiac function after EPO treatment is associated with formation of new vessels 5. Pulmonary arterial hypertension (PAH) is a disease in which pulmonary vascular remodeling leads to increased pulmonary vascular resistance and consequently to right ventricular failure. EPO administration in the hypoxic rat model for pulmonary hypertension reduces pulmonary vascular remodeling, without effects on right ventricular hypertrophy or pulmonary pressures 6. Furthermore, transgenic mice with increased EPO production appeared to be less sensitive to the development of hypoxic pulmonary hypertension 7. In a recent study, mice lacking the EPOreceptor had an accelerated development of pulmonary hypertension under hypoxic conditions with more pronounced pulmonary vascular remodeling 8. Hence, EPO may play an important role at multiple levels in the development of pulmonary vascular disease in PAH. EPO treatment could have beneficial effects in pulmonary hypertension either by improving capillarisation of the hypertrophied myocardium or by direct favourable effects on pulmonary vascular remodeling. Therefore, this study was designed to determine the effects of EPO therapy on cardiac and pulmonary vascular remodeling in a rat model for flow-associated PAH.

surgery (PAH + EPO, n = 18). This dosage was chosen based on pilot experiments in our lab, showing a significant rise in hematocrit and is comparable to a dosage of 2000 IU/kg of short acting erythropoietin. 3) Rats that were subjected to sham surgery and saline injections served as controls (CON, n = 13). Hemodynamic measurements Three weeks after EPO administration, animals were anesthetized with isoflurane (2.0%) in a mixture of N2O and O2 (2:1). Pulmonary arterial pressures were measured using standard techniques as described by Rabinovitch 10 which are routinely used in our laboratory 9. If pulmonary arterial pressure could not be obtained, right ventricular systolic pressure was recorded as being equal to systolic pulmonary arterial pressure. Subsequently, a Microtip pressure transducer (Millar Instr. Inc., Houston, TX, USA) was inserted into the right ventricular cavity to determine right ventricular systolic pressure (RVSP) and right ventricular end-diastolic pressure (RVEDP). As index of contractility, the maximal rate of increase in right ventricular pressure (RVP), dP/dtmax, was taken and corrected for RVSP (dP/dtmax ind). Similarly -dP/dtmax ind was calculated from the maximal rate of decrease in RVP and taken as index for relaxation. By introducing a catheter via the left carotid artery into the aorta, systemic arterial pressures as well as heart rate were measured. Pulmonary vascular remodeling After completion of hemodynamic measurements, blood samples were drawn from the upper abdominal aorta and caval vein and oxygen saturation was determined to calculate the aortocaval saturation difference. The thorax was opened and heart and lungs were excised. The left lung was fixated by filling the airways with 3.6% formalin at a pressure of 20 cm H2O. The right lung was frozen in liquid nitrogen for further molecular analysis. Pulmonary sections (5 µm thickness) were stained with hematoxylin-eosin and Verhoef elastin stain for morphometric analysis of vascular dimensions according to a previously described protocol 9. In lung sections all transversally cut arteries with a diameter equal to or more than 50 micrometer (preacinar arteries) and 40 randomly chosen vessels (10 in each left lung quadrant) with a diameter less than 50 micrometer (intra-acinar vessels) were quantatively analyzed at 200 and 400 times magnification using an image analysis system (Image-Pro plus for windows version 4.5) 9. Vessels < 50 micrometer usually do not have a clearly discernible internal elastic lamina. Therefore, a vascular occlusion score was calculated in these vessels as opposed to the calculation of a medial wall to lumen ratio in the larger pulmonary arteries. Occlusion was calculated in the intra-acinar pulmonary vessels according to the following formula: (outer vessel area – luminal area)/(outer vessel area). Pulmonary arteries were excluded from measurement if they had a longest/shortest diameter of more than 2, an incomplete circular shape or a collapse of more than one quarter of the vessel wall. Muscularization of 40 small pulmonary vessels was assessed according to van Suylen and coworkers 11. 166

Table 1. Primer sequences for VEGF and its receptors, alpha-myosin heavy chain and beta-myosin heavy chain. Gene

Primer sequence

VEGF

F 5’-GTACCTCCACCATGCCAAGT-3’ R 5’-AATAGCTGCGCTGGTAGACG-3’

VEGF R1 (flt-1)

F 5’-GACCTGCGAAGCCACAGTTA-3’ R 5’-GTCAATCCGCTGCCTGATAG-3’

VEGF R2 (flk-1)

F 5’-GCCTTATGATGCCAGCAAGT-3’ R 5’-GCCAATGTGGATGAGGATCT-3’

Alpha-myosin heavy chain

F 5’-GGCCAATAGAATAGCCTCCAG-3’ R 5’-TCCACGATGGGCGATGTTCTC-3’

Beta-myosin heavy chain

F 5’-AGTGAAGAGCCTCCAGAGTT-3’ R 5’-TCCACGATGGGCGATGTTCTC-3’

Statistical analysis Data are presented as mean ± standard error of the mean (SEM). Group differences were analyzed using one-way ANOVA-testing with Fisher’s protected LSD post-hoc testing. The non-parametric Kruskall-Wallis test was used when data were not normally distributed, followed by Mann-Whitney post-hoc testing with Bonferroni correction. Correlation analysis was performed with Pearson’s correlation test. Alpha was chosen to be 0.05. 167


Gene expression In order to determine the expression of myosin heavy chain mRNA and of angiogenic factors, RNA was extracted from pulmonary and right ventricular tissue using the Qiagen RNeasy Mini Kit (Qiagen, Frankfurt, Germany). Real-time PCR experiments were performed on a Gene Amp 5700 Sequence detector (Applied Biosystems, Nieuwerkerk a/d IJssel, The Netherlands) as described previously 14. Primers were designed for vascular endothelial growth factor (VEGF) and its two receptor subtypes VEGF-R1 and VEGF-R2 and for alpha-myosin heavy chain and beta-myosin heavy chain. Respective primer sequences are provided in table 1. PCR results were obtained from a dilution standard curve.

Chapter 9

Right ventricular remodeling The heart was divided into atria, ventricles and septum. Sections were weighed separately and fixed in 3.6% formalin. Deparaffinized 5 µm thick transverse cardiac sections at midventricular level were stained with Gomori silver staining for analysis of myocyte size and with Lectin GSL staining (Sigma) of endothelial cells for analysis of capillary density 12;13. Image analysis (Image-Pro plus for windows, version 4.5) was used to measure capillary density and myocyte size. Capillary density was expressed as the number of capillaries per tissue area (mm2), myocyte size as the average crosssectional area of transversally cut myocytes at the level of the nucleus.

Table 2. Animal characteristics at time of sacrifice. Data are shown as mean ± SEM. CON = control animals, PAH = experimental group, PAH + EPO = experimental animals treated with EPO, RV = right ventricle, bpm = beats per minute. * = p < 0.05 vs. CON, † = p < 0.05 vs. PAH. CON

PAH

PAH + EPO

Body weight at sacrifice (g) Arterio-venous saturation difference (%)

398 ± 6 23.2 ± 2.8

371 ± 6 * 6.4 ± 1.0 *

369 ± 6 * 6.5 ± 2.1 *

Hemodynamics Mean pulmonary arterial pressure (mmHg) End diastolic pressure RV (mmHg) dP/dtmax ind (1/s) -dP/dtmax ind (1/s) Mean systemic arterial pressure (mmHg) Heart rate (bpm)

20 ± 1 3.1 ± 0.7 97 ± 8 86 ± 6 111 ± 5 384 ± 10

41 ± 2 * 6.2 ± 1.0 * 71 ± 2 * 73 ± 2 * 83 ± 5 * 309 ± 13 *

40 ± 2 * 7.0 ± 1.5 * 77 ± 3 * 72 ± 2 * 91 ± 6 * 351 ± 11 †

Pathology Heart to body weight ratio (g/kg) Right ventricular hypertrophy (RV(LV+IVS))

2.77 ± 0.05 0.25 ± 0.01

4.19 ± 0.12 * 0.44 ± 0.02 *

4.10 ± 0.13 * 0.43 ± 0.01 *

Results Animal model and treatment Shunt surgery was performed successfully in all but five of the forty-five rats. Three animals died because of acute surgery-related complications, whereas two animals did not have a shunt at the end of the protocol, and were therefore excluded from further analysis. One rat in the EPO group died prematurely of unknown cause. Experimental animals had decreased body weights and developed dyspnea, defined as the use of accessory respiratory muscles, at the end of the protocol. EPO treatment did not alter body weight (table 2). Hematocrit was not significantly increased three weeks after administration in the EPO treated group (0.42 ± 0.02 vs. 0.39 ± 0.02 in the PAH animals, p = 0.41). Hemodynamics and cardiac function The aortacaval saturation difference was decreased in the shunted animal groups, but identical between treated and untreated animals (table 2), indicating that there was no effect of treatment on shunt flow. Mean pulmonary arterial pressure and right ventricular pressure were significantly increased in the PAH group compared to controls. Right ventricular end diastolic pressure was also increased compared to controls. Systemic arterial pressure and heart rate decreased in the animal model. 168

CON

PAH

PAH + EPO

Treatment with EPO did not significantly alter pulmonary or systemic arterial pressures, nor did it change right ventricular pressures. Heart rate increased significantly after EPO treatment (table 2). Myocardial contractility, measured as indexed dP/dt, was impaired in the PAH group. EPO treatment was not able to restore this impaired contractility. Similarly, impaired right ventricular relaxation was not altered after EPO treatment (table 2). Figure 1. Typical examples of pulmonary histopathology of the intra-acinar pulmonary vessels. CON = control animals, PAH = experimental group, PAH + EPO = experimental animals treated with EPO.

169


Pulmonary vascular remodeling Pre-acinar pulmonary arteries (> 50 micrometer): In the PAH group the pre-acinar pulmonary arteries had an increased wall thickness and wall to lumen ratio and they increased in number in these animals. No intimal proliferation was observed in the pre-acinar arteries of the PAH group. Treatment significantly reduced wall thickness in these arteries (table 3). The increased wall to lumen ratio decreased by more than 50% (figure 2A). Intra-acinar pulmonary vessels (< 50 micrometer): Representative pictures of pulmonary vascular remodeling are shown in figure 1. The intra-acinar pulmonary vessels in the PAH group showed a decreased luminal diameter. Outer diameter remained similar to control animals, indicating inward remodeling. Increased wall thicknesses, wall to lumen ratios, and increased occlusion with more muscularization support this observation. Therapeutic intervention with EPO decreased wall thickness (table 3) and occlusion scores (figure 2B), but did not affect the degree of muscularization (figure 1 and 2C).

Chapter 9

Cardiac weights Experimental rats showed increased cardiac weights, as demonstrated by an increased organ weight to body weight ratio (table 2). Treatment with EPO did not alter total heart weight to body weight ratios. Right ventricular hypertrophy, expressed as right ventricular to left ventricular plus septal weight ratio, almost doubled in the PAH group, while EPO did not significantly influence this ratio (table 2).

Table 3. Pulmonary vascular morphometry. CON = control animals, PAH = experimental group, PAH + EPO = experimental animals treated with EPO. * = p < 0.05 vs. CON, † = p < 0.05 vs. PAH. CON

PAH

PAH + EPO

64 ± 7 * 118 ± 7 91 ± 6 14 ± 1 *

63 ± 6 * 111 ± 6 91 ± 6 10 ± 1†

26.8 ± 0.6 21.8 ± 0.7 * 2.5 ± 0.2 *

26.3 ± 0.6 22.3 ± 0.6 * 2.0 ± 0.1 *†

Pre-acinar pulmonary arteries (> 50 µm) Number per lung section Outer diameter (µm) Luminal diameter (µm) Wall thickness (µm)

42 ± 2 130 ± 10 111 ± 8 9 ± 1

Intra-acinar pulmonary arteries (< 50 µm) Outer diameter (µm) Luminal diameter (µm) Wall thickness (µm)

26.2 ± 0.8 25.0 ± 0.7 0.6 ± 0.2

B

A *

20

*†

0,15

0,10

0,05

*†

12 8 4

0,00

0

Figure 2. Pulmonary vascular remodeling. A) Wall to lumen ratio in the pre-acinar pulmonary arteries. B) Occlusion score of the intra-acinar pulmonary vessels. C) Percentage of the intra-acinar pulmonary vessels that was totally muscularized. CON = control animals, PAH = experimental group, PAH + EPO = experimental animals treated with EPO. * = p < 0.05 vs. CON, † = p < 0.05 vs. PAH.

C Percentage of vessels that was totally msucularised (%)

CON PAH PAH + EPO

170

*

16

Occlusion (%)

Wall-lumen ratio

0,20

50 40 30 20 10 0

*

*

A

B

*

800

600

400

*

Capillary density (no/mm2)

1000

Myocyte cross-sectional area (um2)

CON PAH PAH + EPO

3500

3000

*†

2500

* 2000

1500 0

0

C

PAH

PAH + EPO

Gene expression Right ventricular expression of VEGF-receptor type 1 increased in the model, whereas VEGF expression and VEGF-receptor type 2 expression did not change. After treatment, cardiac VEGF expression did not alter, nor did VEGF-receptor type 2 expression. However, therapy prevented the increase in receptor type 1 expression in the untreated group (figure 4A). Pulmonary VEGF expression was not altered in the animal model, or by EPO treatment. 171


Figure 3. Right ventricular remodeling Cardiac remodeling Right ventricular hypertrophy was fur- A) Bar graphs representing the myocyte ther examined determining myocyte size. cross-sectional area. B) Measurements for capillary density in number of capillaries per Myocyte cross-sectional area increased by mm2. C) Examples of lectin stained tissue 50% in the PAH group. Treatment did not sections of the right ventricular wall to deterresult in a significant decrease in myocyte mine capillary density. CON = control animals, PAH = experimental group, PAH + EPO = size (figure 3A). Capillaries stained with lectin could be experimental animals treated with EPO. * = p < 0.05 vs. control, † = p < 0.05 vs. PAH. discriminated clearly within the myocardium and representative examples from each group are shown in figure 3C. Capillary density was decreased in the PAH group compared to controls. Capillary density increased by 11% after EPO treatment (figure 3B).

Chapter 9

CON

RIGHT VENTRICULAR mRNA EXPRESSION CON PAH PAH + EPO

1,6 *

1,4 1,2 1,0

†

0,8 0,6 0,4 0,2 0,0

VEGF

VEGF-R1

VEGF-R2

B Fold regulation compared to control


A

PULMONARY mRNA EXPRESSION 1,6 1,4 1,2 †

1,0 0,8

*

*

*

0,6 0,4 0,2 0,0

VEGF

VEGF-R1

VEGF-R2

Both VEGF-receptor subtypes in pulmonary tis- Figure 4. Real-time PCR for vascusue decreased in the model. EPO treatment re- lar endothelial growth factor (VEGF) stored pulmonary VEGF-receptor type 2 expres- and its receptors type 1 (VEGF-R1 or flt-1) and type 2 (VEGF-R2 or flk-1). sion to near normal levels (figure 4B), without A) Expression of the VEGF system in affecting VEGF-receptor type 1 expression. right ventricular tissue. B) ExpresRight ventricular alpha-myosin heavy chain ex- sion of the VEGF system in pulmonary pression decreased in the model (0.65 ± 0.08 tissue. CON = control animals, PAH vs. 1.27 ± 0.08 in control animals, p < 0.001) = experimental group, PAH + EPO = experimental animals treated with EPO. but was not altered by therapy (0.65 ± 0.09, * = p < 0.05 vs. CON, † = p < 0.05 vs. ns vs. PAH group). Beta-myosin heavy chain ex- PAH. Results are normalized as fold pression increased in the animal model (0.90 regulation compared to control animals. ± 0.05 vs. 0.31 ± 0.06 in control animals, p < 0.001). Therapy did not influence this (1.00 ± 0.13, ns vs. PAH group). Consequently, the ratio of beta over alpha myosin heavy chain expression increased in the model, without effect of therapy.

Discussion In this animal model for flow-associated PAH, EPO treatment ameliorated pulmonary vascular remodeling and increased myocardial capillarisation, whereas these changes were not accompanied by a decrease in pulmonary arterial pressure, or by changes in right ventricular myocardial contractility. The findings in this model are in congruency with those in models for other forms of pulmonary hypertension. In hypoxic pulmonary hypertensive rats, right ventricular to body weight ratio and right ventricular pressures were not altered by EPO treatment, while pulmonary vascular remodeling ameliorated 6. In mice with increased EPO production, pulmonary vasoconstrictor responses in isolated perfused lungs were decreased, as was pulmonary vascular remodeling after a prolonged period of exposure to hypoxia 7;15. Thus, investigations in different animal models for pulmo172


173

Chapter 9

nary hypertension strongly indicate that EPO beneficially affects pulmonary vascular remodeling, without changing hemodynamics or right ventricular hypertrophy. Several mechanisms could be responsible for this reversal of pulmonary vascular remodeling. First of all, EPO administration leads to endothelial progenitor cell (EPC) mobilisation from the bone marrow 16;17. In vitro, EPO stimulates EPC proliferation, adhesion and differentiation 16;17. By stimulating incorporation of EPCs into the neo-endothelium, EPO facilitates endothelial repair 18. Accordingly, EPCs might be beneficial in the repair of the damaged pulmonary endothelium in PAH. In the monocrotaline rat model, intravenously injected EPCs have been retrieved in the pulmonary vasculature and are shown to prevent the monocrotaline-induced pulmonary vascular remodeling 19;20. Literature is not conclusive though, since Sahara et al could not demonstrate beneficial effects of injection with unfractionated bone marrow derived cells on medial wall thickness in the rat 21. Recently, Satoh et al demonstrated that the development of increased pulmonary arterial pressure and of pulmonary vascular remodeling in response to hypoxia was accelerated in EPOreceptor deficient mice compared to wild-type mice 8. The mobilization of EPCs and their recruitment to the pulmonary endothelium were significantly impaired in these animals. It has been suggested recently that the anti-oxidant and anti-apoptotic effects of EPO are dependent on JAK2 and Akt phosphorylation and may be linked with the activation of heme oxygenase-1 (HO-1) 22;23. HO-1 is an inducible enzyme with potent anti-oxidant and anti-apoptotic activities, which are regulated by Akt-signalling. Decreased expression of HO-1 has been shown in human pulmonary hypertension 24 , whereas the inhibition of HO-1 has been shown to aggravate murine monocrotaline-induced pulmonary hypertension 25 and increasing HO-1 in this model is beneficial 26. HO-1 may therefore have a central role in the effects of EPO in pulmonary hypertension that warrants further investigation. Another compound that could mediate the beneficial effects of EPO administration is VEGF. Increased VEGF expression has been demonstrated specifically in the plexiform lesions of patients with PAH 27;28. This may suggest a role for VEGF in the pathogenesis of the disease. In vivo experiments have shown beneficial effects of VEGF in pulmonary hypertension. Firstly, VEGF inhibition in newborn rats causes pulmonary hypertension 29 . Moreover, administration of human recombinant VEGF preserves endothelial function and reduces pulmonary vascular remodeling in a sheep model for primary pulmonary hypertension of the newborn 30;31. Gene transfer of VEGF reduced bleomycin-induced pulmonary hypertension in rabbits 32 and hypoxic pulmonary hypertension in rats 33. When VEGF-expressing vascular smooth muscle cells were delivered to monocrotaline-treated Fisher rats, right ventricular pressure and right ventricular hypertrophy decreased as did wall thickness of the pulmonary arteries 34. In vitro, EPO has been shown to induce VEGF in human vascular endothelial cells 35. In vivo studies showed an increase in VEGF after EPO administration 36;37. Together, these data indicate that the beneficial effects of EPO could be mediated through a VEGF pathway.

In our model, we could not demonstrate changes in the expression of VEGF mRNA, three weeks after EPO administration. VEGF-receptor mRNA expression, however, was altered both in the model and after EPO treatment. VEGF-R1 is known to negatively regulate vascular formation, possibly by acting as a scavenger receptor in its soluble form 38;39. In contrast, VEGF-R2 signalling is important in promoting angiogenesis 40. In our animal model, increased right ventricular VEGF-R1 expression suggests inhibition of VEGF-mediated vascular formation. The interpretation of the net effect of receptor regulation in the experimental lungs is more complicated, because both receptor subtypes were down regulated in the model compared to controls. Treatment with EPO likely stimulates VEGF-mediated angiogenic effects, since VEGF-R1 to VEGF-R2 expression ratio decreased after EPO treatment, both in the right ventricle and in the hypertensive lungs. In the course of PAH, right ventricular hypertrophy and failure are important determinants of outcome. EPO treatment has been shown to improve cardiac function and to induce neovascularisation in rats with heart failure after myocardial infarction 5. In a rat model for left ventricular hypertrophy associated with chronic renal failure, EPO treatment seemed to increase cardiac capillary density 41. This increased vascular growth after EPO treatment has been correlated with the number of circulating EPCs 42. Moreover, also VEGF seems to be crucial in increasing myocardial capillarisation, since by blocking VEGF activity, bradycardia-induced myocardial angiogenesis was antagonized 43. Question remains whether EPO could play a role in prevention of the progression of right ventricular hypertrophy to right ventricular failure in PAH. Although we could demonstrate an increase in capillary density in the hypertrophied right ventricle, this was not associated with an improvement in its contractility. For additional assessment of the functional consequences of the altered right ventricular remodeling, we studied the expression of different isoforms of myosin heavy chain (MHC). Both the fast alpha and the slow beta myosin heavy chain are expressed in the normal cardiomyocyte. These two forms differ in ATP-ase activity. A shift towards more alpha-myosin heavy chain expression is associated with improved contractility 5;44. In concordance with the lack of change in contractility measurements after treatment, we did not find differences in the expression of alpha and beta myosin heavy chain between treated and untreated rats. Thus, cardiac remodeling improved with EPO treatment, whereas this could not be associated with improved right ventricular function, nor with a decrease in hypertrophy. A possible explanation for the effects observed could be the increased blood viscosity caused by EPO. Although it was initially hypothesized by Petit et al that EPO administration would deteriorate hypoxic pulmonary hypertension because of the associated polycythemia, in his experiments pulmonary arterial pressure did not increase 45 and pulmonary vascular remodeling appeared to be even less pronounced 6. Moreover, isolated lungs from EPO treated hypoxic rats had lower pulmonary vascular resistance than saline-treated hypoxic rats when perfused with blood from normocythemic donor rats 6. This indicates that normocythemic EPO-treated animals could have decreased pulmonary vascular resistance and consequently less right ven174

tricular hypertrophy. Whereas we did not find a significant difference in hematocrit three weeks after administration, an initial increase might have been possible 5. The hematopoietic effects of EPO, leading to an increased pulmonary vascular resistance could therefore counteract the beneficial structural effects on the heart.

175


Concluding, in a rat model for flow-associated PAH, EPO causes beneficial effects on both cardiac and pulmonary vascular remodeling. No improved pulmonary hemodynamics could be demonstrated in this study to accompany these histopathological changes. Molecular studies in our model suggest that the VEGF/VEGF-receptor system may be involved in mediating these effects of EPO. These data warrant further detailed studies to investigate the mechanisms through which EPO exerts its beneficial effects in pulmonary hypertension.

Chapter 9

Limitations This study did not allow identifying the mechanisms through which EPO exerts its beneficial effects on cardiac and pulmonary vascular remodeling in our model. Although hematocrit and the VEGF-receptor system have been investigated three weeks after EPO administration, no sequential investigations were performed. Other potential mechanisms, such as activation of EPCs or induction of HO-1, were not investigated. Neither was the effect of multiple doses of EPO studied. Further studies are needed to investigate its mechanisms in detail. Although in our model heart rate normalised after EPO treatment, we could not demonstrate a change in pulmonary hemodynamics. This might be explained by the fact that we have only measured pulmonary arterial pressure, and not cardiac output or pulmonary vascular resistance. In our shunt model, beneficial functional effects of the reversed pulmonary vascular remodeling after EPO might have been masked by an increase in pulmonary flow, leading to unchanged PAP in the presence of reduced pulmonary vascular resistance. More sensitive hemodynamic assessment would be needed to demonstrate such an effect.

References 1.

Brines ML, Ghezzi P, Keenan S, Agnello D, de Lanerolle NC, Cerami C, Itri LM, Cerami A. Erythropoietin crosses the blood-brain barrier to protect against experimental brain injury. Proc Natl Acad Sci U S A. 2000;97:10526-10531.

2.

Van der Meer P, Lipsic E, Henning RH, de Boer RA, Suurmeijer AJ, van Veldhuisen DJ, van Gilst WH. Erythropoietin improves left ventricular function and coronary flow in an experimental model of ischemia-reperfusion injury. Eur J Heart Fail. 2004;6:853-859.

3.

Parsa CJ, Matsumoto A, Kim J, Riel RU, Pascal LS, Walton GB, Thompson RB, Petrofski JA, Annex BH, Stamler JS, Koch WJ. A novel protective effect of erythropoietin in the infarcted heart. J Clin Invest. 2003;112:999-1007.

4.

Cai Z, Semenza GL. Phosphatidylinositol-3-kinase signaling is required for erythropoietinmediated acute protection against myocardial ischemia/reperfusion injury. Circulation. 2004;109:2050-2053.

5.

Van der Meer P, Lipsic E, Henning RH, Boddeus K, van der Velden J, Voors AA, van Veldhuisen DJ, van Gilst WH, Schoemaker RG. Erythropoietin induces neovascularization and improves cardiac function in rats with heart failure after myocardial infarction. J Am Coll Cardiol. 2005;46:125-133.

6.

Petit RD, Warburton RR, Ou LC, Hill NS. Pulmonary vascular adaptations to augmented polycythemia during chronic hypoxia. J Appl Physiol. 1995;79:229-235.

7.

Weissmann N, Manz D, Buchspies D, Keller S, Mehling T, Voswinckel R, Quanz K, Ghofrani HA, Schermuly RT, Fink L, Seeger W, Gassmann M, Grimminger F. Congenital erythropoietin overexpression causes “anti-pulmonary hypertensive” structural and functional changes in mice, both in normoxia and hypoxia. Thromb Haemost. 2005;94:630-638.

8.

Satoh K, Kagaya Y, Nakano M, Ito Y, Ohta J, Tada H, Karibe A, Minegishi N, Suzuki N, Yamamoto M, Ono M, Watanabe J, Shirato K, Ishii N, Sugamura K, Shimokawa H. Important role of endogenous erythropoietin system in recruitment of endothelial progenitor cells in hypoxia-induced pulmonary hypertension in mice. Circulation. 2006;113:1442-1450.

9.

Van Albada ME, Schoemaker RG, Kemna M, Cromme-Dijkhuis AH, van Veghel R, Berger RMF. The role of increased pulmonary blood flow in pulmonary arterial hypertension. Eur Respir J. 2005;26:487-493.

10. Rabinovitch M, Gamble W, Nadas AS, Miettinen OS, Reid L. Rat pulmonary circulation after chronic hypoxia: hemodynamic and structural features. Am J Physiol. 1979;236:H818-H827. 11. Van Suylen RJ, Smits JF, Daemen MJ. Pulmonary artery remodeling differs in hypoxia- and monocrotaline-induced pulmonary hypertension. Am J Respir Crit Care Med. 1998;157:1423-1428. 12. Van Kerckhoven R, van Veghel R, Saxena PR, Schoemaker RG. Pharmacological therapy can increase capillary density in post-infarction remodeled rat hearts. Cardiovasc Res. 2004;61:620-629.

176

13. Kalkman EA, van Suylen RJ, van Dijk JP, Saxena PR, Schoemaker RG. Chronic aspirin treatment affects collagen deposition in non-infarcted myocardium during remodeling after coronary artery ligation in the rat. J Mol Cell Cardiol. 1995;27:2483-2494. 14. Sandovici M, Henning RH, Hut RA, Strijkstra AM, Epema AH, van Goor H, Deelman LE. Differential regulation of glomerular and interstitial endothelial nitric oxide synthase expression in the kidney of hibernating ground squirrel. Nitric Oxide. 2004;11:194-200. 15. Walker BR, Resta TC, Nelin LD. Nitric oxide-dependent pulmonary vasodilation in polycythemic rats. Am J Physiol Heart Circ Physiol. 2000;279:H2382-H2389. 16. Heeschen C, Aicher A, Lehmann R, Fichtlscherer S, Vasa M, Urbich C, Mildner-Rihm C, Martin H, Zeiher AM, Dimmeler S. Erythropoietin is a potent physiologic stimulus for endothelial progenitor cell mobilization. Blood. 2003;102:1340-1346. 17. Bahlmann FH, DeGroot K, Duckert T, Niemczyk E, Bahlmann E, Boehm SM, Haller H, Fliser D. Endothelial progenitor cell proliferation and differentiation is regulated by erythropoietin. Kidney Int. 2003;64:1648-1652. 18. Urao N, Okigaki M, Yamada H, Aadachi Y, Matsuno K, Matsui A, Matsunaga S, Tateishi K, Nomura T, Takahashi T, Tatsumi T, Matsubara H. Erythropoietin-mobilized endothelial progenitors enhance reendothelialization via Akt-endothelial nitric oxide synthase activation and prevent neointimal hyperplasia. Circ Res. 2006;98:1405-1413.

21. Sahara M, Sata M, Morita T, Nakamura K, Hirata Y, Nagai R. Diverse contribution of bone marrowderived cells to vascular remodeling associated with pulmonary arterial hypertension and arterial neointimal formation. Circulation. 2007;115:509-517. 22. Calo LA, Davis PA, Piccoli A, Pessina AC. A role for heme oxygenase-1 in the antioxidant and antiapoptotic effects of erythropoietin: the start of a good news/bad news story? Nephron Physiol. 2006;103:107-111. 23. Smith KJ, Bleyer AJ, Little WC, Sane DC. The cardiovascular effects of erythropoietin. Cardiovasc Res. 2003;59:538-548. 24. Achcar RO, Demura Y, Rai PR, Taraseviciene-Stewart L, Kasper M, Voelkel NF, Cool CD. Loss of caveolin and heme oxygenase expression in severe pulmonary hypertension. Chest. 2006;129:696705. 25. Goto J, Ishikawa K, Kawamura K, Watanabe Y, Matumoto H, Sugawara D, Maruyama Y. Heme oxygenase-1 reduces murine monocrotaline-induced pulmonary inflammatory responses and resultant right ventricular overload. Antioxid Redox Signal. 2002;4:563-568.

177


20. Raoul W, Wagner-Ballon O, Saber G, Hulin A, Marcos E, Giraudier S, Vainchenker W, Adnot S, Eddahibi S, Maitre B. Effects of bone marrow-derived cells on monocrotaline- and hypoxiainduced pulmonary hypertension in mice. Respir Res. 2007;8:8.

Chapter 9

19. Zhao YD, Courtman DW, Deng Y, Kugathasan L, Zhang Q, Stewart DJ. Rescue of monocrotalineinduced pulmonary arterial hypertension using bone marrow-derived endothelial-like progenitor cells: efficacy of combined cell and eNOS gene therapy in established disease. Circ Res. 2005;96:442-450.

26. Zhou H, Liu H, Porvasnik SL, Terada N, Agarwal A, Cheng Y, Visner GA. Heme oxygenase-1 mediates the protective effects of rapamycin in monocrotaline-induced pulmonary hypertension. Lab Invest. 2006;86:62-71. 27. Geiger R, Berger RM, Hess J, Bogers AJ, Sharma HS, Mooi WJ. Enhanced expression of vascular endothelial growth factor in pulmonary plexogenic arteriopathy due to congenital heart disease. J Pathol. 2000;191:202-207. 28. Hirose S, Hosoda Y, Furuya S, Otsuki T, Ikeda E. Expression of vascular endothelial growth factor and its receptors correlates closely with formation of the plexiform lesion in human pulmonary hypertension. Pathol Int. 2000;50:472-479. 29. Le Cras TD, Markham NE, Tuder RM, Voelkel NF, Abman SH. Treatment of newborn rats with a VEGF receptor inhibitor causes pulmonary hypertension and abnormal lung structure. Am J Physiol Lung Cell Mol Physiol. 2002;283:L555-L562. 30. Grover TR, Parker TA, Markham NE, Abman SH. rhVEGF treatment preserves pulmonary vascular reactivity and structure in an experimental model of pulmonary hypertension in fetal sheep. Am J Physiol Lung Cell Mol Physiol. 2005;289:L315-L321. 31. Grover TR, Parker TA, Abman SH. Vascular endothelial growth factor improves pulmonary vascular reactivity and structure in an experimental model of chronic pulmonary hypertension in fetal sheep. Chest. 2005;128:614S. 32. Gong F, Tang H, Lin Y, Gu W, Wang W, Kang M. Gene transfer of vascular endothelial growth factor reduces bleomycin-induced pulmonary hypertension in immature rabbits. Pediatr Int. 2005;47:242-247. 33. Partovian C, Adnot S, Raffestin B, Louzier V, Levame M, Mavier IM, Lemarchand P, Eddahibi S. Adenovirus-mediated lung vascular endothelial growth factor overexpression protects against hypoxic pulmonary hypertension in rats. Am J Respir Cell Mol Biol. 2000;23:762-771. 34. Campbell AI, Zhao Y, Sandhu R, Stewart DJ. Cell-based gene transfer of vascular endothelial growth factor attenuates monocrotaline-induced pulmonary hypertension. Circulation. 2001;104:2242-2248. 35. Kertesz N, Wu J, Chen TH, Sucov HM, Wu H. The role of erythropoietin in regulating angiogenesis. Dev Biol. 2004;276:101-110. 36. Galeano M, Altavilla D, Bitto A, Minutoli L, Calo M, Lo Cascio P, Polito F, Giugliano G, Squadrito G, Mioni C, Giuliani D, Venuti FS, Squadrito F. Recombinant human erythropoietin improves angiogenesis and wound healing in experimental burn wounds. Crit Care Med. 2006;34:11391146. 37. Wang L, Zhang Z, Wang Y, Zhang R, Chopp M. Treatment of stroke with erythropoietin enhances neurogenesis and angiogenesis and improves neurological function in rats. Stroke. 2004;35:17321737. 38. Hiratsuka S, Minowa O, Kuno J, Noda T, Shibuya M. Flt-1 lacking the tyrosine kinase domain is sufficient for normal development and angiogenesis in mice. Proc Natl Acad Sci U S A. 1998;95:9349-9354.

178

39. Fong GH, Rossant J, Gertsenstein M, Breitman ML. Role of the Flt-1 receptor tyrosine kinase in regulating the assembly of vascular endothelium. Nature. 1995;376:66-70. 40. Shalaby F, Rossant J, Yamaguchi TP, Gertsenstein M, Wu XF, Breitman ML, Schuh AC. Failure of blood-island formation and vasculogenesis in Flk-1-deficient mice. Nature. 1995;376:62-66. 41. Amann K, Buzello M, Simonaviciene A, Miltenberger-Miltenyi G, Koch A, Nabokov A, Gross ML, Gless B, Mall G, Ritz E. Capillary/myocyte mismatch in the heart in renal failure-a role for erythropoietin? Nephrol Dial Transplant. 2000;15:964-969. 42. Bahlmann FH, De Groot K, Spandau JM, Landry AL, Hertel B, Duckert T, Boehm SM, Menne J, Haller H, Fliser D. Erythropoietin regulates endothelial progenitor cells. Blood. 2004;103:921-926. 43. Zheng W, Brown MD, Brock TA, Bjercke RJ, Tomanek RJ. Bradycardia-induced coronary angiogenesis is dependent on vascular endothelial growth factor. Circ Res. 1999;85:192-198. 44. Herron TJ, McDonald KS. Small amounts of alpha-myosin heavy chain isoform expression significantly increase power output of rat cardiac myocyte fragments. Circ Res. 2002;90:11501152. 45. Petit RD, Warburton RR, Ou LC, Brinck-Johnson T, Hill NS. Exogenous erythropoietin fails to augment hypoxic pulmonary hypertension in rats. Respir Physiol. 1993;91:271-282. Chapter 9 Erythropoietin improves advanced pulmonary vascular remodeling in a rat model

179

Chapter 10 General discussion and summary

Patients with congenital heart defects and increased pulmonary blood flow are at risk to develop pulmonary arterial hypertension (PAH). This is a proliferative pulmonary vascular disease, in which inward remodeling of the pulmonary vasculature increases pulmonary vascular resistance. If pulmonary arterial hypertension is left untreated, vascular remodeling gets irreversible and progresses even after closure of the original cardiac defect. The resulting increased right ventricular workload leads to right ventricular hypertrophy and failure. PAH carries a poor prognosis 1 and is an important cause of morbidity and mortality in patients with congenital heart defects 2-4. No curative treatment strategy for pulmonary arterial hypertension exists so far. Theoretically, treatment strategies can be aimed at achieving different goals. Dilating the pulmonary vasculature helps to reduce pulmonary vascular resistance and thereby right ventricular afterload. Diminishing or regressing right ventricular remodeling is another optional treatment strategy. Right ventricular remodeling in increased loading conditions involves hypertrophy of cardiomyocytes, decreased oxygen availability and increased fibrosis, leading to a malfunctioning myocardium 5. Therapeutic strategies aimed at improving right ventricular function and preferably also reducing remodeling could contribute to survival. Although much experience had been gained in the field of the treatment of left ventricular function and reduction of left ventricular remodeling, translation to the right ventricle is not straightforward, as the ventricles differ in function, shape and composition. Finally, strategies aimed at the reversal of pulmonary vascular remodeling, targeting the basis of the disease, will probably be most beneficial. In order to develop effective treatment strategies, knowledge of pathophysiological alterations contributing to the development of pulmonary vascular remodeling in PAH is mandatory. A better understanding of the molecular and cellular events contributing to pulmonary vascular and right ventricular remodeling would help designing appropriate treatment modalities able to slow, arrest or preferentially reverse this condition. Pulmonary vasoconstriction, thrombosis, inflammation and proliferation are the key pathofysiologic components in the pulmonary vascular remodeling process. In patients, increased expression of vasoconstrictive, pro-inflammatory, thrombotic and pro-proliferative agents as endothelin, serotonin and thromboxane has been demonstrated. Concurrently, the formation of vasodilating, antithrombotic, anti-inflammatory and anti-proliferative agents is decreased (for review see 6;7). Recently, new treatment options have emerged. Epoprostenol is an analogue of the vasodilator prostacyclin, that has to be administered intravenously. Bosentan is a blocker of the receptors for the vasoconstrictor endothelin. Furthermore, sildenafil, a phosphodiesterase-inhibitor, has been registered for use in PAH. Phosphodiesterase is involved in the breakdown of the second messenger cGMP, which causes vasodilatation downstream in the NO-signaling cascade. Newer drugs are awaiting registration. Examples of these drugs are sitaxsentan, a selective endothelin receptor antagonist, and treprostinil and beraprost, prostacyclin analogues suitable for other modes of delivery. Although these treatment options have proven to be effective in PAH, none of these drugs is able to cure the disease 8. 182


183

Chapter 10

Characterization and follow-up of patients The group of patients with congenital heart defects and associated PAH is very heterogeneous, since many different heart defects, with associated varieties in hemodynamics, can lead to the occurrence of the disease. This heterogeneity complicates the standardization of research and treatment protocols. On the Second World Symposium on Pulmonary Arterial Hypertension in 1998, the symptom pulmonary hypertension, defined as a mean pulmonary arterial pressure of more than 25 mmHg at rest or 30 mmHg during exercise, was grouped into five different classes, according to aetiology. PAH is the first of these five classes, which separates itself from the other groups by the occurrence of a specific histopathological pattern, plexogenic arteriopathy, which is exclusively seen in patients with PAH. Besides congenital heart defects, other conditions in which PAH occurs are collagen vascular diseases, HIV infection and portal hypertension. Additionally, PAH can occur idiopathically. Further subclassification of the heterogenous group of patients with PAH and congenital heart disease is required to be able to describe an individual patient and to define all characteristics of a patient that are of importance for diagnosis, prognosis and therapy. By accurately designing and implementing such a subclassfication, the design, execution and interpretation of clinical studies could be performed in a more effective way. In chapter 2 of this thesis, characteristics of such a classification are proposed based on type of the defect, dimensions of the defect, the direction of the shunt, whether it is a pre-tricuspid or post-tricuspid lesion, whether the lesion is restrictive or not, whether the lesion is corrected or not and whether additional extracardiac abnormalities are present. It should be realized that the majority of therapeutic clinical trials in PAH are performed in patients with idiopathic PAH, or in a mixture of patients with PAH due to different origins. The beneficial effects of therapies in idiopathic PAH, however, can not be automatically translated to patients with PAH associated with congenital cardiac lesions, because of differences in the evolution of the pulmonary vascular disease, in circulatory pathofysiology, the variability of prognosis and the difference in consequences of vasodilating therapy. Although the effects of prostacyclin analogues, endothelin receptor antagonists and phosphodiesterase inhibitors are not as extensively studied in patients with congenital heart disease, the available results do show effectiveness of these new treatments in this population as well. In adult therapeutic trials in PAH, functional parameters and hemodynamic variables are the cornerstones in characterizing disease progression. Unfortunately, these variables have their limitations in pediatric patients. In order to obtain right ventricular hemodynamic data, cardiac catheterization under general anesthesia needs to be performed, which is hazardous in these children. Exercise testing in young children is motivation dependent and not feasible in the very young. Thus, there is a need for appropriate, easily obtainable markers that are related to know prognostic factors as right atrial pressure, right ventricular pressure, pulmonary vascular resistance and to mortality itself. In chapter 3, serum markers that have been validated in adult patients with pulmonary hypertension are evaluated in our pediatric patient population. In 30 patients, N-terminal pro-BNP, uric acid, norepinephrine and epinephrine are re-

lated to invasively obtained hemodynamic parameters, to functional exercise testing when available and to mortality. In this patient population, ranging in age from 1 month to 17 years old, both serum levels of NT-proBNP and of norepinephine were sensitive and specific predictors of mortality. The level of NT-proBNP was further correlated with the amount of meters patients were able to walk within six minutes and with the functional classification of patients with PAH as defined by the world health organisation. Further, a relation was found between uric acid and the hemodynamic variables mean pulmonary arterial pressure, pulmonary vascular resistance and cardiac index. Finally, NT-proBNP levels decreased after initiation of treatment. These results provide convincing arguments to implement serum screening for NTproBNP, norepinephine and uric acid in the standard follow-up of pediatric patients with PAH. In our study, serum marker levels were obtained both from treated and untreated patients, either with the idiopathic form of PAH or with PAH due to an underlying congenital heart defect. It is conceivable that a separate analysis would lead to even more sensitive cut-off values in predicting adverse outcome. Moreover, it would be interesting to explore whether different treatment options have different effects on serum marker levels and to what extent the response of serum levels to treatment initiation is related to the improvement of outcome parameters. The development of a suitable animal model The presence of increased pulmonary blood flow distinguishes patients with PAH and congenital heart defects from those with another form of PAH. Increased pulmonary blood flow inflicts increased shear stress upon the pulmonary vascular endothelium, which leads to the activation of a cascade of remodeling events 9. Indeed, patients with a cardiac defect causing a solitary increase in pulmonary pressure rarely display severe pulmonary vascular remodeling, while pulmonary vessel disease is most often noted in those cardiac patients that have high pulmonary arterial pressures with a concomitant increase in pulmonary blood flow. Patients with an exclusively increased pulmonary blood flow, as occurs for example in the presence of an atrial septal defect, develop pulmonary hypertension at a significantly slower pace. This has led to the hypothesis that increased pulmonary blood flow is a prerequisite in the signaling cascade leading to the activation of inappropriately dividing cells. Our aim was to employ an animal model in which the pulmonary vascular bed was exposed to increased pulmonary blood flow and that displayed the advanced pulmonary vascular remodeling that is seen in patients with PAH. Therefore, we chose to combine the monocrotaline rat model, a classical rat model for increased pulmonary arterial pressure, with an abdominal aortocaval shunt to increase pulmonary blood flow. In chapter 4 of this thesis, the effects of a sole increase in pulmonary flow induced by an abdominal aortocaval shunt and a sole increase in pulmonary arterial pressure induced by monocrotaline were studied and compared to the combination model of both increased pulmonary arterial pressure and increased pulmonary blood flow. The effects of these interventions on pulmonary arterial pressure, right ventricular remodeling, right ventricular failure and pulmonary vascular remodeling were studied in this chapter, while the effects of increased pulmonary blood flow on a molecular level are described in chapter 5. Intra-acinar 184

185


Effects of pharmacological intervention The rat model for flow-associated PAH as described above was used to evaluate the therapeutic mechanism in flow-associated pulmonary arterial hypertension of known effective treatment strategies. Prostacyclin administration has proven to be a successful treatment in flow-associated PAH 11. However, its mechanism of action has not been studied in this condition. Further, we hypothesized that decreasing concentrations of the vasoconstrictor thromboxane by the administration of aspirin would lead to similar benefical effects as the administration of the vasodilator

Chapter 10

pulmonary vessel remodeling and occlusion occurred to a similar extent in shunted and non-shunted monocrotaline-treated rats. However, at similar pulmonary arterial pressures, rats that both had an increase in pulmonary arterial pressure and in pulmonary blood flow displayed higher mortality, higher pulmonary-to-systemic arterial pressure ratios, and more pronounced right ventricular hypertrophy compared to non-shunted monocrotaline-treated rats. Rats that only had increased pulmonary blood flow did not display significant alterations in pulmonary arterial pressures, in pulmonary vascular remodeling or in right ventricular hypertrophy. The effects of additional flow and its consequent increase in shear stress a molecular level were determined employing a microarray set-up. This technique allows studying and comparing the expression of over 25 thousand genes in one experiment. Increased pulmonary blood flow specifically led to increased expression of activating transcription factor 3 (ATF3) and early growth response protein 1 (Egr-1). Both are transcription factors which activation contributes to vascular and cardiac dysfunction. Interestingly, it has been shown that the promoter of the bone morphogenetic protein type 2 receptor, a receptor in which mutations are described in patients with PAH, contains Egr-1 binding sites 10. The Wnt family contributes to lung development and to a variety of pulmonary pathological processes, including pulmonary inflammation and proliferation. In our study, we found several components of the Wnt system to be changed. Frizzled related protein B (FrzB), an inhibitor of Wnt-signaling, was increased in the rats that received monocrotaline and a shunt. Carboxypeptidase Z, a stimulator of Wnt-signaling was increased in the monocrotaline-treated rats, while it decreased when increased pulmonary blood flow was added. Furthermore, increased expression of mast cell markers was demonstrated after the administration of monocrotaline. Activated mast cells are presumed to contribute to vessel remodeling by the release of specific serine proteases from their granules. Thus, both monocrotaline and increased pulmonary blood flow caused changes in pulmonary gene expression that could conceivably contribute to the pathogenesis of PAH in humans. In conclusion, the combination of monocrotaline and an abdominal aortocaval shunt in the rat leads to the creation of a model in which the pulmonary vascular bed is exposed to shear stress similarly as in patients with congenital heart defects and in which advanced pulmonary vascular lesions comparable to those in plexogenic arteriopathy are present. The detailed study of molecular biological alterations in this model provides additional information on pathways possibly involved in the pathogenesis of flow-associated PAH.

prostacyclin. Pulmonary hypertensive rats were either treated with low-dose aspirin, known to inhibit thromboxane formation, or with the prostacyclin analogue iloprost, as described in chapter 6. As expected, both interventions diminished the incidence of dyspnea and pleural fluid. To our surprise, however, these effects were not accompanied by obvious alterations in pulmonary vascular remodeling, as has been reported in a limited amount of experimental studies, but rather with an improvement in right ventricular capillarisation. At a molecular level, iloprost treatment increased the expression of several genes from the Wnt-signaling pathway. The net effect of these regulations is difficult to determine, since the upregulation involved both stimulators and inhibitors of Wnt signaling. Additionally, mast cell number was diminished after iloprost administration. These are interesting new therapeutic mechanisms, which deserve further exploration. A disadvantage of iloprost administration is its short half-life. Treprostinil is a prostacyclin analogue with a longer half-life, suitable for subcutaneous administration. Its effects on pulmonary hemodynamics and pulmonary vascular remodeling are presented in chapter 7. Treprostinil decreased mean pulmonary arterial pressure, but as in treatment with iloprost, this was not associated with reversed structural remodeling of the pulmonary vasculature, suggesting possible effects on myocardial contractility or vascular capacitance, rather than structural effects. Endothelin-receptor antagonism has also recently been discovered to be effective in the treatment of PAH in patients with congenital heart defects, or more specifically, Eisenmenger syndrome 12. Chapter 8 describes the effects of dual endothelin receptor antagonism, blocking both the endothelin-A receptor and the endothelin-B receptor, in flow-associated PAH. Pulmonary vascular remodeling was significantly diminished by dual receptor blockade in this model with advanced pulmonary vascular lesions. At the same time, bosentan decreased pulmonary arterial pressure and right ventricular hypertrophy and improved right ventricular contractility. This was accompanied by increased myocardial capillarisation. This could be due to direct inhibition of the myocardial endothelin system. On the other hand, it is also possible that improved myocardial performance is the consequence of a diminished afterload. Finally, bosentan treatment resulted in an increased endothelin-A to endothelin-B receptor expression ratio both in pulmonary and in right ventricular tissue. This can possibly be regarded as a contra-regulatory effect, since bosentan has a somewhat higher affinity for the endothelin-A receptor than for the endothelin-B receptor. Recent clinical study findings are interesting in that respect 13. It was shown that endothelin-receptor antagonists are improving peak oxygen consumption and exercise duration at treadmill test, and walking distance and Borg dyspnoea index at a 6-minute walking test 4 months after the initiation of treatment, while all exercise parameters appeared to return to their baseline values at 2 years of follow-up. Speculating, altered endothelin receptor expression might play a role in this. Further, it raises the question if altered endothelin-A to endothelin-B receptor expression changes outcome in patients who discontinue the drug. Since endothelin receptor signaling of A and B type receptors involves interreceptor cross-talk, receptor heterodimerization, 186

Future therapeutic perspectives Since there is no curative treatment for PAH, it is mandatory to look for further therapeutic options. Microarray experiments in this thesis provided several clues for such pathways. Interference with the effects of the transcription factor Egr-1 might antagonize some of the effects of increased shear stress. Further, mast cell inflammation is apparently important in pulmonary vascular remodeling. Fortunately, mast 187


In summary, studies with prostacyclin analogues in our rat model for flow-associated PAH showed improvement of survival and hemodynamics, without obvious effects on pulmonary vascular remodeling. Interestingly, effects on cardiac remodeling of both intervention with iloprost and aspirin were described, most probably caused either by direct modulation of myocardial angiogenesis, or secondary by improving right ventricular loading conditions. Modulation of pulmonary vascular proliferating cells seems of less importance in prostacyclin therapy. In contrast, treatment with either erythropoietin or with an endothelin receptor antagonist reduced pulmonary vascular occlusion, either by causing regression of already present lesions or by preventing the formation of new proliferations. Additionally, bosentan treatment was shown to improve right ventricular functioning and remodeling.

Chapter 10

desensitization, and a dual role for endothelin-B receptor signaling, mRNA expression levels alone do not provide sufficient information to draw conclusions on clinical relevance. Nevertheless, these findings stress the need for studies on localization and function of endothelin receptors in order to better comprehend the effects of endothelin receptor antagonism in patients. In chapter 9 of this thesis, a new treatment modality was explored. Erythropoietin (EPO) is a hypoxia-induced hormone that leads to the proliferation and differentiation of erythroid precursor cells. Besides that, erythropoietin possesses cytoprotective and pro-angiogenic properties. Therefore, EPO is currently being investigated for its role in ischemic left ventricular failure. Interestingly, increased EPO production appears to protect against the development of hypoxic pulmonary hypertension 14, while absent EPO signaling had accelerated the development of the disease 15. Therefore, we studied the effects of erythropoietin in flow-associated PAH. Intriguingly, EPO increased right ventricular capillary density and decreased pulmonary vascular occlusion. However, these effects were not accompanied by significant alteration in pulmonary hemodynamics. Theoretically, different mechanisms could mediate the effects of EPO. These deserve further investigation. First, endothelial progenitor cells that are mobilized from the bone marrow by EPO administration could incorporate into the neo-endothelium, facilitating endothelial repair 16. Secondly, it has been suggested that the anti-oxidant and anti-apoptotic effects of EPO are linked with the activation of heme oxygenase-1 (HO-1) 17. HO-1 is an inducible enzyme with potent anti-oxidant and anti-apoptotic activities. Decreased expression of HO-1 has been shown in human pulmonary hypertension 18, whereas increasing HO-1 in the experimental situation is beneficial 19;20.

cell inhibitors are readily available for testing. Also, interference in the Wnt signaling cascade may reverse the progression of PAH. However, this system is more complex, and developing pharmacological modalities to influence it will be more challenging. This study provides interesting clues for further therapeutic directions. In patients, small studies have been performed evaluating the additive effect of combining treatment regimes. Addition of sildenafil in patients already treated with bosentan improved 6-minute walking distance 21. Further, the combination of inhaled iloprost therapy with oral sildenafil was more effective in reducing pulmonary vascular resistance than either of the drugs alone 22;23. The combination of treatment regimes needs to be further explored in order to optimize therapy of the individual patient facing this still catastrophic disease. Our study results indicate that by combining the effects of drugs with effects on cardiac function with a drug with mainly pulmonary vascular anti-remodeling properties, a more beneficial effect might be achieved. Conclusions In pediatric PAH, serum screening for NT-proBNP, norepinephine and uric acid provides additional information on hemodynamics, exercise tolerance and prognosis. In the future, the use of serum markers might partially replace more invasive determinants to evaluate the status of the individual patient. By combining monocrotaline injections with increased pulmonary blood flow a rat model was created in which the pulmonary vascular bed is exposed to shear stress similarly as in patients with congenital heart defects and in which advanced pulmonary vascular lesions comparable to those in plexogenic arteriopathy are present. Microarray analysis provided new pathways possibly involved in the pathogenesis of flow-associated PAH. Intervention with prostacyclin analogues or thromboxane inhibition in this rat model for flow-associated PAH showed improvement of survival, hemodynamics and cardiac remodeling, without obvious effects on pulmonary vascular remodeling. On the contrary, treatment with either erythropoietin or with the endothelin receptor antagonist bosentan reduced pulmonary vascular occlusion. Additionallly, bosentan treatment was shown to improve right ventricular functioning and remodeling. Finally, several new possible pathways for intervention are suggested in this thesis. Further experiments are needed to study these new therapeutic targets.

188

References

2.

Steele PM, Fuster V, Cohen M, Ritter DG, McGoon DC. Isolated atrial septal defect with pulmonary vascular obstructive disease-long-term follow-up and prediction of outcome after surgical correction. Circulation. 1987;76:1037-1042.

3.


4.


5.

Chin KM, Kim NH, Rubin LJ. The right ventricle in pulmonary hypertension. Coron Artery Dis. 2005;16:13-18.

6.

Humbert M, Morrell NW, Archer SL, Stenmark KR, MacLean MR, Lang IM, Christman BW, Weir EK, Eickelberg O, Voelkel NF, Rabinovitch M. Cellular and molecular pathobiology of pulmonary arterial hypertension. J Am Coll Cardiol. 2004;43:13S-24S.

7.

McLaughlin VV, McGoon MD. Pulmonary arterial hypertension. Circulation. 2006;114:1417-1431.

8.

Humbert M, Sitbon O, Simonneau G. Treatment of pulmonary arterial hypertension. N Engl J Med. 2004;351:1425-1436.

9.

Davies PF. Flow-mediated endothelial mechanotransduction. Physiol Rev. 1995;75:519-560.

10. Hu H, Sung A, Zhao G, Shi L, Qiu D, Nishimura T, Kao PN. Simvastatin enhances bone morphogenetic protein receptor type II expression. Biochem Biophys Res Commun. 2006;339:59-64. 11. Rosenzweig EB, Kerstein D, Barst RJ. Long-term prostacyclin for pulmonary hypertension with associated congenital heart defects. Circulation. 1999;99:1858-1865. 12. Galie N, Beghetti M, Gatzoulis MA, Granton J, Berger RM, Lauer A, Chiossi E, Landzberg M. Bosentan therapy in patients with Eisenmenger syndrome: a multicenter, double-blind, randomized, placebo-controlled study. Circulation. 2006;114:48-54. 13. Apostolopoulou SC, Manginas A, Cokkinos DV, Rammos S. Long-term oral bosentan treatment in patients with pulmonary arterial hypertension related to congenital heart disease: a 2-year study. Heart. 2007;93:350-354. 14. Weissmann N, Manz D, Buchspies D, Keller S, Mehling T, Voswinckel R, Quanz K, Ghofrani HA, Schermuly RT, Fink L, Seeger W, Gassmann M, Grimminger F. Congenital erythropoietin overexpression causes “anti-pulmonary hypertensive” structural and functional changes in mice, both

189


McLaughlin VV, Presberg KW, Doyle RL, Abman SH, McCrory DC, Fortin T, Ahearn G. Prognosis of pulmonary arterial hypertension: ACCP evidence-based clinical practice guidelines. Chest. 2004;126:78S-92S.

Chapter 10

1.

in normoxia and hypoxia. Thromb Haemost. 2005;94:630-638. 15. Satoh K, Kagaya Y, Nakano M, Ito Y, Ohta J, Tada H, Karibe A, Minegishi N, Suzuki N, Yamamoto M, Ono M, Watanabe J, Shirato K, Ishii N, Sugamura K, Shimokawa H. Important role of endogenous erythropoietin system in recruitment of endothelial progenitor cells in hypoxia-induced pulmonary hypertension in mice. Circulation. 2006;113:1442-1450. 16. Zhao YD, Courtman DW, Deng Y, Kugathasan L, Zhang Q, Stewart DJ. Rescue of monocrotalineinduced pulmonary arterial hypertension using bone marrow-derived endothelial-like progenitor cells: efficacy of combined cell and eNOS gene therapy in established disease. Circ Res. 2005;96:442-450. 17. Calo LA, Davis PA, Piccoli A, Pessina AC. A role for heme oxygenase-1 in the antioxidant and antiapoptotic effects of erythropoietin: the start of a good news/bad news story? Nephron Physiol. 2006;103:107-111. 18. Achcar RO, Demura Y, Rai PR, Taraseviciene-Stewart L, Kasper M, Voelkel NF, Cool CD. Loss of caveolin and heme oxygenase expression in severe pulmonary hypertension. Chest. 2006;129:696705. 19. Goto J, Ishikawa K, Kawamura K, Watanabe Y, Matumoto H, Sugawara D, Maruyama Y. Heme oxygenase-1 reduces murine monocrotaline-induced pulmonary inflammatory responses and resultant right ventricular overload. Antioxid Redox Signal. 2002;4:563-568. 20. Zhou H, Liu H, Porvasnik SL, Terada N, Agarwal A, Cheng Y, Visner GA. Heme oxygenase-1 mediates the protective effects of rapamycin in monocrotaline-induced pulmonary hypertension. Lab Invest. 2006;86:62-71. 21. Hoeper MM, Faulenbach C, Golpon H, Winkler J, Welte T, Niedermeyer J. Combination therapy with bosentan and sildenafil in idiopathic pulmonary arterial hypertension. Eur Respir J. 2004;24:1007-1010. 22. Ghofrani HA, Wiedemann R, Rose F, Olschewski H, Schermuly RT, Weissmann N, Seeger W, Grimminger F. Combination therapy with oral sildenafil and inhaled iloprost for severe pulmonary hypertension. Ann Intern Med. 2002;136:515-522. 23. Wilkens H, Guth A, Konig J, Forestier N, Cremers B, Hennen B, Bohm M, Sybrecht GW. Effect of inhaled iloprost plus oral sildenafil in patients with primary pulmonary hypertension. Circulation. 2001;104:1218-1222.

190


Aangeboren hartafwijkingen zijn de meest voorkomende aangeboren afwijkingen. In Nederland worden elk jaar ongeveer 1500 patiënten met een hartafwijking geboren. Patiënten die een hartafwijking hebben die gepaard gaat met een toegenomen longcirculatie lopen het risico om pulmonale arteriële hypertensie (PAH) te ontwikkelen. Dit is een vasoproliferatieve ziekte waarbij er door remodellering van de longvaten een toename van de longvaatweerstand optreedt. Het is een irreversibele aandoening met een slechte prognose, die ook voortschrijdt na chirurgische correctie van de hartafwijking. PAH is een belangrijke oorzaak van de morbiditeit en mortaliteit bij patiënten met een aangeboren hartafwijking. Als gevolg van de toegenomen belasting van de rechterkamer ontstaat rechter ventrikelhypertrofie en uiteindelijk ook falen van de rechterventrikel. Er bestaan nog geen behandelingsmogelijkheden voor PAH. In theorie zou men verschillende behandeldoelen kunnen nastreven. Een reductie van de pulmonale vaatweerstand zou helpen de afterload van de rechterventrikel te reduceren. Tevens zou het beïnvloeden van de rechterventrikel adaptatie gunstig kunnen zijn. Onder omstandigheden waarin de rechterventrikel wordt belast, hypertrofiëren de cardiomyocyten, waarbij er een verminderde beschikbaarheid van zuurstof ontstaat en fibrose optreedt. Deze veranderingen leiden op den duur tot een slecht functionerend myocard. Derhalve zouden gunstige effecten verwacht kunnen worden van therapieën die de remodellering van de rechterventrikel beïnvloeden. Hoewel er veel ervaring bestaat met het behandelen van aandoeningen die gepaard gaan met falen van de linkerventrikel en met reductie van de remodellering van de linkerventrikel, is het niet mogelijk deze kennis direct toe te passen bij aandoeningen gepaard gaande met rechter ventrikelfalen aangezien de ventrikels verschillen in functie, vorm en samenstelling. Therapeutische strategieën die zich richten op het terugdringen van de celproliferatie in de longvaten zelf zullen naar verwachting het meest effectief zijn bij de behandeling van PAH. Om succesvolle behandelingen te ontwikkelen is kennis van de pathofysiologische veranderingen die bijdragen tot het ontstaan van de longvaatremodellering en de rechter ventrikelhypertrofie essentieel. Dit zou kunnen leiden tot de ontwikkeling van therapieën die deze progressieve aandoening kunnen vertragen, stoppen of zelfs genezen. De belangrijkste pathologische processen die optreden in PAH zijn pulmonale vasoconstrictie, trombose, inflammatie en proliferatie. In patiënten met PAH wordt een toegenomen expressie van vasoconstrictieve, pro-inflammatoire, pro-trombotische en proliferatieve stoffen zoals endotheline, serotonine en thromboxaan gevonden, terwijl de vorming van vasodilaterende, anti-trombotische en anti-proliferatieve stoffen is afgenomen. De afgelopen decennia zijn er nieuwe behandelingsvormen voor PAH ontdekt. Epoprostenol, een analoog van de vaatverwijdende stof prostacycline, wordt succesvol toegepast bij de behandeling van patiënten met PAH. Bosentan is een endotheline-receptor blocker die geregistreerd is voor de behandeling van PAH. Ook sildenafil, een blocker van het enzym fosfodiësterase, is recent geregistreerd. Het enzym fosfodiësterase is betrokken bij de afbraak van cyclisch GMP (cGMP). cGMP zorgt normaal gesproken voor vasodilatatie. Alhoewel deze therapieën ef194

fectief zijn, bestaat er tot nu toe helaas geen behandeling die de ziekte kan genezen.

195


Karakterisering van patiënten Patiënten die een aangeboren hartafwijking hebben gepaard gaande met PAH vormen een heterogene groep. Dit komt omdat veel verschillende hartafwijkingen, met de daarmee geassocieerde variatie in hemodynamiek, tot het ontstaan van de ziekte kunnen leiden. Deze heterogeniteit bemoeilijkt de standaardisatie van onderzoek en behandelingsprotocollen. Op het Tweede Wereldsymposium over pulmonale hypertensie in 1998, werd het symptoom pulmonale hypertensie gedefinieerd als een pulmonale arteriële druk van meer dan 25 mmHg in rust of meer dan 30 mmHg tijdens inspanning. Pulmonale hypertensie wordt gegroepeerd in vijf verschillende categorieën, afhankelijk van de oorzaak. PAH vormt de eerste van deze vijf categorieën. De eerste categorie onderscheidt zich van de andere categorieën door een kenmerkend histologisch beeld, de zogenaamde plexogene arteriopathie. Dit beeld wordt alleen gezien in patiënten met PAH. Behalve bij patiënten met aangeboren hartafwijkingen wordt PAH ook gezien bij mensen met andere aandoeningen, zoals collageenziekten, HIV infecties en portale hypertensie. Tevens komt PAH idiopathisch voor. Om de kenmerken van een patiënt met PAH en een congenitale hartafwijking die van belang zijn voor diagnose, therapie en behandeling goed te kunnen beschrijven, is een verdere onderverdeling van deze heterogene groep noodzakelijk. Door een dergelijke subclassificatie kunnen ook het ontwerp, de uitvoering en de interpretatie van klinische studies effectiever plaatsvinden. In hoofdstuk 2 van dit proefschrift worden de kenmerken van een dergelijke classificatie geschetst, gebaseerd op het type defect, de afmetingen van het defect, de richting van de shunt, of het een pre-tricuspide of een post-tricuspide shunt is, of de laesie restrictief is of niet, of de laesie gecorrigeerd is of niet en of er verdere extracardiale afwijkingen aanwezig zijn. Overigens wordt het merendeel van de klinische trials betreffende PAH gedaan bij patiënten met idiopathische PAH of in een gemengde populatie van patiënten met PAH op basis van diverse oorzaken. De gunstige therapeutische effecten beschreven in idiopathische PAH kunnen echter niet automatisch vertaald worden naar patiënten met PAH gecombineerd met een congenitale hartafwijking, aangezien de ontstaanswijze van de pulmonale vaatafwijkingen, de circulatoire fysiologie, de prognose en de effecten van vasodilaterende interventies verschillen. Hoewel de effecten van prostacycline analogen, van endotheline-receptor antagonisten en van fosfodiësterase-remmers niet zo uitgebreid bestudeerd zijn bij patiënten met PAH en een congenitale hartafwijking, lijkt er wel een zekere effectiviteit van deze interventies te zijn. In studies bij volwassenen met PAH zijn functionele parameters en hemodynamische variabelen uitkomstmaten die vaak worden gebruikt. Helaas kennen deze uitkomstmaten hun beperkingen bij kinderen. Een rechter hartkatheterisatie om pulmonale arteriële drukken te verkrijgen dient altijd onder algehele anesthesie te gebeuren, met alle nadelen van dien. Functionele testen zoals inspanningstes-

ten zijn afhankelijk van motivatie en zijn onbruikbaar bij de jongere kinderen. Derhalve is er behoefte aan geschikte, makkelijk te verkrijgen parameters die gerelateerd zijn aan bekende prognostische factoren zoals rechter atriumdruk, rechter ventrikeldruk, pulmonale vaatweerstand en aan mortaliteit zelf. In hoofdstuk 3 worden merkstoffen, gemeten in het bloed, die gevalideerd zijn in een volwassen patiëntenpopulatie, geëvalueerd voor hun bruikbaarheid in een pediatrische patiëntenpoputatie met PAH. Bij 30 patiënten werden het serum N-terminal pro-brain natriuretisch peptide (NT-proBNP), het urinezuur en de noradrenaline en adrenaline spiegels gerelateerd aan invasieve hemodynamische gegevens, aan functionele inspanningstesten en aan mortaliteit. In deze patiëntenpopulatie, in leeftijd variërend van 1 maand tot 17 jaar, bleken zowel NT-proBNP als noradrenaline sensitieve en specifieke voorspellers voor mortaliteit. De NT-proBNP spiegel correleerde verder met de afstand die patiënten in zes minuten konden lopen en met de functionele classificatie volgens de World Health Organisation. Bovendien werd er een relatie gevonden tussen het urinezuur en de gemiddelde pulmonale arteriële druk, de pulmonale vaatweerstand en het geïndexeerde hartminuutvolume. Na therapeutische interventie namen de NT-proBNP spiegels af. Hieruit blijkt dat implementatie van meting van NT-proBNP, noradrenaline en urinezuur in de follow-up van kinderen met PAH een waardevolle aanvulling kan zijn. In de gepresenteerde studie werden de serumwaardes van de specifieke merkstoffen van zowel behandelde als onbehandelde patiënten gegroepeerd. Ook bestond de studiepopulatie zowel uit patiënten met idiopathische PAH als uit patiënten met PAH veroorzaakt door een onderliggende aangeboren hartafwijking. Het is goed voorstelbaar dat een gescheiden analyse nog gevoeligere afkapwaarden zou kunnen genereren. Verder zou het interessant zijn om te onderzoeken of de merkstoffen worden beïnvloed door de verschillende therapeutische interventies. De ontwikkeling van een geschikt diermodel De aanwezigheid van een toegenomen longdoorstroming onderscheidt patiënten met PAH en een aangeboren hartafwijking van diegenen met een andere vorm van PAH. Een toegenomen longdoorstroming leidt door stimulatie van het endotheel tot activatie van een cascade van gebeurtenissen met effect op de celproliferatie. Patiënten die een hartafwijking hebben die uitsluitend gepaard gaat met een hoge druk in het longvaatbed ontwikkelen zelden ernstige pulmonale vaatwandremodellering, terwijl dit juist wel wordt gezien bij patiënten met een hoge druk in het pulmonale vaatbed wanneer die gepaard gaat met een toegenomen longdoorstroming. Patiënten die een geïsoleerde toename in longvaatdoorstroming hebben, zoals bijvoorbeeld patiënten met een atrium septum defect, ontwikkelen uiteindelijk wel PAH, maar meestal pas op veel latere leeftijd. Deze waarnemingen leidden tot de hypothese dat een toegenomen longvaatdoorstroming essentieel is voor de activatie van processen die een onaangepaste celdeling in de longvaten veroorzaken. Er werd een diermodel ontwikkeld waarin het longvaatbed werd blootgesteld aan een toegenomen longdoorstroming om zo de ernstige histologische laesies 196

197


die gezien worden bij patiënten met PAH, zoals neointima vorming, te creëren. Er werd gekozen voor een combinatie van monocrotaline injecties in de rat, een klassiek model voor een toegenomen druk in de longvaten, met een abdominale aortocavale shunt om de longvaatdoorstroming te doen toenemen. In hoofdstuk 4 van dit proefschrift worden de effecten van een geïsoleerde toename in longvaatdoorstroming en een geïsoleerde toename in pulmonale arteriële druk vergeleken met een combinatiemodel waarin er een toename van zowel de longvaatdoorstroming als van de pulmonale arteriële druk bestaat. De effecten van deze verschillende modellen op de pulmonale arteriële druk, op remodellering van de rechterventrikel, op rechter hart falen en op de remodellering van de longvaten zijn in dit hoofdstuk beschreven, terwijl de effecten van deze modellen op moleculair niveau zijn beschreven in hoofdstuk 5. Occlusie van de kleine weerstandsvaatjes trad in ratten met en zonder shunt in gelijke mate op. Hoewel de pulmonale arteriële drukken in beide groepen gelijk waren, was de sterfte in ratten met de combinatie van een verhoogde druk en een verhoogde longvaatdoorstroming hoger, hadden zij hogere ratio’s tussen de pulmonale arteriële druk en de systeemdruk en hadden zij een meer uitgesproken rechterventrikel hypertrofie. Ratten die alleen een abdominale aortocavale shunt hadden, ontwikkelden geen significante veranderingen in pulmonale arteriële druk, in remodellering van de pulmonaalvaten of in rechter ventrikelhypertrofie ten opzichte van gezonde controleratten. De effecten van een toegenomen longvaatdoorstroming op moleculair niveau werden geëvalueerd met behulp van een microarray. Deze techniek maakt de gelijktijdige bestudering van de expressie van meer dan 25 duizend genen mogelijk. In ons diermodel voor flow-geassocieerde PAH veroorzaakte een toegenomen longvaatdoorstroming een toename in de expressie van activating transcription factor 3 (ATF3) en early growth response protein 1 (Egr-1). Dit zijn beide transcriptiefactoren die bij activatie bijdragen aan disfunctie van hart en vaten. Interessant genoeg bevat de promotor van de bone morphogenetic protein type 2 receptor, een receptor waarin bij patiënten mutaties zijn beschreven, Egr-1 bindingsplaatsen. De Wnt familie speelt een rol in de ontwikkeling van de long alsook in verschillende pathologische processen, zoals inflammatie en proliferatie. In onze studie vonden we veranderingen in de expressie van verschillende componenten van het Wnt systeem. Frizzled related protein B (FrzB), een remmer van de Wnt-signaling, was verhoogd in ratten die zowel monocrotaline als een shunt hadden gekregen. Carboxypeptidase Z, een stimulator van de Wnt-signaling, was verhoogd in ratten die behandeld waren met monocrotaline. In ratten die zowel monocrotaline als een shunt hadden gekregen, was carboxypeptidase Z juist afgenomen. Na toediening van monocrotaline werd tevens een verhoogde expressie van mestcelmarkers gevonden. Geactiveerde mestcellen zouden een rol kunnen spelen in vaatremodellering door het vrijmaken van specifieke proteases uit hun granules. Inderdaad vonden we in de longen van ratten behandeld met monocrotaline, net als in patiënten, een toename van het aantal mestcellen. Concluderend leidt de combinatie van monocrotaline en een abdominale aortocavale shunt in ratten tot een model waarin het longvaatbed is blootgesteld

aan dezelfde veranderingen als die optreden in patiënten met een aangeboren hartafwijking en waarin ernstige longvaatlaesies aanwezig zijn die vergelijkbaar zijn met die van humane patiënten met plexogene arteriopathie. Zowel monocrotaline als een toegenomen longvaatdoorstroming zorgen voor veranderingen in gen-expressie die zouden kunnen bijdragen aan de pathogenese van humane PAH. Het bestuderen van veranderingen die op moleculair niveau in dit model optreden leidt tot het ontdekken van nieuwe systemen die van belang kunnen zijn in de pathogenese van flow-geassocieerde PAH. Effecten van farmacologische interventie Het bovengenoemde rattenmodel voor flow-geassocieerde PAH werd gebruikt om het werkingsmechanisme van verschillende behandelvormen te evalueren. Prostacycline is een werkzame stof bij de behandeling van flow-geassocieerde PAH. Het werkingsmechanisme van dit middel was echter nog niet onderzocht. Aangezien in de urine van patiënten met PAH de concentratie van thromboxaanmetabolieten verhoogd is, verwachtten we dat het verlagen van thromboxaanconcentraties, door het toedienen van aspirine, vergelijkbare effecten zou hebben als het toedienen van prostacycline. In hoofdstuk 6 worden de effecten van behandeling met de prostacycline-analoog iloprost vergeleken met de effecten van behandeling met aspirine. Beide interventies verminderden de incidentie van dyspneu en pleuravocht. Deze veranderingen gingen echter niet gepaard met een significante verbetering van de remodellering van de longvaten, maar wel met een verbetering van de capillarisatie van de rechterventrikel. Op moleculair niveau verhoogde de behandeling met prostacycline de expressie van verschillende genen van de Wnt-familie. Het uiteindelijke effect van deze regulatie is moeilijk te beoordelen aangezien de verhoogde expressie van deze factoren zowel stimulatoren als remmers van de Wnt signalering betrof. Verder remde iloprost toediening de proliferatie van mestcellen. Dit zijn interessante therapeutische mechanismen die verder onderzocht dienen te worden. Een nadeel van de prostacycline-analoog iloprost is zijn korte halfwaardetijd. Treprostinil is een analoog met een langere halfwaardetijd die geschikt is voor subcutane toediening. De effecten van treprostinil toediening op de pulmonale hemodynamiek en op remodellering van de longvaten werd onderzocht in hoofdstuk 7. Treprostinil zorgde voor een daling in de gemiddelde pulmonale arteriële druk. Net als bij iloprost ging deze daling niet gepaard met een veranderde remodellering van het pulmonale vaatbed, hetgeen mogelijke effecten op contractiliteit van de rechterventrikel of op vasculaire stijfheid suggereert. Antagonisme van de endotheline-receptor is een andere effectieve behandeling van patiënten met PAH en een congenitale hartafwijking. In hoofdstuk 8 worden de effecten van blokkade van het endotheline-systeem in flow-geassocieerde PAH beschreven. De remodellering van de longvaten verminderde na behandeling met bosentan, een endotheline-receptor antagonist die beide receptoren blokkeert. Tegelijkertijd zorgde toediening van bosentan voor een daling van de pulmonale arteriële druk, een afname van de rechter ventrikelhypertrofie en een verbeterde 198

Samenvattend laten de studies met prostacycline analogen in dit model voor flow-geassocieerde pulmonale arteriële hypertensie gunstige effecten op overleving en hemodynamische parameters zien, zonder duidelijke effecten op de remodellering van de longvaten. Echter, er werden wel gunstige effecten op capillarisatie van de rechterventrikel geconstateerd, die mogelijk gerelateerd zijn aan een verbeterde rechter ventrikelfunctie. Behandeling met een endotheline199


contractiliteit van de rechterventrikel. Dit ging gepaard met een toegenomen capillarisatie van de rechterventrikel. Deze toename in capillarisatie en geassocieerde verbetering van de contractiliteit zijn mogelijk een direct gevolg van de blokkade van het endotheline-systeem. Een andere optie is dat de verbeterde myocardiale functie het gevolg is van een verminderde afterload. Blokkade van het endotheline-systeem zorgde ook voor een toegenomen ratio in de expressie tussen de endotheline-A en de endotheline-B receptor. Dit zou beschouwd kunnen worden als contra-regulatie, aangezien bosentan een wat hogere affiniteit voor de A-receptor dan voor de B-receptor heeft. Deze bevindingen leiden tot de vraag of deze veranderde receptor expressie ook invloed heeft op het verdere verloop van de ziekte bij patiënten waarbij het gebruik van bosentan wordt gestopt. Aangezien de activatie van endotheline-receptoren complex is, en er bij de activatie van deze receptoren cross-talk, heterodimerisatie en desensitisatie een rol spelen, is het niet mogelijk om klinische consequenties aan deze data te verbinden. Desalniettemin illustreren deze data de noodzaak voor verder studies naar de lokalisatie en functie van de endotheline-receptoren. In het laatste hoofdstuk wordt een nieuwe behandelingsoptie bestudeerd. Erytropoietine (EPO) is een hormoon waarvan de productie wordt gestimuleerd door hypoxie. EPO stimuleert de proliferatie en differentiatie van erythroïde voorlopercellen. Bovendien bezit EPO cytoprotectieve en pro-angiogene eigenschappen. Dus werden recentelijk de effecten van de EPO-toediening op ischemisch linker ventrikelfalen onderzocht. In een diermodel voor hypoxische pulmonale hypertensie bleek een toegenomen EPO-productie bescherming te bieden tegen de ontwikkeling van de ziekte. Daarom bestudeerden we de effecten van EPO-toediening in flow-geassocieerde PAH in hoofdstuk 9. EPO veroorzaakte een toename van de capillarisatie in de rechterventrikel, en een afname van de occlusie van de longvaten. Deze veranderingen gingen echter niet gepaard met een verandering van hemodynamische variabelen. In theorie kunnen verschillende mechanismen bijdragen aan deze gunstige remodelleringseffecten van EPO. Endotheelvoorlopercellen, die uit het beenmerg worden gemobiliseerd na EPO-toediening, zouden zich in het longvaatendotheel kunnen innestelen en de reparatie van beschadigd endotheel stimuleren. Tevens is er gesuggereerd dat de anti-oxidatieve en anti-apoptotische effecten van EPO geëffectueerd worden via haem oxygenase-1 (HO-1). HO-1 is een enzym met krachtige anti-oxidatieve en anti-apoptotische effecten. In patiënten met PAH is een afgenomen expressie van HO-1 aangetoond. Tevens lijkt een inductie van HO-1 gunstige effecten te hebben in experimentele setting.

receptor blocker en met EPO daarentegen beïnvloeden de remodellering van de longvaten, hetzij door regressie van bestaande laesies te bewerkstelligen of door het voorkomen van het ontstaan van nieuwe laesies. Toediening van bosentan had bovendien ook gunstige effecten op de capillarisatie en de contractiliteit van de rechterventrikel. Toekomstperspectieven Aangezien er geen curatieve behandeling voor PAH beschikbaar is, is het noodzakelijk om nieuwe therapeutische mogelijkheden te bestuderen. Microarray experimenten, zoals beschreven in dit proefschrift, dragen bij tot het vinden van nieuwe behandelingsvormen. Kleine humane studies laten zien dat de combinatie van medicamenten mogelijk effectiever is dan de separate toediening van deze geneesmiddelen. De combinatie van medicatie met effecten op het myocard met interventies met specifieke effecten op remodellering van de longvaten dient verder onderzocht te worden. Conclusies Bij kinderen met PAH levert screening van NT-proBNP, noradrenaline en uinezuur extra informatie over hemodynamiek, inspanningstolerantie en prognose. In de toekomst zou screening van deze merkstoffen de noodzaak tot meer invasieve bepalingen overbodig kunnen maken. Door monocrotaline injecties te combineren met een toename van de longvaatdoorstroming, veroorzaakt door een abdominale aortocavale shunt, werd er een diermodel gecreëerd met ernstige pulmonale histologische afwijkingen die vergelijkbaar zijn met die van patiënten. Microarray analyse van de gen-expressie niveaus in de longen van deze dieren leverde nieuwe aanknopingspunten op voor systemen die betrokken zijn bij de pathogenese van flow-geassocieerde PAH. Deze systemen kunnen mogelijk een doel vormen voor toekomstige therapeutische interventie. Behandeling met prostacycline analogen en remming van de thromboxaan productie in dit model zorgde voor een verbeterde overleving, veranderingen in hemodynamiek en in capillarisatie van het myocard, zonder duidelijke effecten op de remodellering van de longvaten. Daar staat tegenover dat behandeling met bosentan en EPO juist effect had op de occlusie van de longvaten. Bosentan had tevens effect op de capillarisatie en functie van de rechterventrikel. Door een gebalanceerde combinatie van werkingsmechanismen te selecteren, kan de behandeling van de patiënt met flow-geassocieerde PAH worden geoptimaliseerd.

200

Dankwoord

Reizen, het is zijn hart losmaken Van het anker der kleine vaart, Om het vlot te laten geraken Op de zeeën der wereldkaart. (Bertus Aafjes, Reizen (fragment), De muze op reis, p. 7)

Hoe welomschreven een project ook is, het doen van een promotieonderzoek blijft een avontuurlijke reis waarvan je aan het begin het einddoel nog niet precies in het vizier hebt. En dat maakt het navigeren tot een lastige taak. Ontelbaar veel mensen hebben me geholpen om mijn bestemming te bereiken. Sommigen hebben aan mijn zijde gelopen, anderen hebben me de weg gewezen, weer anderen hebben me de broodnodige bagage verstrekt, of de inspiratie om door te gaan. Hen allen wil ik hierbij bedanken. Als eerste mijn promotor Rolf Berger. Beste Rolf, bedankt voor je enthousiasme voor dit project, voor je geduld in het herhalen van de fysiologielessen en voor het feit dat je me niet alleen figuurlijk maar ook letterlijk de kans hebt gegeven om veel van de wereld te zien. Mijn co-promotor Regien Schoemaker wil ik bedanken voor het onderricht in alle organisatorische en praktische zaken die gepaard gaan met het doen van onderzoek en voor de morele steun. Hoewel je de afrondingsfase van dit proefschrift van minder nabij hebt kunnen meemaken, hoop ik dat dit proefschrift ook is geworden wat jij je ervan had voorgesteld. Professor Naeije, professor Sauer en professor Van Gilst wil ik hartelijk bedanken voor de bereidheid mijn proefschrift kritisch te beoordelen. Velen zijn betrokken geweest bij het uitvoeren van de experimenten. Allereerst wil ik Martin Houwertjes bedanken voor zijn eindeloze precisie, vindingrijkheid en geduld bij het uitvoeren van de ontelbare drukregistraties. Hierbij natuurlijk ook veel dank aan Richard van Veghel voor het aanleren van de technieken. Alex Kluppel wil ik bedanken voor het geduld waarmee hij op de meest uiteenlopende vragen een antwoord wist te vinden. Azuwerus van Buiten, bedankt voor al je hulp bij het uitdenken en uitvoeren van de eerste vaatexperimenten. Ook ben ik veel dank verschuldigd aan Jochum Prop en Arjen Petersen voor hun hulp en indrukwekkende praktische vaardigheden bij het opzetten van een nieuw diermodel. Hoewel onze pogingen helaas gecompliceerd werden door technische problemen bewaar ik goede herinneringen aan deze experimenten. Bianca Meijeringh en Maaike Goris dank ik voor hun hulp met de histologische kleuringen. In dit rijtje mogen zeker Harry van Goor en Marie Geerlings niet ontbreken voor hun hulp bij het experimenteren met diversie immunohistochemische kleuringen. Overigens ben ik ook de andere medewerkers van de pathologie erkentelijk voor hun geduldige 204

uitleg, mooie verhalen en gezelligheid tijdens het inbedden, snijden en kleuren. Op het moleculaire lab hebben Marry, Antoinet, Cecile en Linda me een snelcursus moleculaire biologie gegeven. Linda, heel veel dank voor je hulp, luisterend oor en bemoedigende woorden. Zonder Gideon du Marchie Sarvaas en Johan Koster was het niet gelukt om van alle ratten een echocardiogram te maken. Bedankt voor alle avonduren die jullie hebben weten vrij te maken om onder het genot van een pizza de kleinste patiëntjes te echoën. Frans Gerbens en Krista Kooi wil ik bedanken voor hun belangeloze investering in het gene array project. Bedankt voor de meer dan prettige samenwerking. Bij het tot stand komen van het hoofdstuk over serummarkers heeft Rebecca Heiner-Fokkema ons erg geholpen; veel dank hiervoor! Beatrijs Bartelds, bedankt voor je intellectuele bijdrage aan veel van mijn stukken. Het samenwerken met jou is een feest. Laura, ik vind het heel prettig dat mijn studies een vervolg gaan krijgen. Veel succes met de nieuwe projecten, en ik hoop je steun te kunnen bieden als je die nodig hebt. Helga de Graaf wil ik bedanken voor haar hulp bij de lay-out. Mijn aio-tijd was grotendeels zo prettig, omdat ik haar op een afdeling met hele fijne collega’s heb doorgebracht. Hiervoor wil ik Ardy Kuperus, Alexandra Douglas, Ellen la Bastide, Hendrik Buikema, Richard van Dokkum, Leo Deelman, Adriaan van Doorn, Jan van den Akker, Rob Henning, Wiek van Gilst en Dick de Zeeuw heel hartelijk danken. Jacoba, Larissa, Peter en Willeke, bedankt voor de gezellige avonden Katan. Er ligt nog een nieuwe afspraak in het verschiet wat mij betreft! Dank ook aan Wessel Sloof, met wiens hulp menige computercrisis in de kiem gesmoord is. Anton, bedankt voor je interesse in zoveel uiteenlopende velden binnen de wetenschap en je inspirerende creativiteit. Ik bewaar veel goede herinneringen aan de sociale activiteiten die je binnen de afdeling geinitiëerd hebt!

Zonder reisgenoten was de tocht lang niet zo boeiend geweest. Gelukkig heb ik pieken en dalen met fantastische collega-aio’s mogen beleven. Lieve Bart, in de wetenschap ben je een voorbeeld voor me geweest vanwege de zorgvuldigheid en het doorzettingsvermogen waarmee je op zoek bent naar de waarheid. Meer nog heb ik genoten van onze gesprekken over heel uiteenlopende onderwerpen. Bedankt! Het feit dat je er op de grote dag niet bij zult kunnen zijn is wel een kleine wolk voor de zon. Lieve Annemarieke, het was een grote eer je paranimf te zijn. Ik mis mijn sportmaatje en hoop binnenkort in Frankfurt de liefde en literatuur weer de revue te kunnen 205

Dankwoord

Een aantal studenten hebben me geholpen bij de totstandkoming van deze hoofd stukken. Hans en Saflloer, ik heb veel respect voor de creativiteit en originaliteit waarmee jullie hebben bijgedragen aan het gene array project. Ik ben heel benieuwd hoe de verdere studies gaan verlopen. Frederieke, dank voor al je geworstel met de patiëntendata. Paul, veel succes met je co-schappen en dank voor je enthousiaste inzet. Jurjen, ik weet niet of het dankzij of ondanks jouw aanwezigheid was dat de shuntoperatie zo soepeltjes ging lopen.

laten passeren. Bernadet, moleculaire vraagbaak en bondgenoot in het kippenhok, bedankt voor al je steun! Maria, ik denk dat je voor velen van ons een voorbeeld bent vanwege de bescheiden wijze waarop je je talenten tentoonspreidt. Veel geluk in en ook buiten de wetenschap. Milý Peter, vždy som sa mala radosť z Tvojho priateľského a optimistického vyžarovania, ktoré po Tvojom odchode z oddelenia veľmi chýba. Dúfam že príde deň, keď sa budeme môcť porozprávať po slovensky. Peter (en Margreet), bedankt voor de gezelligheid op en buiten de klinische farmacologie. Veel plezier in Boston. En natuurlijk Els, Hiddo, Hisko, Rik, Pim, Daan, Nadir, Irma, Irina, Cheng, Ying, Simone, Bas en Heidrun; de diversiteit aan mensen en culturen maakt de klinische farmacologie tot een afdeling waar je op veel terreinen wijzer wordt. Tot mijn paranimfen wil ik graag even apart het woord richten. Lieve Willemijn, als iemand de ups en downs van mijn promotietraject tot in de finesses kent ben jij het wel. De deur-dicht momenten, het organiseren van de aio-trips: de goede herinneringen zijn teveel om op te noemen. Ik ben heel blij jou als vriendin te hebben leren kennen in de afgelopen jaren! Lieve Marieke, jouw steun is al onontbeerlijk gebleken op veel momenten in mijn leven. Het is fantastisch dat je me ook op deze dag terzijde wilt staan. In de Beatrix Kinderkliniek heb ik me meteen heel welkom gevoeld dankzij een hele schare fijne collega’s. Nynke, Brigitte, Nienke en Han wil ik in het bijzonder bedanken voor hun steun en medeleven bij de laatste loodjes. Lieve vrienden, met jullie steun heb ik een groot aantal hobbels met relatief gemak kunnen nemen. Lieve Monique, bedankt voor alle gesprekken en veel meer! Iris wil ik bedanken voor alle gezelligheid. De oranje bank staat klaar voor meer maandagavonden! Eelkje, Joanna, Annemarieke, Amerins, Berber en vrienden uit Sneek: ondanks de (wisselende) afstand blijft de band bestaan, bedankt daarvoor! Lieve Maaike, bedankt voor al je inspanningen tijdens mijn verhuizing. Lieve Ype, dankjewel voor het eindeloze geduld waarmee je weer een maaltijd voor me opwarmde. Heel veel geluk! Mijn familie vormt de solide basis van waaruit ik alles onderneem. Lieve pap, mam, Liuwe en oma, heel veel dank voor jullie steun in verschrikkelijk veel opzichten en het vertrouwen dat jullie altijd in me hebben. Dankzij jullie ben ik waar ik nu ben. Ik geloof niet dat je de plaats waar je wieg staat kunt uitzoeken, dus heb ik oneindig veel geluk gehad. Liever Erik, als iemand op veel verschillende manieren aan dit proefschift heeft bijgedragen ben jij het wel! Ik kan je voor eindeloos veel dingen bedanken. Het leven met jou is rijk! 206

Bibliography

Articles 1

Rutten A, van Albada ME, Silveira DC, Cha BH, Liu X, Hu YN, Cilio MR, Holmes GL. Memory impairment following status epilepticus in immature rats: time-course and environmental effects. Eur J Neurosci. 2002 Aug;16(3):501-13.

2

van Albada ME, Eldering MJ, Post WJ, Klinkenberg TJ, Timens W, Groen HJ. The biopsying of at least 5 mediastinal lymph node stations for presurgical staging in patients with a non-small-cell lung carcinoma. Ned Tijdschr Geneeskd. 2004 Feb 7;148(6):281-6. Dutch.

3

van Albada ME, Schoemaker RG, Kemna MS, Cromme-Dijkhuis AH, van Veghel R, Berger RM. The role of increased pulmonary blood flow in pulmonary arterial hypertension. Eur Respir J. 2005 Sep;26(3):487-93.

4

van Albada ME, Berger RM, Niggebrugge M, van Veghel R, CrommeDijkhuis AH, Schoemaker RG. Prostacyclin therapy increases right ventricular capillarisation in a model for flow-associated pulmonary hypertension. Eur J Pharmacol. 2006 Nov 7;549(1-3):107-16.

5

van Albada ME, van Veghel R, Cromme-Dijkhuis AH, Schoemaker RG, Berger RM. Treprostinil in advanced experimental pulmonary hypertension: beneficial outcome without reversed pulmonary vascular remodeling. J Cardiovasc Pharmacol. 2006 Nov;48(5):249-54.

Abstracts

1

van Albada ME, Niggebrugge MJN, et al. Increased prostacyclin-tromboxane ratio improves outcome of flow-associated pulmonary hypertension. NaunynSchmiedebergs Archives of Pharmacology 2005 Jan;371(1): R2-R2.

2

van Albada ME, Niggebrugge MJN, et al. Prostacyclin induces angiogenesis in rats with right ventricular failure. Eur J of Heart Failure. 2005 Jun;4 Supplement 1:p131.

3

van Albada ME, Berger RMF, Schoemaker RG. Gene expression in rat pulmonary arterial hypertension. Naunyn-Aunyn-Schmiedebergs Archives of Pharmacology. 2006 Apr;373(1):92-92

210

4

van Albada ME, Houwertjes MC, et al. Bosentan improves both pulmonary vascular and cardiac remodeling in experimental flow-associated pulmonary hypertension. Eur J of Heart Failure, 2007 Jun;5 Supplement 1:p170.

5

van Albada ME, Loot FG, et al. Serum markers in pediatric pulmonary arterial hypertension. Cardiol Young. 2006.

6

van Albada ME, Houwertjes MC, Schoemaker RG, Berger RMF. Remodeling effects of bosentan in experimental flow-associated pulmonary hypertension. Cardiol Young 2006.

7

van Albada ME, Berger RMF, Schoemaker RG. Erythropoietin reverses pulmonary vascular remodelling in experimental flow-associated pulmonary hypertension. J Heart Lung Transplant. 2007 Feb; 26(2S): S248.

8

van Albada ME, Schoemaker, RG, Berger RMF. Effects of bosentan on both pulmonary vascular remodeling and cardiac function and remodeling in pulmonary hypertension. J Heart Lung Transplant. 2007 Feb; 26(2S): S187.

Bibliography

211