secretion system regulated by - Wiley Online Library

bs_bs_banner

Environmental Microbiology (2013) 15(2), 557–569

doi:10.1111/1462-2920.12005

A type VI secretion system regulated by OmpR in Yersinia pseudotuberculosis functions to maintain intracellular pH homeostasis

Weipeng Zhang,1,2† Yao Wang,1,2† Yunhong Song,1 Tietao Wang,1 Shengjuan Xu,1,2 Zhong Peng,1 Xiaoli Lin,1 Lei Zhang1 and Xihui Shen1,2* 1 State Key Laboratory of Crop Stress Biology for Arid Areas and College of Life Sciences, Northwest A&F University, Yangling, Shaanxi 712100, China. 2 Wuhan Institute of Virology, Chinese Academy of Sciences, Wuhan 430071, China. Summary Type VI secretion systems (T6SSs) which widely distributed in Gram-negative bacteria have been primarily studied in the context of cell interactions with eukaryotic hosts or other bacteria. We have recently identified a thermoregulated T6SS4 in the enteric pathogen Yersinia pseudotuberculosis. Here we report that OmpR directly binds to the promoter of T6SS4 operon and regulates its expression. Further, we observed that the OmpR-regulated T6SS4 is essential for bacterial survival under acidic conditions and that its expression is induced by low pH. Moreover, we showed that T6SS4 plays a role in pumping H+ out of the cell to maintain intracellular pH homeostasis. The acid tolerance phenotype of T6SS4 is dependent on the ATPase activity of ClpV4, one of the components of T6SS4. These results not only uncover a novel strategy utilized by Y. pseudotuberculosis for acid resistance, but also reveal that T6SS, a bacteria secretion system known to be functional in protein transportation has an unexpected function in H+ extrusion under acid conditions. Introduction Gram-negative bacteria employ a variety of secretion systems to deliver proteins to the extracellular milieu or directly into the cytosol of host cells (Holland, 2010). These systems utilize ATPase or proton motive force Received 5 May, 2012; accepted 23 September, 2012. *For correspondence. E-mail [email protected]; Tel. (+86) 29 8708 1062; Fax (+86) 29 8708 1623. †These authors contributed equally to this work.

© 2012 Society for Applied Microbiology and Blackwell Publishing Ltd

(PMF) to energize substrate protein translocation and the assembly of the secretion machine (Galán, 2008; Dalbey and Kuhn, 2012). The recently identified type VI secretion systems (T6SSs) are specialized bacterial protein export machines that present in more than a quarter of sequenced bacterial genomes, and structurally and functionally related to contractile phage tail sheath (Jani and Cotter, 2010; Schwarz et al., 2010; Basler et al., 2012). ClpV and IcmF, two conserved components with ATPase activity may function as energizers for T6SSs. ClpV is a member of the AAA+ (ATPases associated with various cellular activities) protein family, which is an oligomeric ring-like machine that binds ATP through the conserved AAA domain and converts the energy of ATP hydrolysis into mechanical force (Schlieker et al., 2005; Bönemann et al., 2009). ClpV is crucial for Hcp and VgrG secretion; it also provides energy for contracting the tail sheath of T6SS via ATP hydrolysis (Mougous et al., 2006; Bönemann et al., 2009; Basler et al., 2012). The membrane localized protein IcmF in T6SS usually interacts with multiple T6SS components and powers the secretion machinery assembly like its IcmF paralogue in T4SS (Sexton et al., 2004; Zheng and Leung, 2007; Ma et al., 2012). A striking feature of T6SS is the presence of multiple gene clusters that appear to code for evolutionarily distinct machineries in a single genome, implying that these systems confer distinct functions or are required for specific niches or hosts (Bingle et al., 2008; Pukatzki et al., 2009). Indeed, T6SSs have been recently reported to play versatile physiological roles including host–symbiont communication, interbacterial interactions, biofilm formation, and acute and chronic infection (Cascales, 2008; Filloux et al., 2008; Pukatzki et al., 2009; Hood et al., 2010; Schwarz et al., 2010). Interestingly, Weber and colleagues (2009) reported that a T6SS in Vibrio anguillarum is important for bacterial stress response and cell survival after exposure to various environmental challenges. However, most studies of T6SSs have focused on their roles in pathogenicity and cell–cell interactions, and very little is known about their roles in bacterial cellular processes such as stress responses. Yersinia pseudotuberculosis is a food-borne enteric pathogen that causes a variety of intestinal and

558 W. Zhang et al. extraintestinal infection (Smego et al., 1999). Whereas most of bacterial genomes harbour only one or two T6SS gene clusters, the closely related Y. pseudotuberculosis and Y. pestis contain four and five such clusters respectively. These systems are believed to confer distinct functions specific for particular niches or hosts (Bingle et al., 2008; Pukatzki et al., 2009). Gene clusters YPO0499– YPO0516 and y3658–y3677, representing one of the five putative T6SSs found in the genome of Y. pestis strain CO92 and KIM10, respectively, have been studied with transcriptomic and proteomic approaches (Cathelyn et al., 2006; Pieper et al., 2009; Robinson et al., 2009). Gene expression of this T6SS locus is controlled by the global regulator RovA (Cathelyn et al., 2006) and is strongly affected by temperature (Pieper et al., 2009). In Y. pestis, deletion of this T6SS locus leads to decrease in phagocytosis by macrophages (Robinson et al., 2009). Our previous study has identified four T6SS clusters in Y. pseudotuberculosis that are differentially thermoregulated (Zhang et al., 2011). Among them, T6SS4, the closest homologue of YPO0499–YPO0516/y3658–y3677 in Y. pestis is preferentially expressed at 26°C. Further, such expression is dependent on growth phase and is regulated by the AHL-mediated quorum sensing. T6SS1, T6SS2 and T6SS3 are speculated to be involved in pathogenicity, killing other bacteria and fimbrial formation respectively (Zhang et al., 2011). Yersinia pseudotuberculosis can survive extreme acid stress for several hours, which may allow the bacterium to overcome the acidic environment in the stomach. Stingl and De Reuse (2005) have reported that Y. pseudotuberculosis uses urease (UreABC) to convert urea to ammonia that neutralizes H+ for acid tolerance. A Y. pseudotuberculosis enzyme involved in aspartate metabolism (AspA) also plays a role in acid survival (Hu et al., 2010). Recently, Hu et al. have shown that the regulator Cra negatively regulates acid tolerance in Y. pseudotuberculosis (Hu et al., 2011). In addition, two-component regulon assays have revealed that several regulators, including PhoP, OmpR and PmrA, control acid survival in Y. pseudotuberculosis (Flamez et al., 2008). Among those regulators, OmpR is essential for the survival of bacteria in acidic pH by positively regulating the expression of urease (Hu et al., 2009). OmpR is the response regulator of the EnvZ/OmpR two-component system, of which EnvZ senses environmental signals and phosphorylates OmpR. Phosphorylation of OmpR drastically increases its affinity to the promoter sequences of its target genes, leading to induction of expression (Head et al., 1998). Beyond its canonical function in bacterial response to osmotic stress, OmpR has recently been found to be essential for low pH adaptation and for priming bacterial survival in severe acid stress in Escherichia coli K-12 (Stincone et al., 2011). In addition, OmpR had been shown to regulate the

stationary-phase acid-inducible response in Salmonella Typhimurium, potentially by counteracting H-NS-mediated repression (Bang et al., 2000; 2002). Thus, it is likely that additional OmpR-regulated pathways are involved in acid tolerance or resistance. We report here OmpR regulated the expression of T6SS4 in Y. pseudotuberculosis. The gene expression was induced by low pH, and T6SS4 played a role in acid survival by maintaining a steady-state intracellular pH (pHi). The acid resistance phenotype was dependent upon the ATPase activity of ClpV4 that participated in H+ extrusion. Thus, T6SS4 may play a novel role in maintain intracellular pH homeostasis by pumping H+ out of the cell. Results OmpR directly binds to the T6SS4 promoter Analysis of the T6SS4 promoter region revealed three putative OmpR binding sites, O1, O2 and O3, which were highly similar to the binding sites of OmpR in E. coli (Egger and Inouye, 1997; Yoshida et al., 2006) (Figs 1A and S1). The interaction of phosphorylated OmpR (OmpR-P) with the T6SS promoter region was investigated by EMSA (Fig. 1B). A 292 bp PCR fragment (T6SS4p) in the T6SS promoter including the three binding sites was used. Incubation of OmpR-P with T6SS4p led to retarded mobility of the probe, indicating direct binding of this protein to the T6SS4 promoter. Further, the DNA–protein complexes increased in responding to more OmpR-P used in the reactions. A 300 bp control DNA amplified from the T6SS4 coding region did not show detectable OmpR-P binding (Fig. 1B). We further determined the binding of OmpR-P to a series of mutated T6SS4p fragments with one or more of the three putative binding sites replaced by same amount of irrelevant base pairs in the EMSA assay (Fig. 1C). When probes lacking O1 (T6SS4pM1), O2 (T6SS4pM2) and O3 (T6SS4pM3) were used for the assay, the amount of DNA–protein complex markedly decreased in reactions containing the same amount of OmpR-P. Moreover, no DNA–protein complex could be detected when a DNA fragment lacking all three operators (T6SS4pM123) was used. Importantly, a probe lacking O3 appeared to interact better with OmpR-P than probes lacking O1 or O2, suggesting that although all three sites can be recognized by OmpR-P, the affinity of the protein to O1 or O2 was higher than that to O3 (Fig. 1C). Collectively, these results indicate that OmpR directly binds to the T6SS4 promoter through recognizing the O1, O2 and O3 elements. Positive regulation of T6SS4 expression by OmpR To further determine the role of OmpR in the expression of T6SS4, we introduced a single copy T6SS4p::lacZ fusion

© 2012 Society for Applied Microbiology and Blackwell Publishing Ltd, Environmental Microbiology, 15, 557–569

Role of T6SS in acid resistance

559

Fig. 1. OmpR directly binds to the T6SS4 promoter. A. The consensus OmpR binding sites was compared with the putative OmpR binding sites O1, O2 and O3 in the T6SS4 promoter (T6SS4p). B and C. EMSA was carried out to analyse interactions between phosphorylated OmpR (OmpR-P) and T6SS4 promoter (B) or promoters with mutations in O1(T6SS4p-M1), O2(T6SS4p-M2), O3(T6SS4p-M3) or all the three consensus binding sites (T6SS4p-M123) (C). The increasing amounts of OmpR-P used were 100, 200, 300 and 400 ng. As a negative control, a 300 bp fragment from the T6SS4 coding region amplified with primers Control-F and Control-R was included in the binding assays (B).

into the chromosomes of wild-type strain YpIII, mutant DompR and complemented strain DompR(ompR). The LacZ activity of the resulting strains was quantitatively measured (Fig. 2A). The T6SS4p::lacZ fusion decreased significantly in DompR, and such decrease can be restored to the wild-type level by introducing a plasmid overexpressing ompR (pKT100-ompR), suggesting that OmpR positively regulates T6SS4 expression. The positive regulation of OmpR to T6SS4 was further confirmed in protein level, with the observation that the protein production of T6SS4 components Hcp4 and ImpA4 were reduced in the DompR mutant and restored to the wild-type level in the complementary strain (Fig. 2B). To further examine the possible roles of O1, O2 and O3 elements in T6SS4 regulation, we constructed a series of T6SS4p::lacZ fusions, in which the expression of the reporter was controlled by a promoter lacking one or all three of these elements. As expected, replacement of all the three putative OmpR binding sites (M123) resulted in an almost complete loss of the promoter activity in wildtype strain YpIII, and individually replace of the O1(M1) or O3(M3) element also led to significant reduction of the promoter activity in the wild type, indicating that both O1 and O3 sites are important for T6SS4 expression. Unexpectedly, deletion of the O2 site (M2) caused an increase in the transcription of the reporter in the wild-type strain (Fig. 2A), implicating that the O2 site plays a negative role in regulation of T6SS4 expression. In addition, the expression of all these fusions in the DompR strain was significantly lower than that observed in the wild-type strain, and such defects in expression can be restored to wildtype level by introducing plasmid pKT100-ompR (Fig. 2A),

suggesting a direct role of OmpR in mediation of such regulations. These results demonstrate that the T6SS4 expression is positively regulated by OmpR through recognizing O1, O2 and O3 elements in an unknown mechanism. Since Y. pseudotuberculosis contains four T6SS clusters, we also measured the promoter activity of the other three T6SSs in strain YPIII and DompR. OmpR did not affect the expression of the other three T6SS clusters in Y. pseudotuberculosis (Fig. 2C). T6SS4 is involved in acid tolerance OmpR has been shown to facilitate acid survival of Y. pseudotuberculosis (Hu et al., 2009). Our observations that this protein also regulates T6SS4 expression prompted us to examine whether the secretion system is directly involved in acid survival. After incubated in a pH 4.0 buffer for 120 min, about 38% of the wild-type YpIII strain survived. The survival rates of the mutant of lacking ompR, hcp4 or clpV4 decreased to 14%, 20% and 18%, respectively, and a 12% survival rate was observed for the double mutant DclpV4DompR. Overexpressing of OmpR in the DclpV4DompR double mutant can only slightly rescue the survival rate to 14% (Fig. 3A). These data suggest that T6SS4 may play a major role in mediation of OmpR regulated acid survival. Further, expression of the T6SS4p::lacZ fusion increased in response to increase of H+ concentration as tested in buffers of pH 7.0, 5.5 or 4.5 (Fig. 3B). The induction of T6SS4 in low-pH condition was mediated by OmpR, as its expression was not significantly altered in the DompR mutant (Fig. 3B). These data


560 W. Zhang et al. et al., 2009; Lee and Harshey, 2012). The plasmid containing pH-sensitive GFPmut3* (pKEN-GFPmut3*, Wilks and Slonczewski, 2007) was introduced into DompR, Dhcp4 and DclpV4 and intracellular pH (pHi) was measured by fluorimetry. Deletion of ompR, hcp4 or clpV4 had no effect on baseline intracellular pH when external pH (pHo) was 7.0. In contrast, when the environmental pH was lowered to 5.0, the baseline pHi was 6.9 ⫾ 0.05 in wild type, which is significantly higher than the 5.9–6.2 in the DompR, Dhcp4 and DclpV4 mutants (Fig. 4A). Thus, T6SS4 is critical in setting the baseline pHi at least when environmental pH is less than 7.0. Next, we examined whether the observed pHi regulation require the H+-ATPase activity by measuring the effects of N-ethylmaleimide (NEM) and N,N′-dicyclohexylcarbodimide (DCCD), two widely used H+-ATPase inhibitors on pHi maintenance in strain YpIII under two pH conditions, pHo of 5.0 and 7.0 respectively. The addition of either NEM or DCCD to cells at pHo 5.0 almost completely dissipated the DpH gradient. While at pHo 7.0, they showed no effect on the DpH gradient (Fig. 4B).

Fig. 2. OmpR positively regulates T6SS4 expression. A. Promoter activities were analysed for the full-length T6SS4 promoter and promoters with mutations in O1(M1), O2(M2), O3(M3) or all the three sites (M123) in the wild type, DompR mutant and its complemented strain DompR(ompR). B. The production of ImpA4 and Hcp4 in wild type, DompR and DompR(ompR) grown in YLB medium to early stationary phase at 26°C. Lysates prepared from equal amount of cells were resolved by SDS-PAGE, the levels of ImpA4 and Hcp4 were detected by using immunoblotting with specific antibodies. The metabolic protein phosphoglucose isomerase (Pgi) was probed as a loading control. C. b-Galactosidase analyses of T6SS1–4 promoter activities by using the transcriptional T6SS1-4p::lacZ chromosomal fusion reporters expressed in the wild-type and DompR mutant grown in YLB medium to early stationary phase at 26°C. Data shown are the average of three independent experiments. The error bars indicate standard deviations of the average.

clearly demonstrate that acidic condition induces the expression of components of T6SS4, which in turn, directly contributes to acid tolerance.

T6SS4 regulates the intracellular pH (pHi) of Y. pseudotuberculosis under acid stress To determine the mechanism underlying T6SS4-mediated acid tolerance, we examined the intracellular pH (pHi) homeostasis in the relevant bacterial strains by using GFP reporter assay (Wilks and Slonczewski, 2007; Kitko

Fig. 3. T6SS4 is essential for survival of strain YpIII under acid stress. A. Acid survival was determined by measuring cfu ml-1 after a treatment at pH 4.0 for 2 h. B. b-Galactosidase analyses of T6SS4 expression in strain YpIII containing T6SS4p::lacZ chromosomal fusion reporter at different external pH. Data shown are the average of three independent experiments. The error bars indicate standard deviations of the average.


Role of T6SS in acid resistance

561

Fig. 4. T6SS4 maintains intracellular pH homeostasis under acid stress. A. Effects of ompR, clp4 and hcp4 mutants act on pHi maintenance at pH 7.0 and pH 5.0. B. Effects of ATPase inhibitors act on pHi maintenance in the wild type at pH 7.0 and pH 5.0. C. Effects of ClpV4 and ClpV4M act on pHi maintenance at pH 7.0 and pH 5.0. The strains observed all carried pKEN-GFPmut3*, fluorescence intensities were used to estimate pHi as described in Experimental procedures. The intensities are averaged for three independent cultures for each condition. D. Proposed domain organization of ClpV4 and conserved motifs involved in ATP hydrolysis. ClpV consists of an N-terminal domain, two nucleotide-binding domains (AAA-1 and AAA-2) that are separated by a middle domain, and a C-terminal domain. Both nucleotide-binding domains contain the Walker A (GX4GKT) and Walker B (Hy2DE) motifs, where X represents any amino acids and y represents hydrophobic amino acids. E. pHi recovery in wild-type YpIII, DclpV4 mutant and the complemented strain. Cells were suspended in M9 medium (pH 7.0) and spectra were recorded every 20 s after shift the external pH to 5.0 by addition of HCl to the culture. F. Effect of VgrG4GFP and VgrG4His expressed in YpIII on pHi maintenance at pH 7.0 and pH 5.0. The pHi values were estimated by BCECF as described in Experimental procedures. G. Effect of NEM and DCCD on the viability of YpIII after treatment at pH 4.0 for 2 h. H. Effect of the ATPase activity of ClpV4 on the viability of YpIII after treatment at pH 4.0 for 2 h. Data shown are the average of three independent experiments. The error bars indicate standard deviations of the average.

Consistent with this result, incubation with NEM or DCCD caused a 20–30% reduction in cell viability under acidic conditions compared with the wild-type strain (Fig. 4G). These data suggest that the H+-ATPase activity is responsible for intracellular pH homeostasis and low pH survival of Y. pseudotuberculosis. As H+-ATPase activity is responsible for intracellular pH homeostasis and low pH survival, we reasoned that the function of ClpV4, the essential energizing component of

the T6SS in acid tolerance, should be relied on its ATPase activity. Deletion of clpV4 in Y. pseudotuberculosis abrogated Hcp4 secretion without altering Hcp4 levels in the cellular fraction, and the Hcp4 secretion defect was restored by introducing a plasmid harbouring clpV4 (Fig. S3). However, ClpV4M, the E304A/E677A variant deficient in ATP hydrolysis (which harbours mutations in the Walker B motifs of both AAA domains, Bönemann et al., 2009) was unable to restore Hcp4 secretion,


562 W. Zhang et al.

Fig. 5. T6SS4 involves in proton extrusion. Wild-type strain YpIII and the DclpV4 mutant were loaded with acid by growing at pH 5.0 for 12 h. After those bacterial cells were transferred to deionized water containing 0.2% glucose (pH 7.0), pH changes of the medium were recorded. For WT + DCCD, DCCD was added at time 24 min. Medium without glucose was used as a control. Data shown are the average of three independent experiments. The error bars indicate standard deviations of the average.

demonstrating that the ATPase activity of ClpV is required for T6S (Fig. S3). We further measured the effect of the ATPase null mutant ClpV4M on pHi maintenance and acid tolerance. As shown in Fig. 4C and H, the defect of pHi maintenance and acid survival observed in DclpV4 could be completely complemented by expression of wild-type clpV4 in plasmid pKT100, but not clpV4M, further proving that the ATPase activity of ClpV4 is pivotal in maintaining the pHi homeostasis and dealing with the acid stress. We also measured the recovery of pHi from an acid-load (HCl prepulse) by the wild-type strain YpIII, the mutant DclpV4, the complemented strains DclpV4(clpV4) and DclpV4(clpV4M). Following the addition of HCl, the pHi of the wild-type and the DclpV4(clpV4) strains fell within 60 s to the low point of ~ 6.2, which was followed by a slow recovery (Fig. 4E). In contrast, the pHi of the DclpV4 and DclpV4(clpV4M) strains reached the low point of ~ 5.75 after exposing to acid for 180 s, and no subsequent recovery was observed (Fig. 4E). Taken together, these results demonstrate that T6SS4 participate in pHi regulation of Y. pseudotuberculosis YpIII, and its ATPase activity is required for this function. We further sought to determine whether the pHi maintenance activity of T6SS4 is directly linked to its secretion channel. One way to test this hypothesis is to block the T6SS4 channel by overexpressing a size increased secretion substrate such as VgrG without disrupting the T6SS4 secreton complex. Increasing the size of VgrG by fusion to a very compact protein such as GFP will block the secretion channel as it’s difficult to unfold and transport the bulky and tightly packed protein through the central channel (Akeda and Galán, 2005; Brown et al., 2008). Consistent with the conclusion that the secretion of VgrG is a hallmark of all T6SSs (Suarez et al., 2008;

Pukatzki et al., 2009), the VgrG4 protein in Y. pseudotuberculosis had been shown to be secreted only in the YPIII wild type but not in the hcp4 and clpV4 mutants (Fig. S4A). Since the secretion signal of VgrG resides in its N-terminal portion (Ma et al., 2009), we constructed VgrG4 derivatives with GFP (VgrG4GFP) or His6 (VgrG4His6) tagged to its C-terminus and tested whether these fusion proteins affect the secretion of a second secretion substrate Hcp4. As shown in Fig. S4B, the expression of VgrGFP fusion in strain YpIII(pBS-vgrG4GFP) resulted in a significant reduction in Hcp4 secretion; however, the expression of VgrG4His fusion in strain YpIII(pBSvgrG4His) has no effect on Hcp4 secretion. This implies that the T6SS4 channel was blocked by VgrG4GFP but not by VgrG4His. Next, when the pHi of strains YpIII(pBSvgrG4GFP), YpIII(pBS-vgrG4His) and YpIII(pBS) were analysed with the pH-sensitive probe BCECF at pHo 7.0 and 5.0, we found that the pHi of YpIII(pBS-vgrG4GFP) decreased to 6.65 at pHo 5.0 whereas the pHi of YpIII(pBS-vgrG4His) and YpIII(pBS) stayed 6.95 (Fig. 4F). These results further indicate that the unblocked channel and the rate of substrate secretion through the central channel are critical for the pHi maintenance activity of T6SS4. T6SS4 participates in H+ extrusion The facts that T6SS4 regulates the pHi under acidic environment and H+-ATPase inhibitors interfere with intracellular pH homeostasis in Y. pseudotuberculosis prompted us to examine whether this secretion system was involved in pumping H+ out of the cell. The wild-type strain YpIII and the mutant DclpV4 were loaded with H+ by suspending in acidic buffer. When the cells were transferred into deionized water containing 0.2% glucose, pH 7.0, acidification of the medium by both strains occurred (Fig. 5). Without glucose, the H+ concentration at 90 min was significantly lower than the culture containing glucose, suggesting that this H+ translocation is an active, energy-consuming process. Further, 1 mM DCCD inhibited H+ efflux in wildtype strain YpIII, indicating the essential role of ATPase activity in medium acidification. Interestingly, in the first 6 min, the acidification of the medium by the DclpV4 mutant was faster than that of the wild-type strain, which could be attributed to the fact that the DclpV4 mutant had been loaded with more H+ because it could not maintain a steady-state pHi similar to the wild-type strain at pHo 5.0. However, between 6 and 36 min, the H+ extrusion rate by the wild-type strain was significantly higher than that of the DclpV4 mutant, indicating the involvement of this ATPase in this process. Finally, the H+ concentration in medium reached a steady state at 54 min for the wild-type strain in comparison with 90 min for the DclpV4 mutant (Fig. 5).


Role of T6SS in acid resistance Discussion Since the initial discovery in 2006, T6SSs have been identified in more than a quarter of bacteria with sequenced genomes (Basler et al., 2012). One striking observation is that many genomes harbour more than one T6SS gene cluster, and as many as five to six T6SS gene clusters are present in some bacteria. The multiple T6SSs are likely involved in different functions in a bacterium (Boyer et al., 2009). The potentially diverse functions suggest that T6SS clusters are controlled by distinct regulatory circuits in response to specific environmental cues. In the present study, we identified the osmolarity response regulator OmpR as a new regulator for T6SS4 expression. Interestingly, there are increasing data demonstrating that OmpR is also the most important two-component regulator in acid response in Salmonella Typhimurium (Bang et al., 2002), E. coli (Stincone et al., 2011) and Y. pseudotuberculosis (Flamez et al., 2008). Our observation that OmpR-P binds to three conserved elements in T6SS4 promoter region provides direct evidence of a regulatory role of this protein in the positive regulation of T6SS4 expression. It is unexpected that the binding of OmpR-P to O2 site has an inhibition effect on T6SS4 expression while O1 and O3 sites activate T6SS4 expression, and this makes the OmpR regulation more complex. However, a similar phenomenon has been observed in OmpRregulated OmpF expression in E. coli (Huang et al., 1994). This occurs through OmpR-P binding to four (F1, F2, F3 and F4) sites of the ompF promoter. At low osmolarity, OmpR-P cooperatively binds to F1, F2 and F3 to activate ompF transcription. However, binding of OmpR-P to the F4 site at high osmolarity blocked ompF transcription (Head et al., 1998; Yoshida et al., 2006). In addition, inactivation of the F4 site by insertion of a 22 bp fragment prevents the repression of ompF expression conferred by the dominant-negative mutation, envZ473 (Huang et al., 1994). T6SSs are involved in a broad variety of functions: from pathogenesis, biofilm formation to stress sensing and antimicrobial property (Cascales, 2008; Filloux et al., 2008; Weber et al., 2009; Hood et al., 2010; Schwarz et al., 2010). The finding that the key acid response regulator OmpR regulates T6SS4 expression prompted us to examine whether this secretion system is directly involved in acid survival. Because Y. pseudotuberculosis T6SS4 mutants displayed lower viability in acidic condition than the wild-type strain (Fig. 3A), T6SS4 appears to play a novel role in maintaining intracellular pH homeostasis. This conclusion is further supported by at least three lines of independent evidence. First, expression of T6SS4 was induced by low pH through OmpR activation (Fig. 3B). Second, deletion of clpV4, hcp4 or ompR resulted in a defect of pHi recovery from acid loading (Fig. 4A). Finally,

563

blockage of the T6SS4 export apparatus by production of VgrG4GFP led to a decrease of pHi under acidic condition, indicating that the ‘channel’ or ‘gate’ of T6SS4 plays a direct role in pHi regulation (Fig. 4F). T6SS4 belongs to a special T6SS cluster with unknown function unique to Burkholderia mallei (BMAA0438-0455), B. pseudomallei (Bpss0516-0533), B. thailandensis (BTH_II1901-1884) and Y. pestis (YPO0499-0516 or y3658-3677) in sequence and organization among 450 species analysed by Schell and colleagues (2007). It remains to be investigated whether other members of this T6SS subfamily function in acid survival and pHi regulation. OmpR does not seem to regulate the expression of other three T6SS clusters in Y. pseudotuberculosis YpIII (Fig. 2C), further suggesting the distinct functions of these systems in the biology of this bacterium. To ensure survival at low pH, bacteria must prevent excessive entry of protons into its cytosol and expel or neutralize them when their concentrations threaten the pH homeostasis essential for growth (Baker-Austin and Dopson, 2007; Vandal et al., 2009; Matsui and Cvitkovitch, 2010). Central to the ability of bacteria to maintain pH homeostasis is transporters that catalyse active proton transport. The transporters include primary proton pumps such as the proton-pumping respiratory chain complexes or H+-ATPases and secondary active transporters such as cation/proton antiporters (Baker-Austin and Dopson, 2007; Krulwich et al., 2011). In E. coli, intracellular pH homeostasis is regulated by proton extrusion via the respiratory chain and potassium influx at acidic pH, and the H+-ATPase extrudes protons to generate the PMF (Harold, 1977). Induction of F1F0-ATPases under acidic environments and consequent expulsion of protons from the cell to maintain an elevated cytoplasmic pH has also been observed in Streptococcus mutans (Kuhnert et al., 2004) and Bifidobacterium animalis (Sánchez et al., 2006). Our results here show that in Y. pseudotuberculosis, pHi regulation requires the ATPase activity of ClpV4. Deletion of clpV4 resulted in defects of pHi recovery following acid loading, and prevented the maintenance of a steady-state pHi in acidic environment (Fig. 4C and E). Further, it was observed that acidification of the medium by the wild-type strain was faster than by the DclpV4 mutant, indicating that ClpV4 is directly involved in H+ efflux (Fig. 5). Moreover, the H+-ATPase inhibitor DCCD prevented acid extrusion, supporting the concept that the maintenance of a steady-state pHi was mainly by H+-ATPases (Fig. 5). Thus, our data suggest that T6SS4 in Y. pseudotuberculosis could pump H+ out of the cell through its gate. The finding that T6SS4 serves as an H+-ATPase or proton transporter is not entirely unexpected in light of the recent finding that the flagellar type III secretion system is also a proton-protein antiporter (Minamino et al., 2011).


564 W. Zhang et al.

Fig. 6. Model of T6SS4-facilitated acid resistance in Y. pseudotuberculosis. Detrimental acidic pH transfers a signal to EnvZ that phosphorylates OmpR to activate expression of T6SS4. T6SS4 is responsible for maintenance of a steady-state pHi via H+ extrusion, and this process is facilitated by the ATPase activity of ClpV4. However, whether PMF and other H+ transporters involved in this process, and how does T6SS4 functions to pump H+ out of the cell need to be further investigated.

However, whether T6SS4 is directly involved in the proton extrusion process via acting as a proton transporter and what’s the role of ClpV in proton extrusion need to be further investigated. Another possibility is that T6SS4 functions by providing PMF for yet unidentified H+-pumps. Nevertheless, our data support a model in which T6SS is involved in the regulation of pH homeostasis and acid tolerance through H+ efflux, which is important for the survival of Y. pseudotuberculosis in acidic environments encountered during passage through the stomach. Thus, the proton extrusion activity of T6SS is a novel strategy employed by Y. pseudotuberculosis to enhance acid tolerance, which is essential for successful colonization in the mammalian host and relies on a pathway or mechanism related to OmpR and possibly PMF (Fig. 6). There are increasing data implying that T6SS is involved in stress response in various bacteria. Previous work by Weber and colleagues (2009) suggested that T6SS may serve as a sensor for an extracytoplasmic signal that modulates RpoS expression and stress response in V. anguillarum. Recently, Ishikawa and colleagues (2012) showed that the T6SS of wild-type Vibrio cholerae O1 strain A1552 was functionally activated when the bacterium was grown under high-osmolarity conditions, and the newly recognized osmoregulatory protein OscR plays a role in the regulation of T6SS gene expression and secretion of Hcp. Additional support for T6SS having a role in stress response is given in Pseudomonas aeruginosa by the eukaryotic-type signalling system

PppA–PpkA, which not only controls the activity of the H1-T6SS at the post-translational level, but also affects the transcription of multiple stress-responsive genes revealed through a transcriptomics analysis (Goldová et al., 2011). In this work, we further identified a direct relationship between T6SS and acid tolerance in Y. pseudotuberculosis, which allowed us to propose a working model that the OmpR regulated T6SS is involved in the regulation of pH homeostasis and acid tolerance through H+ efflux (Fig. 6). Thus, our results uncovered a novel strategy utilized by Y. pseudotuberculosis for acid resistance. To our knowledge, this is the first study to demonstrate the role of T6SS in proton extrusion. Stress responding T6SSs may be of great significance to understand the secretion mechanisms and ecological consequences of T6SS in the near future. Experimental procedures Bacterial strains and growth conditions Bacterial strains and plasmids used in this study are listed in Table S1. Strains were grown as described previously (Zhang et al., 2011). Briefly, E. coli were grown in LB with appropriate antibiotics. Y. pseudotuberculosis strains were cultured in Yersinia Luria–Bertani (YLB) broth (1% tryptone, 0.5% yeast extract, 0.5% NaCl) with appropriate antibiotics when necessary. The Y. pseudotuberculosis strain YpIII was the parent of all derivatives used in this study. In-frame deletions were generated by means of the method described previously (Ding et al., 2009). Antibiotics were added at the following


Role of T6SS in acid resistance -1

concentrations: ampicillin, 100 mg ml ; kanamycin, 50 mg ml-1; tetracycline, 10 mg ml-1; chloramphenicol, 30 mg ml-1.

Plasmid construction Plasmids and primers used in this study are listed in Supplementary Tables S1 and S2 respectively. The lacZ fusion reporter vector pDM4-T6SS4p::lacZ was made in previous study (Zhang et al., 2011). To construct T6SS4 promoter fragments with OmpR binding site mutations, overlap PCR were performed to replace the O1, O2 or O3 sites (20 bp each) with identical amount of irrelevant base pairs. For instance, to replace the O1 site, primer pairs T6SS4p-SalI-F/ T6SS4pM1-R and T6SS4pM1-F/T6SS4p-XbaI-R were used to amplify the up-fragment and down-fragment of T6SS4 promoter respectively. Primers T6SS4pM1-F and T6SS4pM1-R were designed to contain 20 bp overlapping DNA fragment (CGCCTCAGGCATTCCCACGC) used to replace the O1 site. Overlap PCR was carried out by using the up-fragment and down-fragment as template and T6SS4pSalI-F/T6SS4p-XbaI-R as primer pair to get the DNA fragment T6SS4pM1. This fragment was further digested with SalI and XbaI and inserted into similar digested pDM4-lacZ to construct pDM4-T6SS4pM1::lacZ. Similarly, plasmid pDM4T6SS4pM2::lacZ was constructed by using primer pairs T6SS4p-SalI-F/T6SS4pM2-R and T6SS4pM2-F/T6SS4pXbaI-R, and plasmid pDM4-T6SS4pM3::lacZ was constructed by using primer pairs T6SS4p-SalI-F/T6SS4pM3-R and T6SS4pM3-F/T6SS4p-XbaI-R respectively. Sequences used to replace O2 and O3 sites were CATCCACGTCATCG TGCTAA and CCCTCCATTAGTAAGAGT respectively. To construct pDM4-T6SS4pM123::lacZ, the up-fragment was amplified with primer pair T6SS4p-SalI-F/T6SS4pM2-R by using pDM4-T6SS4pM1::lacZ plasmid as template, and the down-fragment was amplified with primer pair T6SS4pM2-F/ T6SS4p-XbaI-R by using pDM4-T6SS4pM3::lacZ plasmid as template, and a further overlap PCR using T6SS4p-SalI-F/ T6SS4p-XbaI-R as primer pair will produce the T6SS4pM123 fragment directly. pDM4-T6SS4pM123::lacZ was generated by inserting the SalI/XbaI-digested T6SS4pM123 fragment into similar digested pDM4-lacZ plasmid. The plasmid pDM4-DclpV4 was used to construct clpV4 in-frame deletion mutant of Y. pseudotuberculosis. The 859 bp upstream PCR product and 667 bp downstream PCR product of clpV4 were amplified with primer pair DclpV4up-SalI-F/DclpV4up-PstI-R and DclpV4down-PstI-F/ DclpV4down-BglII-R respectively. In the next step, the upstream and downstream products were digested with SalI/ PstI and PstI/BglII, respectively, and inserted into SalI/BglII sites of pDM4 to get pDM4-DclpV4. To complement the ompR mutant, primers ompR-SphI-F/ ompR-SalI-R were used to amplify ompR gene fragment from YpIII genome. The PCR product of ompR was digested with SphI/XhoI and was inserted into the SphI/SalI sites of pKT100 to produce pKT100-ompR. The complementation plasmid pKT100-clpV4 was constructed in similar manners by using primers clpV4-SphI-F/clpV4-SalI-R. Overlap PCR was carried out to make mutational alterations of clpV4M(E304A/E677A) with primers clpV4-E304M-F/clpV4E304M-R and clpV4-E677M-F/clpV4-E677M-R. In detail, the clpV4 DNA sequence was amplified in three segments.

304

565

304

Primer pairs clpV4-SphI-F/clpV4-E M-R, clpV4-E M-F/ clpV4-E677M-R and clpV4-E677M-F/clpV4-SalI-R were used to amplify segments 1, 2 and 3 respectively. Then overlap PCR was carried out by using clpV4-SphI-F/clpV4-E677M-R as primer pair while fragment 1 and fragment 2 as templates to get segment 1 + 2 which contained a mutation in the E304 site of ClpV4. Subsequently, a second round of overlap PCR was carried out by using clpV4-SphI-F/clpV4-SalI-R as primer pair while segment 1 + 2 and segment 3 as templates to obtain fragment 1 + 2 + 3, namely clpV4M, which contained mutations in both E304 and E677. To construct pKT100-clpVM, the DNA fragment clpV4M was digested with SphI and SalI and inserted into similarly digested pKT100. Plasmids pET28a-impA4 and pET28a-ompR were constructed to overexpress ImpA4 and OmpR respectively. Briefly, primers impA4-BamHI-F/impA4-SalI-R, ompRBamHI-F/ompR-SalI-R were used to amplify impA4 and ompR genes fragments from strain YpIII genome respectively. The PCR products of impA4, ompR were digested with BamHI/SalI and inserted into the BamHI/SalI sites of pET28a to generate pET28a-impA4 and pET28a-ompR. To construct pBS-vgrG4GFP, gene fragments of vgrG4 and GFP were amplified from genome of strain YpIII and plasmid pEGFP-C1 with primers vgrG4-XbaI-F/vgrG4GFP-R and vgrG4GFP-F/GFP-XbaI-R respectively. The T6SS4 promoter was amplified with primer pair T6SS4p-SalI-F/T6SS4pXbaI-R and inserted into the SalI/XbaI sites of pBluescript II SK (+) to produce pBS-T6SS4p. PCR products of vgrG4 and GFP are further fused by overlap PCR with primers clpV4XbaI-F/GFP-XbaI-R, and the PCR product was digested with XbaI and inserted into pBS-T6SSp to make pBS-vgrG4GFP. The vgrG4His fragment was amplified from the YpIII genome with primers vgrG4-XbaI-F/vgrG4His-XbaI-R, XbaI-digested DNA was inserted into pBS-T6SS4p to make pBS-vgrG4His. The integrity of the insert in all constructs was confirmed by DNA sequencing.

Construction of chromosomal fusion reporter strains and b-galactosidase assays The lacZ fusion reporter vectors pDM4-T6SS4p::lacZ, pDM4T6SS1p::lacZ, pDM4-T6SS2p::lacZ, pDM4-T6SS3p::lacZ, pDM4-T6SS4pM1::lacZ pDM4-T6SS4pM2::lacZ, pDM4T6SS4pM3::lacZ and pDM4-T6SS4pM123::lacZ were transformed into E. coli S17-1lpir and mated with the YpIII parent, mutants DompR or DclpV4 respectively, according to the procedure described elsewhere (Atkinson et al., 1999; Ding et al., 2009). The lacZ fusion reporter strains were grown in YLB broth and b-galactosidase activities were assayed with ONPG as the substrate (Miller, 1992). The b-galactosidase data shown represent the mean of one representative assay performed in triplicate, and error bars represent standard deviation. Statistical analysis was carried out with Student’s t-test.

Overexpression and purification of recombinant proteins Plasmids pET28a-impA4 and pET28a-ompR were transformed into E. coli BL21(DE3), and the recombinant bacteria containing plasmids pET28a-impA4 and pET28a-ompR were grown at 37°C in LB medium to an OD600 of 0.5. The


566 W. Zhang et al. strains were then induced with 0.4 mM isopropyl b-D-1thiogalactopyranoside (IPTG) and then cultivated for an additional 16 h at 22°C. Harvested cells were resuspended in lysis buffer (10 ml g-1 pellet) containing 50 mM Tris-HCl (pH 8.0), 100 mM NaCl, 0.5 mg ml-1 lysozyme and 2 mM phenylmethylsulfonyl fluoride (PMSF) and then incubated on ice with occasional vortexing for 10–15 min until the suspension became viscous. The cells were broken by sonication on ice until the suspension was translucent. Clear cell lysates were incubated with Ni2+ agarose beads for 2 h at 4°C, and the beads were washed with 40 times of the bed volume of TBS buffer (50 mM Tris-HCl, 150 mM NaCl, pH 7.6) containing 20 mM imidazole. Recombinant His6-tagged proteins ImpA4 and OmpR were eluted with TBS buffer containing 200 mM imidazole and dialysed against TBS to remove imidazole. Protein concentrations were determined by the Bradford assay (Bradford, 1976).

Western blot analysis Supernatant proteins and cell pellets were prepared according to Zhang and colleagues (2011). For Western blots, samples resolved by SDS-PAGE were transferred onto PVDF membranes. Non-specific protein interactions were blocked with 4% milk in PBST buffer (PBS buffer containing 0.2% Tween 20) for 2 h at room temperature. Membranes were probed in PBST buffer for 2 h at room temperature with the appropriate primary antibody: anti-Hcp4, 1:1000; anti-ImpA4, 1:1000; anti-Pgi, 1:2000; anti-His (Millipore, MA, USA), 1:1000. The blots were washed several times in PBST buffer and then incubated with 1:5000 dilution of horseradish peroxidase-conjugated secondary antibodies in PBST buffer for 1 h. The proteins were visualized by using enhanced bioluminescence reagents (Pierce, Rockford, IL) following the manufacturer’s specified protocol. ImpA4 antiserum was prepared referring to the method described previously (Zhang et al., 2011). Briefly, affinity-purified His6-ImpA4 protein was further separated using SDS-15%-PAGE. His6ImpA4 protein was excised from the gel and used for immunization of mice to produce mouse polyclonal mouse antiserum. The Hcp4 and Pgi antisera were made in our previous study (Zhang et al., 2011).

Electrophoretic mobility shift assay (EMSA) EMSA was performed with reference to the method described by Hu and colleagues (2009) with modifications. Briefly, DNA probes (292 bp T6SS4p fragments with or without binding site mutations) were amplified from the T6SS4 promoter region of corresponding pDM4-T6SS4p::lacZ reporter vectors (Supplementary Table S1) by using primers T6SS4pO-F and T6SS4p-O-R. The reaction mixture (20 ml) contained 20 mM Tris/HCl (pH 7.4), 4 mM MgCl2, 100 mM NaCl, 1 mM dithiothreitol, 10% (v/v) glycerol, 0.5 mg of poly(dI-dC), 100 ng of BSA, 200 ng of DNA probes and 0–400 ng of OmpR protein. For phosphorylation of OmpR, 100 mM acetyl phosphate (acetyl-P, Sigma) was added to the reaction mixture. OmpR phosphorylation and binding to probes were performed at 37°C for 1 h. As a negative control, a 300 bp fragment from the T6SS4 coding region amplified with primers Control-F and Control-R was included in the binding

assays. The samples were then loaded onto a 7.0% native polyacrylamide gel. Electrophoresis was carried out in 0.5¥ TBE buffer for 4 h on ice. The DNA bands were visualized by staining the gels with ethidium bromide.

Acid survival assays Acid survival assays were performed based upon the method proposed by Hu and colleagues (2009) with minor modifications as follows: stationary-phase overnight cultures of Y. pseudotuberculosis strains grown in YLB medium at 26°C were diluted 40-fold with M9 medium (Na2HPO4, 6 g l-1; KH2PO4, 3 g l-1; NaCl, 0.5 g l-1; NH4Cl, 1 g l-1; MgSO4, 1 mM; CaCl2, 0.1 mM; glucose, 0.2%) adjusted to pH 4.0 and kept incubated at 37°C for 2 h. The cultures were serially diluted and plated onto M9 agar plates, and colonies were counted after 48 h growth at 26°C. Percentage survival was calculated as follows: [(cfu ml-1 after challenge at different stresses)/(cfu ml-1 at pH 7.0 before stresses challenge)] ¥ 100.

Intracellular pH measurement with GFP reporter plasmid and BCECF Intracellular pH of Y. pseudotuberculosis was measured by using GFPmut3*, a pH-sensitive green fluorescent protein, as described (Wilks and Slonczewski, 2007; Kitko et al., 2009). The plasmid pKEN-GFPmut3* (Wilks and Slonczewski, 2007) was introduced into DompR, Dhcp4 and DclpV4 and intracellular pH (pHi) was measured with a spectro-max spectrofluorimeter. For pHi measurement, the cultures were resuspended to an OD600 of 0.4 in M9 medium. The pHo was adjusted with HCl to pH 5.0–7.0, depending on the experiment. The emission was measured at 545 nm, with an excitation wavelength of 480 nm. To measure pHi recovery following HCl addition, spectra were recorded every 20 s after the addition of 10 mM HCl to the culture of YpIII and mutants containing the plasmid pKEN-GFPmut3*. Fluorescence intensity was correlated with pH based on a standard curve made for changes of GFP fluorescence signal at different pHs. The standard curve (Fig. S2A) was determined by obtaining fluorescence measurements of samples resuspended at pH 5.5, 6.0, 7.0, 7.5 and 8.0 solutions containing 1 mM carbonyl cyanide m-chlorophenyl-hydrazone that equilibrates cytoplasmic pH with external pH (Olsen et al., 2002). Data were fitted to the standard curve correlating internal pH with fluorescence intensity. The pHi of YpIII (pBS-vgrG4GFP), YpIII(pBS-vgrG4His) and YpIII(pBS) were measured with 2′,7′-biscarboxyethyl-5,6-carboxyfluorescein (BCECF) as described previously (Breeuwer et al., 1996). The cells were loaded with the acetoxymethyl ester form of the probe (BCECF-AM) at room temperature. BCECF-loaded cells were then pelleted and suspended in M9 medium. Fluorescence intensities were monitored at 527 nm, with excitation wavelengths of 480 nm (peak fluorescene) and 435 nm (isosbestic fluorescene) respectively. The ratio (peak/ isosbestic) was calibrated to pHi by means of the high K+-nigericin technique (Bidani et al., 1989; 1994). The standard curve (Fig. S2B) correlating the ratio and the pHi was made and K+-nigericin was used to equilibrate cytoplasmic pH with external pH. Spectra were recorded for three biological replicates for each condition.


Role of T6SS in acid resistance +

H efflux experiment H+ efflux experiment was carried out with acid loaded cells based on reported proton transport protocols (Sachs et al., 1976; Graça da Silveira et al., 2002; Campos et al., 2009). The cells of the wild-type strain YpIII and the mutant DclpV4 were grown at 26°C in YLB medium (pH 7.0) to an OD600 of 2.5 and then transferred to YLB medium (pH 5.0) allowing acid loading. After grown in pH 5.0 for 12 h, acid loaded cells were harvested by centrifugation at 4000 g for 10 min. Equal amount of acid loaded cells were washed twice with ice-cold deionized water and then suspended in 40 ml of deionized water containing 0.2% glucose at a turbidity of 0.5 at 600 nm. The suspension was mixed with a stir bar at room temperature. The pH change was measured with a Mettler Toledo (Zürich Switzerland) FE20 pH meter.

Acknowledgements We thank Prof. Zhao-Qing Luo (Purdue University, West Lafayette, IN, USA) and Prof. Luying Xun (Washington State University, Pullman, WA, USA) for critical reading of the manuscript and for their helpful comments. We are grateful to Prof. Paul Williams, Prof. Miguel Cámara, Dr Steve Atkinson (University of Nottingham, Nottingham, UK) and Dr Yangbo Hu (Wuhan Institute of Virology, CAS, Wuhan, China) for their generous gift of strains or plasmids. This work was supported by the National Natural Science Foundation of China (31170100, 31170121 and 31270078) and the Specialized Research Fund for the Doctoral Program of Higher Education of China (20110204120023).

References Akeda, Y., and Galán, J.E. (2005) Chaperone release and unfolding of substrates in type III secretion. Nature 437: 911–915. Atkinson, S., Throup, J.P., Stewart, G.S., and Williams, P. (1999) A hierarchical quorum-sensing system in Yersinia pseudotuberculosis is involved in the regulation of motility and clumping. Mol Microbiol 33: 1267–1277. Baker-Austin, C., and Dopson, M. (2007) Life in acid: pH homeostasis in acidophiles. Trends Microbiol 15: 165– 171. Bang, I.S., Kim, B.H., Foster, J.W., and Park, Y.K. (2000) OmpR regulates the stationary-phase acid tolerance response of Salmonella enterica serovar typhimurium. J Bacteriol 182: 2245–2252. Bang, I.S., Audia, J.P., Park, Y.K., and Foster, J.W. (2002) Autoinduction of the ompR response regulator by acid shock and control of the Salmonella enterica acid tolerance response. Mol Microbiol 44: 1235–1250. Basler, M., Pilhofer, M., Henderson, G.P., Jensen, G.J., and Mekalanos, J.J. (2012) Type VI secretion requires a dynamic contractile phage tail-like structure. Nature 483: 182–186. Bidani, A., Brown, S.E., Heming, T.A., Gurich, R., and Dubose, T.D., Jr (1989) Cytoplasmic pH in pulmonary macrophages: recovery from acid load is Na+ independent and NEM sensitive. Am J Physiol 257: C65–C76.

567

Bidani, A., Brown, S.E., and Heming, T.A. (1994) pHi regulation in alveolar macrophages: relative roles of Na+-H+ antiport and H+-ATPase. Am J Physiol 266: L681– L688. Bingle, L., Bailey, C., and Pallen, M. (2008) Type VI secretion: a beginner’s guide. Curr Opin Microbiol 11: 3–8. Bönemann, G., Pietrosiuk, A., Diemand, A., Zentgraf, H., and Mogk, A. (2009) Remodelling of VipA/VipB tubules by ClpV-mediated threading is crucial for type VI protein secretion. EMBO J 28: 315–325. Boyer, F., Fichant, G., Berthod, J., Vandenbrouck, Y., and Attree, I. (2009) Dissecting the bacterial type VI secretion system by a genome wide in silico analysis: what can be learned from available microbial genomic resources? BMC Genomics 10: 104. Bradford, M.M. (1976) A dye binding assay for protein. Anal Biochem 72: 248–254. Breeuwer, P., Drocourt, J., Rombouts, F.M., and Abee, T. (1996) A novel method for continuous determination of the intracellular pH in bacteria with the internally conjugated fluorescent probe 5 (and 6-)-carboxyfluorescein succinimidyl ester. Appl Environ Microbiol 62: 178–183. Brown, J.D., Saini, S., Aldridge, C., Herbert, J., Rao, C.V., and Aldridge, P.D. (2008) The rate of protein secretion dictates the temporal dynamics of flagellar gene expression. Mol Microbiol 70: 924–937. Campos, F.M., Couto, J.A., Figueiredo, A.R., Tóth, I.V., Rangel, A.O.S., and Hogg, T.A. (2009) Cell membrane damage induced by phenolic acids on wine lactic acid bacteria. Int J Food Microbiol 135: 144–151. Cascales, E. (2008) The type VI secretion toolkit. EMBO Rep 8: 735–741. Cathelyn, J.S., Crosby, S.D., Lathem, W.W., Goldman, W.E., and Miller, V.L. (2006) RovA, a global regulator of Yersinia pestis, specifically required for bubonic plague. Proc Natl Acad Sci USA 103: 13514–13519. Dalbey, R.E., and Kuhn, A. (2012) Protein traffic in gramnegative bacteria – how exported and secreted proteins find their way. FEMS Microbiol Rev 36: 1023–1045. Ding, L., Wang, Y., Hu, Y., Atkinson, S., Williams, P., and Chen, S. (2009) Functional characterization of FlgM in the regulation of flagellar synthesis and motility in Yersinia pseudotuberculosis. Microbiology 155: 1890–1900. Egger, L.A., and Inouye, M. (1997) Purification and characterization of the periplasmic domain of EnvZ osmosensor in Escherichia coli. Biochem Biophys Res Commun 231: 68–72. Filloux, A., Hachani, A., and Bleves, S. (2008) The bacterial type VI secretion machine: yet another player for protein transport across membranes. Microbiology 154: 1570– 1583. Flamez, C., Ricard, I., Arafah, S., Simonet, M., and Marceau, M. (2008) New insights into two-component system regulon plasticity in bacteria. Int J Med Microbiol 298: 193– 207. Galán, J.E. (2008) Energizing type III secretion machines: what is the fuel? Nat Struct Mol Biol 15: 127–128. Goldová, J., Ulrych, A., Hercík, K., and Branny, P. (2011) A eukaryotic-type signalling system of Pseudomonas aeruginosa contributes to oxidative stress resistance, intracellular survival and virulence. BMC Genomics 12: 437.


568 W. Zhang et al. Graça da Silveira, M., Vitória San Romão, M., Loureiro-Dias, M.C., Rombouts, F.M., and Abee, T. (2002) Flow cytometric assessment of membrane integrity of ethanol-stressed Oenococcus oeni cells. Appl Environ Microbiol 68: 6087– 6093. Harold, F.M. (1977) Membranes and energy transduction in bacteria. Curr Top Bioenerg 6: 83–149. Head, C.G., Tardy, A., and Kenney, L.J. (1998) Relative binding affinities of OmpR and OmpR-phosphate at the ompF and ompC regulatory sites. J Mol Biol 281: 857–870. Holland, I.B. (2010) The extraordinary diversity of bacterial protein secretion mechanisms. Methods Mol Biol 619: 1–20. Hood, R.D., Singh, P., Hsu, F., Güvener, T., Carl, M.A., Trinidad, R.R., et al. (2010) A type VI secretion system of Pseudomonas aeruginosa targets a toxin to bacteria. Cell Host Microbe 7: 25–37. Hu, Y., Lu, P., Wang, Y., Ding, L., Atkinson, S., and Chen, S. (2009) OmpR positively regulates urease expression to enhance acid survival of Yersinia pseudotuberculosis. Microbiology 155: 2522–2531. Hu, Y., Lu, P., Zhang, Y., Li, L., and Chen, S. (2010) Characterization of an aspartate-dependent acid survival system in Yersinia pseudotuberculosis. FEBS Lett 584: 2311– 2314. Hu, Y., Lu, P., Zhang, Y., Li, Y., Li, L., Huang, L., et al. (2011) Cra negatively regulates acid survival in Yersinia pseudotuberculosis. FEMS Microbiol Lett 317: 190–195. Huang, K.J., Schieberl, J.L., and Igo, M.M. (1994) A distant upstream site involved in the negative regulation of the Escherichia coli ompF gene. J Bacteriol 176: 1309–1315. Ishikawa, T., Sabharwal, D., Bröms, J., Milton, D.L., Sjöstedt, A., Uhlin, B.E., et al. (2012) Pathoadaptive conditional regulation of the type VI secretion system in Vibrio cholerae O1 strains. Infect Immun 80: 575–584. Jani, A.J., and Cotter, P.A. (2010) Type VI secretion: not just for pathogenesis anymore. Cell Host Microbe 8: 2–6. Kitko, R.D., Cleeton, R.L., Armentrout, E.I., Lee, G.E., Noguchi, K., Berkmen, M.B., et al. (2009) Cytoplasmic acidification and the benzoate transcriptome in Bacillus subtilis. PLoS ONE 4: e8255. Krulwich, T.A., Sachs, G., and Padan, E. (2011) Molecular aspects of bacterial pH sensing and homeostasis. Nat Rev Microbiol 9: 330–343. Kuhnert, W.L., Zheng, G., Faustoferri, R.C., and Quivey, R.G. Jr (2004) The F-ATPase operon promoter of Streptococcus mutans is transcriptionally regulated in response to external pH. J Bacteriol 186: 8524–8528. Lee, J., and Harshey, R.M. (2012) Loss of FlhE in the flagellar Type III secretion system allows proton influx into Salmonella and Escherichia coli. Mol Microbiol 84: 550–565. Ma, A.T., McAuley, S., Pukatzki, S., and Mekalanos, J.J. (2009) Translocation of a Vibrio cholerae type VI secretion effector requires bacterial endocytosis by host cells. Cell Host Microbe 5: 234–243. Ma, L.S., Narberhaus, F., and Lai, E.M. (2012) The IcmFfamily protein TssM exhibits ATPase activity and energizes type VI secretion. J Biol Chem 287: 15610–15621. Matsui, R., and Cvitkovitch, D. (2010) Acid tolerance mechanisms utilized by Streptococcus mutans. Future Microbiol 5: 403–417.

Miller, J.H. (1992) A Short Course in Bacterial Genetics: A Laboratory Manual and Handbook for Escherichia coli and Related Bacteria. Cold Spring Harbor, NY, USA: Cold Spring Harbor Laboratory Press. Minamino, T., Morimoto, Y.V., Hara, N., and Namba, K. (2011) An energy transduction mechanism used in bacterial flagellar type III protein export. Nat Commun 2: 475. Mougous, J.D., Cuff, M.E., Raunser, S., Shen, A., Zhou, M., Gifford, C.A., et al. (2006) A virulence locus of Pseudomonas aeruginosa encodes a protein secretion apparatus. Science 312: 1526–1530. Olsen, K.N., Budde, B.B., Siegumfeldt, H., Rechinger, K.B., Jakobsen, M., and Ingmer, H. (2002) Noninvasive measurement of bacterial intracellular pH on a single-cell level with green fluorescent protein and fluorescence ratio imaging microscopy. Appl Environ Microbiol 68: 4145– 4147. Pieper, R., Huang, S.T., Robinson, J.M., Clark, D.J., Alami, H., Parmar, P.P., et al. (2009) Temperature and growth phase influence the outer-membrane proteome and the expression of a type VI secretion system in Yersinia pestis. Microbiology 155: 498–512. Pukatzki, S., McAuley, S.B., and Miyata, S.T. (2009) The type VI secretion system: translocation of effectors and effectordomains. Curr Opin Microbiol 12: 11–17. Robinson, J.B., Telepnev, M.V., Zudina, I.V., Bouyer, D., Montenieri, J.A., Bearden, S.W., et al. (2009) Evaluation of a Yersinia pestis mutant impaired in a thermoregulated type VI-like secretion system in flea, macrophage and murine models. Microb Pathog 47: 243–251. Sachs, G., Chang, H.H., Rabon, E., Schackman, R., Lewin, M., and Saccomani, G. (1976) A nonelectrogenic H+ pump in plasma membranes of Hog Stomach. J Biol Chem 251: 7690–7698. Sánchez, B., de los Reyes-Gavilán, C.G., and Margolles, A. (2006) The F1F0-ATPase of Bifidobacterium animalis is involved in bile tolerance. Environ Microbiol 8: 1825– 1833. Schell, M.A., Ulrich, R.L., Ribot, W.J., Brueggemann, E.E., Hines, H.B., Chen, D., et al. (2007) Type VI secretion is a major virulence determinant in Burkholderia mallei. Mol Microbiol 64: 1466–1485. Schlieker, C., Zentgraf, H., Dersch, P., and Mogk, A. (2005) ClpV, a unique Hsp100/Clp member of pathogenic proteobacteria. Biol Chem 386: 1115–1112. Schwarz, S., West, T.E., Boyer, F., Chiang, W.C., Carl, M.A., Hood, R.D., et al. (2010) Burkholderia type VI secretion systems have distinct roles in eukaryotic and bacterial cell interactions. PLoS Pathog 6: e1001068. Sexton, J.A., Miller, J.L., Yoneda, A., Kehl-Fie, T.E., and Vogel, J.P. (2004) Legionella pneumophila DotU and IcmF are required for stability of the Dot/Icm complex. Infect Immun 72: 5983–5992. Smego, R.A., Frean, J., and Koornhof, H.J. (1999) Yersiniosis I: microbiological and linicoepidemiological aspects of plague and non-plague Yersinia infections. Eur J Clin Microbiol Infect Dis 1: 1–15. Stincone, A., Daudi, N., Rahman, A.S., Antczak, P., Henderson, I., Cole, J., et al. (2011) A systems biology approach sheds new light on Escherichia coli acid resistance. Nucleic Acids Res 39: 7512–7528.


Role of T6SS in acid resistance Stingl, K., and De Reuse, H. (2005) Staying alive overdosed: how does Helicobacter pylori control urease activity? Int J Med Microbiol 295: 307–315. Suarez, G., Sierra, J.C., Sha, J., Wang, S., Erova, T.E., Fadl, A.A., et al. (2008) Molecular characterization of a functional type VI secretion system from a clinical isolate of Aeromonas hydrophila. Microb Pathog 44: 344–361. Vandal, O.H., Nathan, C.F., and Ehrt, S. (2009) Acid resistance in Mycobacterium tuberculosis. J Bacteriol 191: 4714–4721. Weber, B., Hasic, M., Chen, C., Wai, S.N., and Milton, D.L. (2009) Type VI secretion modulates quorum sensing and stress response in Vibrio anguillarumemi. Environ Microbiol 11: 3018–3048. Wilks, J.C., and Slonczewski, J.L. (2007) pH of the cytoplasm and periplasm of Escherichia coli: rapid measurement by green fluorescent protein fluorimetry. J Bacteriol 189: 5601–5607. Yoshida, T., Qin, L., Egger, L.A., and Inouye, M. (2006) Transcription regulation of ompF and ompC by a single transcription factor, OmpR. J Biol Chem 281: 17114–17123. Zhang, W.P., Xu, S.J., Li, J., Shen, X.H., Wang, Y., and Yuan, Z. (2011) Modulation of a thermoregulated type VI secretion system by AHL-dependent Quorum Sensing in Yersinia pseudotuberculosis. Arch Microbiol 193: 351–363. Zheng, J., and Leung, K.Y. (2007) Dissection of a type VI secretion system in Edwardsiella tarda. Mol Microbiol 66: 1192–1206.

Supporting information Additional Supporting Information may be found in the online version of this article: Fig. S1. Putative OmpR binding sites O1, O2 and O3 (marked in red) in the T6SS4 promoter region. The ATG start codon of the first ORF of T6SS4 operon was also marked in red. Letters underlined denote the sequences used to replace the three binding regions (M1, M2 and M3).

569

Fig. S2. A. Standard curves made for changes in the excitation/emission wavelengths for GFP fluorescence at different pHs. pH dependence of fluorescence of GFPmut3* in wild-type strain YpIII, DclpV4, Dhcp4 and DompR were measured. The fluorescence intensity was measured in a microplate fluorometer as described in Experimental procedures. pHi and pHo were equilibrated by incubation with carbonyl cyanide m-chlorophenyl-hydrazone (1 mM). B. Standard curve made for changes in the ratio of 480 nm (peak fluorescene) and 435 nm excitation wavelengths for BCECF at different pHs. pH dependence of fluorescence of BCECF in wild-type strain YpIII containing plasmid pBS was measured. pHi and pHo were equilibrated by incubation with K+ and nigericin as described in Experimental procedures. Fig. S3. The ATPase activity of ClpV4 is responsible for Hcp4 secretion. Complementation of the DclpV4 secretion defect by plasmid-encoded ClpV4 and ClpV4M using Hcp4specific antibodies. The metabolic protein phosphoglucose isomerase (Pgi) was probed as a loading control. The Pgi protein was not detected in the culture supernatant, indicating that the secretion of Hcp4 was not a consequence of cell lysis. Sup: culture supernatant; Pellet: total cell pellet. Fig. S4. A. Western blot analysis of VgrG4His production and secretion in the wild type, hcp4 and clpV4 mutants containing pBS-VgrG4His after growing to early stationary phase at 26°C using an anti-His monoclonal antibody. B. Overexpression of vgrG4GFP prevents secretion of Hcp4. Western blot detection of Hcp4 expression and secretion in the strains YpIII wild type, YpIII(pBS-vgrG4GFP) and YpIII(pBS-vgrG4His). The metabolic protein phosphoglucose isomerase (Pgi) was probed as a loading control. The Pgi protein was not detected in the culture supernatant, indicating that the secretion of Hcp4 was not a consequence of cell lysis. Sup: culture supernatant; Pellet: total cell pellet. Table S1. Bacterial strains and plasmids used in this study. Table S2. Primers used in this study.
