SpoT Homolog, in Stringent

INFECTION AND IMMUNITY, May 2010, p. 1873–1883 0019-9567/10/$12.00 doi:10.1128/IAI.01439-09 Copyright © 2010, American Society for Microbiology. All Rights Reserved.

Vol. 78, No. 5

Role of the (p)ppGpp Synthase RSH, a RelA/SpoT Homolog, in Stringent Response and Virulence of Staphylococcus aureus䌤 Tobias Geiger,1 Christiane Goerke,1 Michaela Fritz,1 Tina Scha¨fer,2 Knut Ohlsen,2 Manuel Liebeke,3 Michael Lalk,3 and Christiane Wolz1* Interfaculty Institute of Microbiology and Infection Medicine, University of Tu ¨bingen, Tu ¨bingen,1 Institute for Molecular Infection Biology, University of Wu ¨rzburg, Wu ¨rzburg,2 and Institute of Pharmaceutical Biology, Ernst-Moritz-Arndt University, Greifswald,3 Germany Received 23 December 2009/Returned for modification 22 January 2010/Accepted 25 February 2010

In most bacteria, nutrient limitations provoke the stringent control through the rapid synthesis of the alarmones pppGpp and ppGpp. Little is known about the stringent control in the human pathogen Staphylococcus aureus, partly due to the essentiality of the major (p)ppGpp synthase/hydrolase enzyme RSH (RelA/SpoT homolog). Here, we show that mutants defective only in the synthase domain of RSH (rshsyn) are not impaired in growth under nutrient-rich conditions. However, these mutants were more sensitive toward mupirocin and were impaired in survival when essential amino acids were depleted from the medium. RSH is the major enzyme responsible for (p)ppGpp synthesis in response to amino acid deprivation (lack of Leu/Val) or mupirocin treatment. Transcriptional analysis showed that the RSH-dependent stringent control in S. aureus is characterized by repression of genes whose products are predicted to be involved in the translation machinery and by upregulation of genes coding for enzymes involved in amino acid metabolism and transport which are controlled by the repressor CodY. Amino acid starvation also provoked stabilization of the RNAs coding for major virulence regulators, such as SaeRS and SarA, independently of RSH. In an animal model, the rshsyn mutant was shown to be less virulent than the wild type. Virulence could be restored by the introduction of a codY mutation into the rshsyn mutant. These results indicate that stringent conditions are present during infection and that RSH-dependent derepression of CodY-regulated genes is essential for virulence in S. aureus. are composed of a C-terminal regulatory and an N-terminal enzymatic domain. Structural data indicate two conformations of the enzyme corresponding to the known reciprocal activity states, (p)ppGpp-hydrolase-OFF/(p)ppGpp-synthase-ON and hydrolase-ON/synthase-OFF (23). The C-terminal domain is probably involved in the reciprocal regulation of the two catalytic activities, since truncation of the C-terminal domain enhances the synthase activity of the enzyme (39). Recently, genes coding for additional small (p)ppGpp synthases were identified in most of the firmicutes (41). Overall, there is now growing evidence that there are fundamental differences in (p)ppGpp synthesis, regulation, and molecular function between firmicutes and proteobacteria (56). For instance, in Escherichia coli, binding of (p)ppGpp to the RNA polymerase in concert with the cofactor protein DksA results in the inhibition of the rrn promoters. In firmicutes, DksA is not present and (p)ppGpp does not appear to interact with RNA polymerase (RNAP) directly (27). (p)ppGpp synthesis reduces intracellular GTP levels, and the GTP level in turn seems to directly influence promoter activity in Bacillus subtilis. It was proposed that the nature of the nucleoside triphosphate (NTP) initiating transcription determines whether genes are under positive or negative stringent control (27, 28, 42, 50). For instance, some rrn promoters of B. subtilis initiate with GTP, and a change in the identity of the base at position ⫹1 results in a loss of regulation by (p)ppGpp and GTP. The GTP level is also crucial for the repressive function of the metabolic regulator CodY, at least in some firmicutes (reviewed in reference 47). In B. subtilis, the repressor function

Staphylococcus aureus causes a variety of infections in humans but also asymptomatically colonizes the nose of healthy individuals. Gene expression must be closely coordinated to allow the pathogen to survive and/or multiply in different compartments during infection and colonization. However, knowledge about growth conditions in vivo is still limited, and the interaction of the regulatory circuits leading to metabolic adaptation and to differential expression of virulence factors is not yet understood completely. The stringent control is one of the first known and most intensively studied global systems of gene regulation in bacteria (for previous reviews, see references 6, 8, 10, 18, 19, 25, 35, 46, 48, 52, 56, and 57). It is provoked by the rapid synthesis of the alarmones pppGpp and ppGpp upon nutrient limitation. Alarmone synthesis is linked to many physiological processes involving rRNA degradation, gene activation/repression, protein translation, enzyme activation, and replication. In many pathogenic bacteria, virulence, persistence, and host interaction are also influenced through (p)ppGpp (18). (p)ppGpp is synthesized by cytoplasmic enzymes containing a conserved synthase domain first described in RelA and SpoT enzymes from proteobacteria. In most firmicutes, bifunctional Rel/SpoT homologs (RSHs), which constitute a distinct class of (p)ppGpp synthases (40, 56), are present. They

* Corresponding author. Mailing address: Interfaculty Institute of Microbiology and Infection Medicine, Universita¨t Tu ¨ bingen, Elfriede-Aulhorn-Strasse 6, 72076 Tu ¨ bingen, Germany. Phone: 497071-2980187. Fax: 49-7071-295165. E-mail: christiane.wolz@med .uni-tuebingen.de. 䌤 Published ahead of print on 8 March 2010. 1873

1874

INFECT. IMMUN.

GEIGER ET AL. TABLE 1. Strains and plasmids

Strain or plasmid

Strains Escherichia coli TOP10 S. aureus RN4220 CYL316 HG001 Newman RN4220-21 RN4220-55 Newman-21 Newman-86 Newman-55 HG001-21 HG001-86 HG001-55 HG001-86-21 Plasmids pCR2.1 pMUTIN4 pKOR1 pCL84 pCG55 pCG86 pCG199

Description

Reference/Source

Competent E. coli for plasmid transformation

Invitrogen

Restriction-deficient S. aureus strain, r⫺ RN4220(pYL112⌬19), L54 int gene, r⫺ RN1 (derived from 8325) with rsbU restored, previously named RN1HG Wild type RN4220 codY::tet(M) RN4220 with rsh gene under Pspac control in the chromosome, ermC Newman codY::tet(M) Newman rshsyn (nucleotides 942 to 950 deleted) Newman with rsh gene under Pspac control in the chromosome, ermC HG001 codY::tet(M) HG001 rshsyn (nucleotides 942 to 950 deleted) HG001 with rsh gene under Pspac control in the chromosome, ermC HG001 rshsyn (nucleotides 942 to 950 deleted), codY::tet(M) mutant

29 30 45 14 45 This 45 This This 45 This This This

Cloning vector Integrative vector including the IPTG-inducible promoter Pspac, Apr Emr AHT-inducible suicide mutagenesis vector Single-copy integration vector, att site for chromosomal integration in geh pMUTIN with integration of a 942-bp rsh fragment for conditional mutagenesis pKOR1 with mutated rsh synthase domain (nucleotides 942 to 950 deleted) pCL84 with rsh for complementation

Invitrogen 51 3 30 This work This work This work

of CodY is activated by GTP, which enhances the affinity of CodY to a conserved binding motif in the promoter region of target genes (21). Thus, there is a direct link between stringent control and CodY-mediated gene regulation: lowering of the GTP pool through the induction of stringent controls leads to derepression of CodY target genes (4, 24). However, GTP is an active ligand for CodY in only some of the firmicutes. For instance, CodY from streptococci or lactococci appears not to interact with GTP. Here, branched-chain amino acids are bound by CodY and constitute the primary signals for CodYmediated gene repression (12, 20, 22, 33). In S. aureus, CodY is a potent repressor of genes mainly involved in nitrogen metabolism and transport. Virulence factors are also regulated by CodY, mainly through CodY-dependent repression of the agr system (37, 45). There is strong evidence that isoleucine is the major ligand of CodY in S. aureus, since CodY target genes were derepressed in medium lacking isoleucine (45). Little information is available on stringent control in staphylococci. Interestingly, it could be shown that the RSH homolog is essential for survival in S. aureus (16). Thus, the lack of viable rsh mutants has hampered an in-depth analysis of the stringent response. However, staphylococci mount a stringent response that is characterized by the generation of (p)ppGpp when treated with mupirocin to mimic isoleucine starvation (9). Mupirocin is a potent antimicrobial agent which inhibits the bacterial isoleucyl tRNA synthetase. RSH contains a typical C-terminal domain which may sense the accumulation of uncharged tRNA after amino acid deprivation, leading to a shift toward the synthase-ON/hydrolase-OFF conformation of the bifunctional enzyme (23). Microarray analysis revealed

work work work work work work

that in S. aureus, mupirocin induces transcriptional changes which are similar to those observed in other bacteria, e.g., the upregulation of several classes of gene products, including transport proteins, virulence factors, regulatory molecules, and peptidases (2). However, it is not clear whether all of these changes are due to (p)ppGpp synthesis. Here, we characterize the stringent control elicited by the (p)ppGpp synthase RSH of S. aureus, which is responsible for (p)ppGpp synthesis upon amino acid deprivation. We show that RSH synthase activity is required for derepression of genes of the CodY regulon and for the repression of genes involved in the translation machinery after amino acid limitation. A mutant defective in RSH synthase activity was less virulent in a murine model of kidney infection than the wild type (WT) or the codY rsh double mutant. MATERIALS AND METHODS Strains and growth conditions. Strains and plasmids are listed in Table 1. S. aureus strains were grown in CYPG medium (10 g/liter Casamino acids, 10 g/liter yeast extract, 5 g/liter NaCl, 0.5% glucose, and 0.06 M phosphoglycerate) (43), in B medium (7), or in a chemically defined medium (CDM) (45). For strains carrying resistance genes, antibiotics were used only in precultures at the following concentrations: erythromycin, 10 ␮g/ml, and tetracycline, 5 ␮g/ml. Bacteria from an overnight culture were diluted to an initial optical density at 600 nm (OD600) of 0.05 in fresh medium and grown with shaking (220 rpm) at 37°C to the desired growth phase. For downshift experiments, strains were grown in complete CDM, including leucine/valine (Leu/Val), to an OD600 of 0.5. The cultures were filtered over a 0.22-␮m filter with vacuum and washed twice with sterile phosphate-buffered saline (PBS), and bacteria were resuspended in an equal volume of CDM medium with or without Leu/Val and grown for another 30 min. Determination of MICs and MBCs. Bacteria were grown in Mueller-Hinton broth to the exponential growth phase (OD600 of 0.5, corresponding to 5 ⫻ 108

VOL. 78, 2010

STRINGENT RESPONSE IN STAPHYLOCOCCUS AUREUS

1875

TABLE 2. Oligonucleotides Purpose and description

Mutagenesis Conditional rsh mutant rsh synthase mutant

Complementation rsh with upstream region

Construction of hybridization probes infB guaC rpsL tsf SAOUHSC_02923 sar a b

Template

Namea

Sequenceb

Newman Newman

EcoRIrsh-1151U BamHIrsh-2080L

AAAAGAATTCGTACCTAAATCATTGTTTAAGGCG TTTAGGATCCTCGGTTTCCATAACGTAT

Newman

attB1rsh-U

Newman

rshSyndel2-L

Newman Newman

rsh-2147U attB2rsh1-L

GGGGACAAGTTTGTACAAAAAAGCAGGCTATTAGG CGGTATCGTAGT TCCATTTGGACCTACTACTGTAGTATGCAACAAATT TTGTTTAGGCATT CAGTAGTAGGTCCAAATGGA GGGGACCACTTTGTACAAGAAAGCTGGGTGCTGCG AATAAATCATCTT

Newman Newman

EcoRIrsh-215U KpnIrsh-L

CTAGGAATTCTTGGATAAAGTCACAATT CCCCCGGTACCCTTTGTACAACTACTTTCATATTTTG CACCT

Newman Newman Newman Newman Newman Newman Newman Newman Newman Newman Newman Newman

infBDIG-U infBDIG-L guaCDIG-U guaCDIG-L rpsLDIG-U rpsLDIG-L tsfDIG-U tsfDIG-L SA02923DIG-U SA02923DIG-L sarDIG-U sarDIG-L

ACCAACTTCAAATCCTGATC TGTAATTTCAACAGGCGTTG AACATATGCAAAATTCAGGC GATGCACCAAATCTAATTGA ACCACAAAAACGTGGTGTATGTACT ACACCTGGTAAGTCTCTTACACGTC GTAGAAACTAAAGGTAACGAC ATATTTAGGGTTGATTGCAG GTAAAGCCCAACCAACAGGT TCATCGTAGGTTTAACAGCA CAATGATTGCTTTGAGTTGT CGTTTATTTACTCGACTCAA

U, upper primer; L, lower primer. Artificial restriction sites are underlined.

bacteria/ml). Ten microliters of a 1:100 dilution of the culture were mixed with 80 ␮l of Mueller-Hinton broth and 10 ␮l of mupirocin (0.001 to 10 ␮g/ml) in microtiter plates. Plates were incubated at 37°C for 24 h and 48 h. The MIC was defined as the lowest concentration where no turbidity could be monitored. Bactericidal activity was determined by plating the dilutions at which no turbidity was detected. The minimal bactericidal concentration (MBC) was defined as the minimal concentration at which no colonies could be recovered. MICs toward vancomycin and ciprofloxacin were determined using an Etest as described by the manufacturer (AB-Biodisk, Solna, Sweden). Construction of mutant strains and complementation. A conditional rsh mutant was generated using the pMUTIN4 vector (51). With this system, conditional mutants can be obtained by integrating the vector upstream of the target gene, which falls under the control of the isopropyl-␤-D-thiogalactopyranoside (IPTG)-inducible promoter Pspac carried by pMUTIN4. For this purpose, a 942-bp internal fragment of the rsh gene containing the native ribosomal binding site was amplified from strain Newman by employing the primers listed in Table 2. The amplicon was cloned into the EcoRI/BamHI restriction sites of pMUTIN4 to yield pCG55. The vector was transferred into the restriction-deficient strain RN4220 under IPTG induction. Since the vector cannot replicate in Grampositive bacteria, pMUTIN4 inserts into the chromosome via a single crossover event by erythromycin selection. The conditional rsh mutant strain (RN4220-55) obtained was verified by PCR and pulsed-field gel electrophoresis (PFGE). The mutation was transduced into S. aureus strain Newman or HG001 using ⌽11 lysates of strain RN4220-55 (Table 1). Transductants were verified by PCR and PFGE. The markerless rshsyn mutant was obtained using the pKOR1 system (3). A deletion in the synthase domain of rsh was introduced by overlapping PCR employing the primers listed in Table 2. The amplicon obtained was moved into pKOR1 using the Gateway cloning system (Invitrogen). The resulting plasmid (pCG86) was verified and transformed into RN4220, from which it was transduced into the different S. aureus strains. Mutagenesis was performed as de-

scribed previously (3). Mutation of the synthase domain of RSH in strains HG001 and Newman was verified by sequence analysis, and the mutants were designated HG001-86 and Newman-86, respectively (Table 1). For complementation, the rsh gene along with a 960-bp upstream region was amplified with the oligonucleotides listed in Table 2 and cloned into the pCR2.1 cloning vector (Invitrogen). The insert was subcloned into the EcoRI site of the integration vector pCL84, yielding plasmid pCG199. The plasmid was used to transform strain CYL316, from which it was transduced into the rshsyn mutant strains (Table 1). RNA isolation, Northern blot analysis, and determination of transcript stability. RNA isolation and Northern blot analysis were performed as described previously (20). Briefly, bacteria were lysed in 1 ml of Trizol reagent (Invitrogen Life Technologies, Karlsruhe, Germany) with 0.5 ml of zirconia-silica beads (0.1-mm diameter) in a high-speed homogenizer (Savant Instruments, Farmingdale, NY). RNA was isolated as described in the instructions provided by the manufacturer of Trizol. Digoxigenin (DIG)-labeled probes for the detection of specific transcripts were generated using a DIG-labeling PCR kit following the manufacturer’s instructions (Roche Biochemicals). Oligonucleotides used for probe generation were as described previously (36, 45) or are listed in Table 2. For determination of transcript stabilities, strains were grown and shifted in CDM with and without Leu/Val as described above. Rifampin (500 ␮g/ml) was added to the cultures for the times indicated in Fig. 8B. At the different time points, RNAs were isolated and Northern blot analyses were performed as described above. Quantitative measurement of the intracellular GTP and (p)ppGpp pools. S. aureus wild-type strain HG001 and its isogenic mutants were grown in CDM to an OD600 of 0.5. Cells were shifted to CDM containing 0.5 ␮g/ml mupirocin or to CDM without Leu/Val as described above. Samples for intracellular metabolite analysis were harvested directly before and 30 min after shift by fast filtration over a 0.22-␮m sterile filter with vacuum. Cells were washed and quenched, and metabolites were extracted as described recently (13, 39a). De-

1876

GEIGER ET AL.

INFECT. IMMUN.

FIG. 1. (A) Growth of conditional rsh mutant (HG001-55) in CYPG medium with increasing concentrations of the inducer IPTG. (B) Growth of strain HG001 (circle), the rshsyn mutant (square), and the conditional rsh mutant (triangle) in CYPG without IPTG.

tection of nucleotides was performed by ion-pairing liquid chromatography–mass spectrometry (IP-LC-MS) (13). Quantification of compounds was done by referring to the internal standard Br-ATP in all samples. Identification and calibration curves for all metabolites were achieved by measuring pure standard compounds, with the exception of pppGpp, for which no chemical standard was commercially available. For this, the precise mass of pppGpp was calculated and compared with the mass found ([M ⫺ H⫹]calculated ⫽ 681.911 versus [M ⫺ H⫹]detected ⫽ 681.910). Quantification of pppGpp was done by adopting the calibration values from ppGpp, due to the analogous structure. The results of the intracellular metabolite measurements represent the means of 4 biological replicates and were normalized to the cellular dry weight. Detection of (p)ppGpp accumulation in S. aureus cells. The cells were grown in a modified low-phosphate CDM (0.4 mM phosphate, buffered at a pH of 7.2 with 40 mM MOPS [morpholinepropanesulfonic acid]) to an OD600 of 0.5, at which point [32P]H3PO4 (50 ␮Ci/ml) was added to the cultures. After 3 h of growth, the cells were shifted into CDM containing 0.5 ␮g/ml mupirocin or into CDM with and without Leu/Val for an additional 30 min. For the shift experiments, the bacteria were filtered using a 0.22-␮m sterile filter with vacuum, washed twice with sterile 1% PBS, and resuspended in the appropriate medium. For the extraction of nucleotides, 200 ␮l ice-cold 2 M formic acid was added per ml of culture, followed by incubation for 30 min on ice. The bacteria were lysed with 0.5 ml of zirconia-silica beads (0.1-mm diameter) in a high-speed homogenizer, and the extracts were centrifuged at 12,000 ⫻ g for 5 min at 4°C. An equal volume of phenol-chloroform-isoamyl alcohol (50:49:1 [vol/vol/vol]) saturated with deionized water was added to the resulting supernatant. The mixture was agitated and centrifuged at 12,000 ⫻ g for 5 min at 4°C. Ten microliters of the resulting supernatant were spotted onto a polyethyleneimine-cellulose thin-layer sheet (Macherey&Nagel). For the one-dimensional thin-layer chromatography (TLC) analysis, 1.2 M KH2PO4 (pH 3.5) was used as the chromatographic solvent. Mouse infection studies. Female BALB/c mice (16 to 18 g) were purchased from Charles River (Sulzfeld, Germany), housed in polypropylene cages, and given food and water ad libitum. S. aureus isolates were cultured for 18 h in B medium, washed three times with sterile PBS, and suspended in sterile PBS to 3 ⫻ 107 CFU/100 ␮l. As a control, selected dilutions were plated on B agar. Mice were inoculated with 100 ␮l of S. aureus via the tail vein. Control mice were treated with sterile PBS. Ten mice were used for each strain. Five days after challenge, kidneys were aseptically harvested and used for CFU enumeration and histological analysis, respectively. For the CFU count, organs of 7 mice were homogenized in 3 ml of PBS using Dispomix (Bio-Budget Technologies GmbH, Krefeld, Germany). Serial dilutions of the organ homogenates were cultured on mannitol salt-phenol red agar plates for at least 48 h at 37°C. CFU were calculated as CFU/organ. The statistical significance of the bacterial load was determined using a Mann Whitney test. For thin sections of kidney tissues, the kidneys of intravenously (i.v.) infected mice were removed, embedded in O.C.T Tissue Tek (Vogel, Gießen, Germany), and shock frozen in liquid nitrogen. Five-micrometer cryosections were thin sliced, mounted on Superfrost slides (Langenbrinck, Emmendingen, Germany), and stored at ⫺80°C until use. For staphylococcal protein A staining, slides were dried and subsequently fixed with prechilled acetone for 5 min. Endogenous peroxidase was blocked with 30% H2O2/methanol for 5 min. Slides were incu-

bated with rabbit IgG (Dianova, Hamburg, Germany) (11 mg/ml) diluted 1:100 in 10% fetal calf serum (FCS)–PBS, followed by incubation with a peroxidasecoupled goat anti-rabbit IgG (Fab)2 fragment (Dianova) diluted 1:100 in 10% FCS. As substrate, 0.1% diaminobenzidine–tetrahydrochloride (AppliChem, Darmstadt, Germany) dissolved in PBS was used. Tissue was counterstained with Mayer’s hematoxylin (Merck, Darmstadt, Germany). Slides were embedded in Roti-Histokitt (Carl-Roth, Karlsruhe, Germany) and dried overnight. Images were captured with an Olympus BX51 microscope equipped with a digital DP71 camera, and images were processed using CellB software (Olympus, Leinfelden, Germany).

RESULTS Hydrolase activity determines the essentiality of RSH in S. aureus. In each of the sequenced S. aureus genomes, three genes with significant homology to the (p)ppGpp synthase domain of RelA from E. coli can be identified. SAOUHSC_02811 and SAOUHSC_00942 code for small proteins with a putative (p)ppGpp synthase domain only; due to sequence homology with proteins characterized in Streptococcus mutans (32), these are designated relP and relQ, respectively. SAOUHSC_01742 shows a high degree of homology to (p)ppGpp synthases of other firmicutes, as well as to both the N-terminal and Cterminal domains of RelA and SpoT from E. coli. In accordance with the nomenclature used in recent reviews (46, 56), we will refer to this enzyme as RSH. Previous attempts to disrupt the rsh gene in S. aureus failed, indicating that RSH is essential for growth and/or survival in this organism (16). Therefore, we first constructed conditional mutants using the pMUTIN4 vector system. pMUTIN4 is a suicide vector that allows a gene in the chromosome to be connected to the IPTG-inducible Pspac promoter (51). A 5⬘ rsh fragment was cloned into pMUTIN4 and transformed into S. aureus. The plasmid integrated into the chromosomal rsh gene, creating a Pspac-rsh fusion in which rsh transcription can be controlled by IPTG. As expected, the conditional mutant strains were not able to grow without the addition of IPTG to the medium, supporting the essentiality of the rsh gene product for the growth of S. aureus (Fig. 1). An IPTG dose-dependent increase of the growth rate could be observed (Fig. 1A). Based on results obtained by analyzing (p)ppGpp synthases in proteobacteria, we hypothesized that in the RSH enzyme, the hydrolase domain but not the synthase domain is important

VOL. 78, 2010


1877

FIG. 2. RSH-dependent (p)ppGpp synthesis after amino acid deprivation. (A and B) 32P-labeled nucleotides of formic acid extracts of S. aureus were detected by thin-layer chromatography. Strain HG001 (WT) and the rshsyn mutant were grown to exponential phase, followed by the addition of mupirocin (0.5 ␮g/ml) (A) or by Leu/Val starvation (B). (C) Measurement of intracellular nucleotide pool by LC-MS of S. aureus extracts before (zero minutes [0⬘]) and 30 min after mupirocin (0.5 ␮g/ml) treatment or Leu/Val downshift (⫺Leu/Val). The level of significance was determined by the two-sided Student’s t test (P ⬍ 0.05).

for viability. E. coli exhibits the bifunctional enzyme SpoT with a (p)ppGpp synthase and a hydrolase domain and the monofunctional enzyme RelA with synthase activity only. It was shown that it is impossible to obtain a spoT mutant in a relApositive background (58). This indicates that the hydrolase activity of SpoT is essential to degrade the otherwise RelAdependent toxic accumulation of (p)ppGpp in the cell. To obtain an rshsyn mutant, we deleted conserved residues at amino acid (aa) positions 308 to 310 (SAOUHSC_01742) of the synthase domain of RSH. For RSHSeq of Streptococcus dysgalactiae subsp. equisimilis, it could be shown that mutation of any of these residues leads to defective synthase but intact hydrolase activity of the enzyme (23). Deletions of the amino acids YQS in the native chromosomal rsh gene of S. aureus could be readily achieved using markerless chromosomal mutagenesis as described previously (3). In contrast to the conditional rsh mutants, the rshsyn mutants showed no growth defect in complex medium (Fig. 1B) or in CDM (data not shown). Thus, the observation that deletion mutants of rsh are not viable in S. aureus is due to the missing hydrolase activity of RSH. The most plausible explanation is

that RSH is required to detoxify molecules synthesized by alternative (p)ppGpp synthases like RelP or RelQ. RSH is the major enzyme of (p)ppGpp synthesis provoked by amino acid deprivation. We aimed to analyze whether and under which conditions RSH contributes to (p)ppGpp synthesis in S. aureus. RSH contains a typical C-terminal domain which may sense the accumulation of uncharged tRNA after amino acid deprivation, leading to a shift toward synthase-ON/ hydrolase-OFF conformation of the bifunctional enzyme (23). The stringent response was induced by mupirocin in bacteria grown to mid-exponential growth phase in complex medium. Alternatively, bacteria grown in CDM were transferred into CDM lacking leucine and valine. Both amino acids were necessary for optimal growth of S. aureus, and downshift of the strain into medium lacking these amino acids resulted in immediate growth inhibition. After induction of the stringent response, nucleotides were detected in cell extracts by TLC (Fig. 2A and B) and by LC-MS (Fig. 2C). With both methods, the alarmones pppGpp and ppGpp were detectable in the wild type under stringent conditions, with higher concentrations of pppGpp than of ppGpp. The addition of mupirocin elicited a

1878

GEIGER ET AL.

INFECT. IMMUN.

TABLE 3. MICs and MBCs of mupirocina 24 h

48 h

Strain

Newman Newman rshsyn HG001 HG001 rshsyn

MIC

MBC

MIC

MBC

0.32 0.08 0.32 0.08

0.625 0.32 0.625 0.32

0.32 0.16 0.625 0.32

0.625 0.32 1.25 0.32

a Results (␮g/ml) are the means of three independent experiments. MIC and MBC were determined in microtiter plates after incubation for 24 h and 48 h at 37°C.

higher (p)ppGpp synthesis rate than did Leu/Val deprivation. In contrast, neither of the inducing conditions resulted in an increase of (p)ppGpp in the rshsyn mutant. This confirmed the hypothesis that the synthase domain is indeed nonfunctional in the rshsyn mutant. A slight spot corresponding to ppGpp was detectable in the rshsyn mutant by TLC analysis. In LC-MS, a weak signal of ppGpp was also detectable in the rsh mutant under stringent conditions, which might be derived from the activity of RelP and/or RelQ. As expected, a significant decrease in GTP levels was observed after the induction of both stringent conditions in the wild type only and was thus clearly related to the pppGpp synthase activity of RSH. The nucleotide analysis showed that RSH is the major enzyme responsible for the stringent response under amino acidlimited conditions induced by either the addition of mupirocin or Leu/Val deprivation. The response is characterized by synthesis of (p)ppGpp and a decrease of the intracellular GTP pool. RSH synthase is important for adaptation to mupirocin treatment and Leu/Val deprivation. Since RSH is clearly responsible for (p)ppGpp synthesis under conditions of amino acid deprivation, it was of interest whether the growth of the rshsyn mutant was affected under such conditions. First, we tested resistance toward mupirocin. Mupirocin acts as a potent inhibitor of Ile-tRNA synthetase and, as such, mimics isoleucine starvation. rshsyn mutants of strains Newman and HG001, respectively, were both shown to be more sensitive toward mupirocin than the wild types, with up to 4-fold decreases of the MICs and MBCs (Table 3). There was no difference between the rshsyn mutants and the wild types with regard to sensitivity toward other classes of antibiotics (vancomycin and ciprofloxacin) not involved in amino acid availability (data not shown). We next monitored growth in CDM lacking single amino acids. Without Leu/Val, S. aureus strains were strongly inhibited in growth. To test whether RSH is important for survival under these conditions, CFU were determined at the time points indicated in Fig. 3. In medium lacking Leu/Val, the rshsyn mutant showed a significant reduction of CFU/ml compared to the growth of the wild type after 24 h; whereas a slight increase in CFU was observed for the wild type, only 4% of inoculated mutant bacteria were reculturable. Of note, there was no significant drop in the OD600 after 24 h for the rshsyn mutant. This indicates that RSH-dependent (p)ppGpp synthesis is required for bacterial survival under conditions of nutrient limitation.

RSH-dependent repression of target genes after Leu/Val deprivation. Mupirocin treatment and Leu/Val deprivation resulted in the stringent response as indicated by (p)ppGpp synthesis via RSH. This is most probably accompanied by a specific modulation of the transcription of at least some genes. We selected a subset of genes which are hallmarks of the stringent control in other bacteria (15, 26) and were shown in microarray analysis to be repressed in S. aureus after the addition of mupirocin (2). We chose to induce the stringent response via Leu/Val deprivation since this may be a more physiological condition than mupirocin treatment. Northern blot analysis revealed that transcription of infB (coding for translation initiation factor IF-2), guaC (coding for GMP reductase), rpsL (coding for ribosomal protein S12), and tsf (coding for translation elongation factor Ts) was markedly decreased after 30 min of Leu/Val deprivation in the wild type but not in the rshsyn mutant (Fig. 4). The integration of a complete rsh gene into the chromosome of the rshsyn mutant restored the wild-type phenotype (Fig. 4, last lane). Thus, repression of the selected genes after Leu/Val downshift is clearly dependent on RSH synthase activity. RSH-dependent activation of CodY-repressed genes after Leu/Val deprivation. An interaction between CodY and the stringent response was shown in several other firmicutes (4, 24, 33). In S. aureus, several of the genes which were found to be repressed by CodY (45) also appeared to be upregulated after mupirocin treatment (2). For further analysis, we selected 4 operons of the CodY regulon which are preceded by a predicted CodY binding motif: the prototypic ilvDBCleuABC-ilvA operon and ilvE coding for enzymes essential for branched-chain amino acid biosynthesis, brnQ1 coding for a branched-chain amino acid permease, and SAOUHSC_ 02932 coding for a putative amino acid permease. All 4 operons were clearly upregulated after Leu/Val deprivation in the wild type and the rsh-complemented strain but not in the rshsyn mutant strain (Fig. 5). The ongoing repression of the selected genes in the rshsyn mutant is clearly CodY dependent since, in a codY mutant, as well

FIG. 3. Growth and survival of strain HG001 (square) and the rshsyn mutant (triangle) after amino acid deprivation. Bacteria were grown in CDM to exponential phase (OD600 ⫽ 0.5) and shifted into medium with (closed symbols) and without Leu/Val (open symbols). CFU were determined at indicated time points. Values are expressed in relation to the initial CFU before shifting the bacteria.

VOL. 78, 2010

FIG. 4. RSH-dependent repression of target genes. Strain HG001 (WT), the rshsyn mutant, and the mutant complemented with rsh integrated into the chromosome (compl) were grown in CDM to the exponential growth phase (OD600 ⫽ 0.5), followed by further incubation in medium with (⫹) or without (⫺) Leu/Val. RNA was hybridized with digoxigenin-labeled PCR fragments. The 16S rRNA detected in the ethidium bromide-stained gels as a loading control is indicated at the bottom.

as in a codY rshsyn double mutant, these genes are derepressed under all conditions (shown for SAOUHSC_02932) (Fig. 6). In contrast, RSH-repressed genes appeared to be independent of the CodY background, as exemplified by the results for infB.

FIG. 5. RSH-dependent upregulation of target genes. Strain HG001 (WT), the rshsyn mutant, and the complemented mutant (compl) were grown in CDM to the exponential growth phase (OD600 ⫽ 0.5), followed by further incubation in medium with (⫹) or without (⫺) Leu/Val. RNA was hybridized with digoxigenin-labeled PCR fragments. The 16S rRNA detected in the ethidium bromide-stained gels as a loading control is indicated at the bottom.


1879

FIG. 6. RSH interaction with CodY regulation. Strain HG001 (WT), the rshsyn mutant, the complemented rshsyn mutant (compl), the codY mutant, and rshsyn codY double mutants were grown in CDM to the exponential growth phase (OD600 ⫽ 0.5), followed by further incubation in medium with (⫹) or without (⫺) Leu/Val. RNA was hybridized with digoxigenin-labeled PCR fragments. The 16S rRNA detected in the ethidium bromide-stained gels as a loading control is indicated at the bottom.

RSH-independent effects of mupirocin and Leu/Val deprivation on virulence regulators. In other pathogens, it was shown that the stringent control is tightly linked with other regulatory pathways involved in virulence gene expression (18). Thus, we extended our analysis to include the influence of the stringent control on the expression of major virulence regulators, namely, the regulatory RNA III encoded in the quorum sensing system agr, the two-component system saePQRS, and the transcription factor sarA. All three virulence regulators appeared to be upregulated in the wild type and in rshsyn mutants after mupirocin treatment for 30 min (Fig. 7). The

FIG. 7. RSH-independent influence of mupirocin on virulence regulators. Strain HG001, strain Newman, and their corresponding rshsyn mutants were grown in CYPG to the exponential growth phase (OD600 ⫽ 0.5), followed by the addition of mupirocin (0.5 ␮g/ml) for 30 min. RNA was hybridized with digoxigenin-labeled PCR fragments. The 16S rRNA detected in the ethidium bromidestained gels as a loading control is indicated at the bottom.

1880

GEIGER ET AL.

INFECT. IMMUN.

FIG. 8. RSH-independent influence of Leu/Val downshift on virulence regulators is due to enhanced transcript stability. (A) Strain HG001 (WT) and the rshsyn mutant were grown in CDM to the exponential growth phase (OD600 ⫽ 0.5), followed by further incubation in medium with (⫹) or without (⫺) Leu/Val. (B) Bacteria were grown as described for panel A, followed by the addition of rifampin (500 ␮g/ml) for the indicated times (min). RNA was hybridized with digoxigenin-labeled PCR fragments. The 16S rRNA detected in the ethidium bromide-stained gels as a loading control is indicated at the bottom.

elevated levels of transcription of sarA after mupirocin treatment were even more pronounced in the rshsyn mutants. These results indicate that the stimulating effects of mupirocin on virulence regulatory loci are largely independent of (p)ppGpp synthesis via RSH. We next analyzed whether induction of the stringent response via Leu/Val deprivation has an effect similar to that of mupirocin addition (Fig. 8A). In fact, enhanced sarA and sae transcription was observed in the wild type, as well as in the rsh mutant, after shifting the bacteria into medium lacking Leu/ Val for 30 min. We hypothesized that the rsh-independent effects on sae and sarA transcript levels under stringent conditions may be due to transcript stabilization rather than to promoter activation. Therefore, we determined transcript stabilities by treatment with rifampin, an antibiotic which inhibits the de novo synthesis of RNA. Strains at the exponential growth phase were shifted into medium with and without Leu/Val or mupirocin and grown for a further 30 min. Then, rifampin (500 ␮g/ml) was added to the cultures for the times indicated in Fig. 8B. We could confirm that, for instance, the sarA-encoding transcripts are stabilized after Leu/Val downshift (Fig. 8B). A similar stabilization of transcripts was observed after mupirocin treatment (data not shown), which is consistent with the results of Anderson et al. (2). Interaction of rsh and codY for virulence of S. aureus in an animal model. The role of the RSH-mediated stringent response and CodY regulation for virulence was investigated in a hematogenic kidney abscess model with S. aureus HG001, the rshsyn mutant, a codY deletion mutant, and an rshsyn codY double mutant (Fig. 9). Mice were challenged with 3 ⫻ 107 CFU via the tail vein. The body weight of the mice was followed over time, and bacterial loads in kidneys were determined 5 days after infection. Our analysis revealed a significantly lower virulence of the rshsyn mutant than of the wild type (P ⬍ 0.01). In contrast, there was no significant difference between the virulence of the codY mutant or the codY rshsyn double mutant compared to that of the wild type. Similarly, body weight decreased significantly (P ⬍ 0.01) in mice chal-

lenged with the wild type, in contrast to those challenged with the rshsyn mutant (data not shown). Histological analysis of mice challenged with the wild type or the codY rshsyn double mutant showed localized bacteria and infiltrated polymorphonuclear leukocytes in the renal cortex and also in the medulla/ papilla of the kidney (Fig. 10A and B). In both cases, the tissue shows typical signs of hematogenous (pyelo) nephritis. In mice challenged with the rshsyn mutant, the bacterial load was below the detection limit and no polymorphonuclear neutrophilic leukocyte infiltration was observed (Fig. 10C). DISCUSSION In the work presented here, we could confirm previous observations (16) that the bifunctional enzyme RSH is essential for the growth of S. aureus. This is a peculiarity of S. aureus since, in other firmicutes, rsh mutants are viable and have been employed to decipher the basic mechanisms of the stringent control in those organisms (1, 4, 26, 31, 38, 49, 54). The essentiality of RSH in S. aureus is due to its hydrolase activity, since mutants in which only the synthase domain of RSH was inactivated remain viable. This led to the hypothesis that other (p)ppGpp synthases in addition to RSH are active in S. aureus

FIG. 9. Role of RSH in kidney infection model. BALB/c mice (n ⫽ 5) were inoculated with 3 ⫻ 107 CFU of S. aureus strain HG001 (WT), the rshsyn mutant, a codY mutant, or a codY rshsyn double mutant. Bacterial loads in the kidneys were determined as CFU/organ. The bar in each column represents the median CFU count per kidney.

VOL. 78, 2010


1881

FIG. 10. Thin sections of hematoxylin and eosin-stained mouse kidney tissues 5 days after i.v. challenge with WT S. aureus (A), the rshsyn codY mutant (B), or the rshsyn mutant (C). Bacteria appear brown due to peroxidase-labeled protein A. Microabscesses in the kidney were detected in the cortex (A1 and B1, arrows) and medulla (A2 and B2). Magnification of abscesses of the medulla is shown in panels A3 and B3. Polymorphonuclear neutrophilic leukocyte infiltration of the renal pelvis is indicated in panel B2 (arrow). In kidneys of mice challenged with the rshsyn mutant (C1 and C2), the bacterial load was below the detection limit and no signs of infection were detectable.

and that RSH is required to hydrolyze these molecules to prevent a toxic accumulation. (p)ppGpp is probably synthesized by one or both of two additional enzymes (RelP and RelQ) with putative (p)ppGpp synthase activity encoded in the genome of S. aureus. They are highly homologous to enzymes already shown to contribute to (p)ppGpp synthesis in other organisms (32, 41) However, RSH is clearly the main enzyme required for (p)ppGpp synthesis after amino acid deprivation in S. aureus. This could be shown by the addition of mupirocin or by shifting bacterial cultures into medium lacking Leu/Val. Both conditions resulted in detectable synthesis of pppGpp and ppGpp within 30 min of induction in the wild type but not in the rshsyn mutant. Under these conditions, the small proteins RelP and RelQ do not contribute significantly to the stringent response. However, it is conceivable that they are responsible for the baseline level of ppGpp observed in the rshsyn mutant (Fig. 2) and that they are important under different stress conditions. In contrast to rsh deletion strains, the RSH synthase mutants of S. aureus strain HG001 or Newman, respectively, were not impaired in growth under nutrient-rich conditions. However, the RSH synthase mutants certainly showed a higher sensitivity toward mupirocin than the wild type, similar to relA mutants of E. coli (5) or Streptococcus pneumoniae (26). One could spec-

ulate that the upregulation of genes involved in isoleucine biosynthesis observed in the wild type but not in the rshsyn mutant results in an increased intracellular isoleucine level. Isoleucine can antagonize mupirocin, thereby increasing the MIC of mupirocin in S. aureus (55). Additionally, the rshsyn mutant was not able to survive conditions of amino acid deprivation, indicated by a decrease of CFU. The lethality of the rshsyn mutant during amino acid limitation may be due to the inability of the strain to stop replication. It was proposed by Wang et al. (53) that rapid replication arrest mediated by (p)ppGpp helps to maintain genomic stability by preventing deleterious consequences associated with continuous replication in starved cells. We employed the rshsyn mutants to gain insights into the stringent response to amino acid starvation in S. aureus. We show that mupirocin and Leu/Val deprivation have a similar impact on the mRNA levels of most of the genes analyzed. Only part of the response is mediated via RSH-driven (p)ppGpp synthesis since, for instance, higher levels of mRNA encoding major virulence regulators (RNA III, SaeRS, and SarA) were seen in the wild type, as well as in the rshsyn mutants, after mupirocin treatment (Fig. 7). These effects are probably due to stabilization of the transcripts under conditions in which translation is impaired. It was proposed that ribosome stalling after

1882

GEIGER ET AL.

binding of uncharged tRNA to the A site affects the lifetime of bacterial mRNA. Ribosomes associated with mRNA act as protective barriers and influence the susceptibility of mRNA to RNase attack (11). These ribosomes mask internal endonuclease cleavage sites and, additionally, blockade the 5⬘ end, which can impede access to internal endonuclease cleavage sites. Transcript stabilization after mupirocin treatment seems to affect different mRNA species to different degrees (2) and may have a regulatory function. Whether higher mRNA levels of the regulatory loci are paralleled by increased protein expression and higher target gene expression remains to be determined. Besides the RSH synthase-independent effects on transcript stabilization, amino acid deprivation also results in RSH synthase-driven (p)ppGpp synthesis, which is accompanied by repression of genes involved in ribosomal turnover and translation and activation of genes involved in amino acid metabolism and transport. This coordinated gene expression probably allows the pathogen to adapt to starvation environments, such as those encountered during certain stages of infection. In other pathogens, (p)ppGpp-dependent activation of virulence genes is mediated by regulatory proteins, such as Sigma factors or transcription factors (4, 17, 24, 33, 44, 46). Here, we focused on the analysis of genes belonging to the previously characterized CodY regulon of S. aureus (45). Stringent conditions evoked by Leu/Val deprivation clearly resulted in the derepression of CodY-regulated genes in S. aureus. For these genes, mutation of codY has an opposing and dominant effect compared to that of rsh mutation. In line with the assumption that induction of the stringent control results in derepression of CodY target genes, a codY rshsyn double mutant expressed CodY target genes under noninduced conditions. Analysis of CodY in several firmicutes has shown that binding of branched-chain amino acids and/or GTP to CodY results in the repression of target gene promoters. In S. aureus, a decreased GTP pool was observed under stringent conditions (Fig. 2C). For B. subtilis (21, 34) and Listeria monocytogenes (4), a direct link between the GTP drop and derepression of CodY target genes was demonstrated. Whether stringent conditions also influence the intracellular isoleucine pool remains to be determined. Previously, we showed that isoleucine is necessary and sufficient for the repression of CodY target genes in S. aureus (45). Of note, in S. mutans, there was also a clear link between the stringent response and CodY which was shown to be independent of variations in the GTP level. A regulatory link between the stringent control and CodY during infection was recently demonstrated for L. monocytogenes (4), with results very similar to those for S. aureus. In both organisms, an rsh mutant was clearly attenuated in an animal model of infection, whereas additional codY mutation restored virulence in both organisms. Thus, the attenuation of the rsh mutant could be due at least in part to ongoing repression of CodY-regulated genes under condition which would result in derepression in the wild type. The expression of these genes is obviously relevant for virulence. In the model applied here, the bacteria are usually efficiently cleared within the bloodstream. Some bacteria can reach the kidney, where they multiply and persist. One may assume that the bacteria there encounter an amino acid limitation which evokes the stringent control. Under such conditions, (p)ppGpp may be essential not

INFECT. IMMUN.

only for growth but also for survival. The survival of the rshsyn mutant under in vivo conditions may be diminished, as was shown in vitro, under conditions of amino acid deprivation. ACKNOWLEDGMENTS We thank Vittoria Bisanzio for excellent technical assistance. The work was supported by grants to C.W. and K.O. from the Deutsche Forschungsgemeinschaft TR34. M. Liebeke was the recipient of a fellowship from the Alfried Krupp von Bohlen und HalbachStiftung Foundation Functional Genomics Approach in Infection Biology program. REFERENCES 1. Abranches, J., A. R. Martinez, J. K. Kajfasz, V. Chavez, D. A. Garsin, and J. A. Lemos. 2009. The molecular alarmone (p)ppGpp mediates stress responses, vancomycin tolerance, and virulence in Enterococcus faecalis. J. Bacteriol. 191:2248–2256. 2. Anderson, K. L., C. Roberts, T. Disz, V. Vonstein, K. Hwang, R. Overbeek, P. D. Olson, S. J. Projan, and P. M. Dunman. 2006. Characterization of the Staphylococcus aureus heat shock, cold shock, stringent, and SOS responses and their effects on log-phase mRNA turnover. J. Bacteriol. 188:6739–6756. 3. Bae, T., and O. Schneewind. 2006. Allelic replacement in Staphylococcus aureus with inducible counter-selection. Plasmid 55:58–63. 4. Bennett, H. J., D. M. Pearce, S. Glenn, C. M. Taylor, M. Kuhn, A. L. Sonenshein, P. W. Andrew, and I. S. Roberts. 2007. Characterization of relA and codY mutants of Listeria monocytogenes: identification of the CodY regulon and its role in virulence. Mol. Microbiol. 63:1453–1467. 5. Beyer, D., H. P. Kroll, R. Endermann, G. Schiffer, S. Siegel, M. Bauser, J. Pohlmann, M. Brands, K. Ziegelbauer, D. Haebich, C. Eymann, and H. Brotz-Oesterhelt. 2004. New class of bacterial phenylalanyl-tRNA synthetase inhibitors with high potency and broad-spectrum activity. Antimicrob. Agents Chemother. 48:525–532. 6. Braeken, K., M. Moris, R. Daniels, J. Vanderleyden, and J. Michiels. 2006. New horizons for (p)ppGpp in bacterial and plant physiology. Trends Microbiol. 14:45–54. 7. Bruckner, R. 1997. Gene replacement in Staphylococcus carnosus and Staphylococcus xylosus. FEMS Microbiology Lett. 151:1–8. 8. Cashel, M. 1975. Regulation of bacterial ppGpp and pppGpp. Annu. Rev. Microbiol. 29:301–318. 9. Cassels, R., B. Oliva, and D. Knowles. 1995. Occurrence of the regulatory nucleotides ppGpp and pppGpp following induction of the stringent response in staphylococci. J. Bacteriol. 177:5161–5165. 10. Chatterji, D., and A. K. Ojha. 2001. Revisiting the stringent response, ppGpp and starvation signaling. Curr. Opin. Microbiol. 4:160–165. 11. Deana, A., and J. G. Belasco. 2005. Lost in translation: the influence of ribosomes on bacterial mRNA decay. Genes Dev. 19:2526–2533. 12. den Hengst, C. D., P. Curley, R. Larsen, G. Buist, A. Nauta, D. van Sinderen, O. P. Kuipers, and J. Kok. 2005. Probing direct interactions between CodY and the oppD promoter of Lactococcus lactis. J. Bacteriol. 187:512–521. 13. Donat, S., K. Streker, T. Schirmeister, S. Rakette, T. Stehle, M. Liebeke, M. Lalk, and K. Ohlsen. 2009. Transcriptome and functional analysis of the eukaryotic-type serine/threonine kinase PknB in Staphylococcus aureus. J. Bacteriol. 191:4056–4069. 14. Duthie, E. S., and L. L. Lorenz. 1952. Staphylococcal coagulase: mode of action and antigenicity. J. Gen. Microbiol. 6:95–107. 15. Eymann, C., G. Homuth, C. Scharf, and M. Hecker. 2002. Bacillus subtilis functional genomics: global characterization of the stringent response by proteome and transcriptome analysis. J. Bacteriol. 184:2500–2520. 16. Gentry, D., T. Li, M. Rosenberg, and D. McDevitt. 2000. The rel gene is essential for in vitro growth of Staphylococcus aureus. J. Bacteriol. 182:4995– 4997. 17. Gentry, D. R., V. J. Hernandez, L. H. Nguyen, D. B. Jensen, and M. Cashel. 1993. Synthesis of the stationary-phase sigma factor sigma s is positively regulated by ppGpp. J. Bacteriol. 175:7982–7989. 18. Godfrey, H. P., J. V. Bugrysheva, and F. C. Cabello. 2002. The role of the stringent response in the pathogenesis of bacterial infections. Trends Microbiol. 10:349–351. 19. Gralla, J. D. 2005. Escherichia coli ribosomal RNA transcription: regulatory roles for ppGpp, NTPs, architectural proteins and a polymerase-binding protein. Mol. Microbiol. 55:973–977. 20. Guedon, E., P. Serror, S. D. Ehrlich, P. Renault, and C. Delorme. 2001. Pleiotropic transcriptional repressor CodY senses the intracellular pool of branched-chain amino acids in Lactococcus lactis. Mol. Microbiol. 40:1227– 1239. 21. Handke, L. D., R. P. Shivers, and A. L. Sonenshein. 2008. Interaction of Bacillus subtilis CodY with GTP. J. Bacteriol. 190:798–806. 22. Hendriksen, W. T., H. J. Bootsma, S. Estevao, T. Hoogenboezem, A. de Jong, R. de Groot, O. P. Kuipers, and P. W. Hermans. 2008. CodY of Streptococcus

VOL. 78, 2010 pneumoniae: link between nutritional gene regulation and colonization. J. Bacteriol. 190:590–601. 23. Hogg, T., U. Mechold, H. Malke, M. Cashel, and R. Hilgenfeld. 2004. Conformational antagonism between opposing active sites in a bifunctional RelA/SpoT homolog modulates (p)ppGpp metabolism during the stringent response. Cell 117:57–68. 24. Inaoka, T., and K. Ochi. 2002. RelA protein is involved in induction of genetic competence in certain Bacillus subtilis strains by moderating the level of intracellular GTP. J. Bacteriol. 184:3923–3930. 25. Jain, V., M. Kumar, and D. Chatterji. 2006. ppGpp: stringent response and survival. J. Microbiol. 44:1–10. 26. Kazmierczak, K. M., K. J. Wayne, A. Rechtsteiner, and M. E. Winkler. 2009. Roles of rel in stringent response, global regulation and virulence of serotype 2 Streptococcus pneumoniae D39. Mol. Microbiol. 72:590–611. 27. Krasny, L., and R. L. Gourse. 2004. An alternative strategy for bacterial ribosome synthesis: Bacillus subtilis rRNA transcription regulation. EMBO J. 23:4473–4483. 28. Krasny, L., H. Tiserova, J. Jonak, D. Rejman, and H. Sanderova. 2008. The identity of the transcription ⫹1 position is crucial for changes in gene expression in response to amino acid starvation in Bacillus subtilis. Mol. Microbiol. 69:42–54. 29. Kreiswirth, B. N., S. Lofdahl, M. J. Betley, M. O’Reilly, P. M. Schlievert, M. S. Bergdoll, and R. P. Novick. 1983. The toxic shock syndrome exotoxin structural gene is not detectably transmitted by a prophage. Nature 305:709– 712. 30. Lee, C. Y., S. L. Buranen, and Z. H. Ye. 1991. Construction of single-copy integration vectors for Staphylococcus aureus. Gene 103:101–105. 31. Lemos, J. A., T. A. Brown, Jr., and R. A. Burne. 2004. Effects of RelA on key virulence properties of planktonic and biofilm populations of Streptococcus mutans. Infect. Immun. 72:1431–1440. 32. Lemos, J. A., V. K. Lin, M. M. Nascimento, J. Abranches, and R. A. Burne. 2007. Three gene products govern (p)ppGpp production by Streptococcus mutans. Mol. Microbiol. 65:1568–1581. 33. Lemos, J. A., M. M. Nascimento, V. K. Lin, J. Abranches, and R. A. Burne. 2008. Global regulation by (p)ppGpp and CodY in Streptococcus mutans. J. Bacteriol. 190:5291–5299. 34. Levdikov, V. M., E. Blagova, V. L. Colledge, A. A. Lebedev, D. C. Williamson, A. L. Sonenshein, and A. J. Wilkinson. 2009. Structural rearrangement accompanying ligand binding in the GAF domain of CodY from Bacillus subtilis. J. Mol. Biol. 390:1007–1018. 35. Magnusson, L. U., A. Farewell, and T. Nystrom. 2005. ppGpp: a global regulator in Escherichia coli. Trends Microbiol. 13:236–242. 36. Mainiero, M., C. Goerke, T. Geiger, C. Gonser, S. Herbert, and C. Wolz. 2010. Differential target gene activation by the Staphylococcus aureus twocomponent system saeRS. J. Bacteriol. 192:613–623. 37. Majerczyk, C. D., M. R. Sadykov, T. T. Luong, C. Lee, G. A. Somerville, and A. L. Sonenshein. 2008. Staphylococcus aureus CodY negatively regulates virulence gene expression. J. Bacteriol. 190:2257–2265. 38. Mechold, U., M. Cashel, K. Steiner, D. Gentry, and H. Malke. 1996. Functional analysis of a relA/spoT gene homolog from Streptococcus equisimilis. J. Bacteriol. 178:1401–1411. 39. Mechold, U., H. Murphy, L. Brown, and M. Cashel. 2002. Intramolecular regulation of the opposing (p)ppGpp catalytic activities of Rel(Seq), the Rel/Spo enzyme from Streptococcus equisimilis. J. Bacteriol. 184:2878–2888. 39a.Mayer, H., M. Liebeke, and M. Lalk. 2010. A protocol for the investigation

Editor: A. J. Ba¨umler


40.

41.

42.

43. 44.

45.

46. 47. 48. 49.

50.

51. 52.

53. 54. 55.

56. 57. 58.

1883

of the intracellular Staphylococcus aureus metabolome. Anal. Biochem. [Epub ahead of print.] doi:10.1016/j.ab.2010.03.003. Mittenhuber, G. 2001. Comparative genomics and evolution of genes encoding bacterial (p)ppGpp synthetases/hydrolases (the Rel, RelA and SpoT proteins). J. Mol. Microbiol. Biotechnol. 3:585–600. Nanamiya, H., K. Kasai, A. Nozawa, C. S. Yun, T. Narisawa, K. Murakami, Y. Natori, F. Kawamura, and Y. Tozawa. 2008. Identification and functional analysis of novel (p)ppGpp synthetase genes in Bacillus subtilis. Mol. Microbiol. 67:291–304. Natori, Y., K. Tagami, K. Murakami, S. Yoshida, O. Tanigawa, Y. Moh, K. Masuda, T. Wada, S. Suzuki, H. Nanamiya, Y. Tozawa, and F. Kawamura. 2009. Transcription activity of individual rrn operons in Bacillus subtilis mutants deficient in (p)ppGpp synthetase genes, relA, yjbM, and ywaC. J. Bacteriol. 191:4555–4561. Novick, R. P. 1991. Genetic systems in staphylococci. Methods Enzymol. 204:587–636. Pizarro-Cerda, J., and K. Tedin. 2004. The bacterial signal molecule, ppGpp, regulates Salmonella virulence gene expression. Mol. Microbiol. 52:1827– 1844. Pohl, K., P. Francois, L. Stenz, F. Schlink, T. Geiger, S. Herbert, C. Goerke, J. Schrenzel, and C. Wolz. 2009. CodY in Staphylococcus aureus: a regulatory link between metabolism and virulence gene expression. J. Bacteriol. 191: 2953–2963. Potrykus, K., and M. Cashel. 2008. (p)ppGpp: still magical? Annu. Rev. Microbiol. 62:35–51. Sonenshein, A. L. 2005. CodY, a global regulator of stationary phase and virulence in Gram-positive bacteria. Curr. Opin. Microbiol. 8:203–207. Srivatsan, A., and J. D. Wang. 2008. Control of bacterial transcription, translation and replication by (p)ppGpp. Curr. Opin. Microbiol. 11:100–105. Steiner, K., and H. Malke. 2000. Life in protein-rich environments: the relA-independent response of Streptococcus pyogenes to amino acid starvation. Mol. Microbiol. 38:1004–1016. Tojo, S., T. Satomura, K. Kumamoto, K. Hirooka, and Y. Fujita. 2008. Molecular mechanisms underlying the positive stringent response of the Bacillus subtilis ilv-leu operon, involved in the biosynthesis of branched-chain amino acids. J. Bacteriol. 190:6134–6147. Vagner, V., E. Dervyn, and S. D. Ehrlich. 1998. A vector for systematic gene inactivation in Bacillus subtilis. Microbiology 144(Pt. 11):3097–3104. Wagner, R. 2002. Regulation of ribosomal RNA synthesis in E. coli: effects of the global regulator guanosine tetraphosphate (ppGpp). J. Mol. Microbiol. Biotechnol. 4:331–340. Wang, J. D., G. M. Sanders, and A. D. Grossman. 2007. Nutritional control of elongation of DNA replication by (p)ppGpp. Cell 128:865–875. Wendrich, T. M., and M. A. Marahiel. 1997. Cloning and characterization of a relA/spoT homologue from Bacillus subtilis. Mol. Microbiol. 26:65–79. Wilson, J. M., B. Oliva, R. Cassels, P. J. O’hanlon, and I. Chopra. 1995. Sb-205952, a novel semisynthetic monic acid analog with at least two modes of action. Antimicrob. Agents Chemother. 39:1925–1933. Wolz, C., T. Geiger, and C. Goerke. 2010. The synthesis and function of the alarmone (p)ppGpp in firmicutes. Int. J. Med. Microbiol. 300:142–147. Wu, J., and J. Xie. 2009. Magic spot: (p)ppGpp. J. Cell. Physiol. 220:297–302. Xiao, H., M. Kalman, K. Ikehara, S. Zemel, G. Glaser, and M. Cashel. 1991. Residual guanosine 3⬘,5⬘-bispyrophosphate synthetic activity of relA null mutants can be eliminated by spoT null mutations. J. Biol. Chem. 266:5980– 5990.