Copyright Ó 2010 by the Genetics Society of America DOI: 10.1534/genetics.109.109553
Drosophila Translational Elongation Factor-1g Is Modified in Response to DOA Kinase Activity and Is Essential for Cellular Viability Yujie Fan,*,† Michael Schlierf,* Ana Cuervo Gaspar,* Catherine Dreux,* Arlette Kpebe,* Linda Chaney,‡ Aurelie Mathieu,* Christophe Hitte,§ Olivier Gre´my,* Emeline Sarot,* Mark Horn,‡ Yunlong Zhao,† Terri Goss Kinzy** and Leonard Rabinow*,‡,1 *Universite´ Paris Sud 11, Centre National de la Recherche Scientifique (CNRS)–UMR C-8080, bis 91400, Orsay, France, †East China Normal University School of Life Science, 200062 Shanghai, People’s Republic of China, ‡Department of Biochemistry and Molecular Biology, University of Nebraska Medical Center, Omaha, Nebraska 68198-4525, §CNRS UMR 6061 Institut de Ge´ne´tique et De´veloppement de Rennes, Universite´ de Rennes 1, CS 34317, 35043 Rennes, France and **Department of Molecular Genetics, Microbiology and Immunology, University of Medicine and Dentistry of New Jersey, Robert Wood Johnson Medical School, Piscataway, New Jersey 08854 Manuscript received September 9, 2009 Accepted for publication October 13, 2009 ABSTRACT Drosophila translational elongation factor-1g (EF1g) interacts in the yeast two-hybrid system with DOA, the LAMMER protein kinase of Drosophila. Analysis of mutant EF1g alleles reveals that the locus encodes a structurally conserved protein essential for both organismal and cellular survival. Although no genetic interactions were detected in combinations with mutations in EF1a, an EF1g allele enhanced mutant phenotypes of Doa alleles. A predicted LAMMER kinase phosphorylation site conserved near the C terminus of all EF1g orthologs is a phosphorylation site in vitro for both Drosophila DOA and tobacco PK12 LAMMER kinases. EF1g protein derived from Doa mutant flies migrates with altered mobility on SDS gels, consistent with it being an in vivo substrate of DOA kinase. However, the aberrant mobility appears to be due to a secondary protein modification, since the mobility of EF1g protein obtained from wild-type Drosophila is unaltered following treatment with several nonspecific phosphatases. Expression of a construct expressing a serine-to-alanine substitution in the LAMMER kinase phosphorylation site into the fly germline rescued null EF1g alleles but at reduced efficiency compared to a wild-type construct. Our data suggest that EF1g functions in vital cellular processes in addition to translational elongation and is a LAMMER kinase substrate in vivo.
T
HE Darkener of apricot (Doa) locus encodes the Drosophila member of the LAMMER/Clk protein kinase family. Doa is essential for embryonic and adult cuticular development (Yun et al. 1994), and strong mutant alleles are cell lethal in both the soma and germline, demonstrating a vital role for the kinase in all cell types (Yun et al. 2000). LAMMER protein kinases are best known for their roles in the regulation of alternative splicing via the phosphorylation of SR proteins (Colwill et al. 1996a,b; Nayler et al. 1997; Savaldi-Goldstein et al. 2000). In Drosophila, a cascade of regulated alternative splicing determines somatic sexual determination (Lopez 1998). Consistent with a role for LAMMER kinases in the regulation of alternative splicing, Doa alleles induce male-specific Supporting information is available online at http://www.genetics.org/ cgi/content/full/genetics.109.109553/DC1. Sequence data from this article have been deposited with the EMBL/ GenBank Data Libraries under accession nos. AF148813 and EF192542– EF192546. 1 Corresponding author: Universite´ de Paris Sud 11, CNRS UMR C-8080, Baˆtiment 442, bis 91400, Orsay, France. E-mail:
[email protected] Genetics 184: 141–154 ( January 2010)
development and splicing of dsx in chromosomally female individuals, as well as hypophosphorylation and delocalization of some SR and SR-like proteins (Du et al. 1998). While primarily recognized for their role in the regulation of splicing, LAMMER kinases are also likely to be involved in mediating one or more signaling cascades. For example, in tobacco, the LAMMER kinase PK12 is post-transcriptionally and post-translationally induced in response to the hormone ethylene (Sessa et al. 1996). In mammalian cell cultures, CLK1 and -2 phosphorylate and activate PTP1b, a cytoplasmic tyrosine phosphatase involved in insulin signaling (Moeslein et al. 1999). Results in cultured mammalian cells initially described LAMMER kinases as exclusively nuclear (Colwill et al. 1996b; Nayler et al. 1997, 1998), but subsequent studies have shown that the mammalian CLK kinases are also cytoplasmic (Moeslein et al. 1999; Menegay et al. 2000; Prasad and Manley 2003), suggesting the possibility of shuttling between the two intracellular compartments. At least six Doa isoforms are produced via alternative promoter utilization (Kpebe and Rabinow 2008a), of
142
Y. Fan et al.
which at least three possess differentiable functions (Kpebe and Rabinow 2008b). Of these isoforms, at least one is nuclear and another cytoplasmic (Yun et al. 2000). In eukaryotes, the soluble elongation factors EF1 and EF2, analogous to the bacterial elongation factors EFTu/Ts and EF-G, are required for translational elongation. EF1 is composed of three or four subunits, EF1a, -b, -g, and -d in higher eukaryotes. EF1a is an abundant protein, the majority of which is isolated as a monomer (Dasmahapatra et al. 1981), but the protein is also found associated with EF1b, -g, and -d subunits in a high molecular weight complex (Carvalho et al. 1984). The a subunit of EF1 binds aminoacyl-tRNA in a GTP-dependent manner. This ternary complex then binds to the ribosome (reviewed in Riis et al. 1990). GTP is hydrolyzed to GDP after the cognate aminoacyltRNA is bound at the ribosomal A site. The GDP remains tightly bound to EF1a following this reaction. EF1b stimulates nucleotide exchange to regenerate EF1aGTP for the next elongation cycle (Slobin and Moller 1978). In Drosophila, recessive lethal alleles of EF1a exist, but loss-of-function mutations in EF1b are not described. Changes to the nomenclature of eukaryotic translation elongation factors were proposed, whereby the EF1 subunits have been renamed (Merrick and Nyborg 2000; Le Sourd et al. 2006). EF1g for example, has been renamed eEF1Bg. However, for the purposes of simplicity and consistency with the terminology used in FlyBase, we use the older nomenclature (EF1g) in this article. Although suggested to stimulate the nucleotide exchange activity of EF1b ( Janssen and Moller 1988), there is little evidence of a function for EF1g in translation. EF1g is completely dispensable for translation in vitro, and its absence fails to affect rates of translational elongation. Indeed, the identification of the protein as an ‘‘elongation factor’’ is due to the fact that it co-isolates with EF1b. While a function of EF1g in translation thus remains largely conjectural, other observations suggest alternative and perhaps multiple roles for the protein (reviewed in Ejiri 2002). For example, the EF1g of Artemia salina co-immunoprecipitates with tubulin ( Janssen and Moller 1988). Drosophila EF1g (CG11901), was also identified in a screen for microtubule-binding proteins, supporting this observation (Hughes et al. 2008). It might be noted that DOA kinase was also identified in the same screen. Interactions of EF1g with keratin have also been observed, and this association is the single report suggesting effects of EF1g on rates of protein translation (Kim et al. 2007). Human EF1g was also described as specifically binding to the 39-UTR of vimentin mRNA (Al-Maghrebi et al. 2002). Intriguingly, EF1g was recently identified in a proteomic screen as a member of the pre-mRNA 39 end cleavage complex
(Shi et al. 2009), reinforcing the finding of RNA-binding properties for the protein and suggesting roles for it in functions in addition to translational elongation. One phenotype involving EF1g is constitutive resistance to oxidative stress in yeast mutants, although without detectable alterations to translation (Olarewaju et al. 2004). The primary sequence and structure of the N terminus of the yeast EF1g encoded by the TEF3 locus resembles the u class of human glutathione Stransferase ( Jeppesen et al. 2003), and this region is conserved among EF1g orthologs. EF1 also interacts with the 26S proteasome in Xenopus oocytes, and the interaction is stabilized by phosphorylation (Tokumoto et al. 2003). A possible link between human disease and EF1g is suggested by the fact that the protein is overexpressed in several cancers (Lew et al. 1992; Mimori et al. 1995, 1996; Mathur et al. 1998), although the effects, if any, of this overexpression remain unknown. EF1g is transcriptionally induced at the onset of autophagy in the Drosophila salivary gland (Gorski et al. 2003), similarly to Doa (Lee et al. 2003), suggesting roles for both gene products and the possibility of their interaction. EF1g was also identified in an RNAi-based screen for genes required for the innate immune response in S2 cells (Foley and O’Farrell 2004), as well as in a proteomics approach for proteins associated with the Drosophila phagosome (Stuart et al. 2007). Here we report the first genetic characterization of Drosophila EF1g in a higher organism, and its in vitro and in vivo interactions with Doa. EF1g activity is required for the viability of both whole animals and individual cells. Recessive lethality occurs during early larval development, consistent with an extensive maternal contribution of the RNA and protein to the embryo. One transcript isoform is also transcriptionally induced by the ecdysone-dependent transcription factor E93 during salivary gland autophagy. EF1g protein is found in pupal nuclei, inconsistent with a role exclusively in translational elongation. However, its overexpression reveals almost no aberrant phenotypes. Drosophila EF1g is phosphorylated in vitro by DOA and tobacco PK12 LAMMER protein kinases on a site that is strictly conserved in all orthologs, and aberrant migration of the protein obtained from Doa mutants suggests that it may also be an in vivo substrate of the kinase, although altered migration appears to be due to a secondary posttranslational modification. Amino acid replacement of the phosphorylated serine and insertion of the construct into the Drosophila germline shows that although the mutated protein is capable of rescuing loss-of-function alleles, rescue is noticeably less efficient in females.
MATERIALS AND METHODS Drosophila culture, mutagenesis, and crosses: Drosophila stocks and crosses were maintained on standard cornmeal agar medium. Crosses were performed at 25°, except as noted.
Drosophila EF1g Crosses to generate heteroallelic Doa individuals were previously described (Rabinow et al. 1993; Kpebe and Rabinow 2008b). GE29510, a P-element insertion at the 59 end of EF1g (CG11901), was purchased from Genexel, and its insertion site verified. Additional alleles were recovered from imprecise excisions of the initial insertion. DrMio/TMS, P{ry[1t7.2] D2-3} males were crossed with yw67c23; P[w1 EF1g] GE29510/TM3 females; F1 D2-3/P[w1 EF1g] GE29510 males were crossed with yw67c23; TM2/TM3 females. Stocks derived from F2 white-eyed males were screened for complementation of deficiency Df(3R)Exel6212 (99A1-99A5), which removes EF1g. Twentyeight reversions of 104 recovered were lethal. Four of these were imprecise excisions generating deficiencies of the locus or retaining only part of the initial P-element: 3 were hypomorphs and 1, a null allele. Of 5 chromosomes viable over Df(3R)Exel6212 analyzed, 4 were precise excisions, while the fifth retained 43 bp of the initial element. Somatic clones were generated with the FLP/FRT system (Xu and Rubin 1993), using the FRT at 82B. Recombinants between Doa and EF1g, which are separated by only 297 kb, were obtained by crossing a Pr DoaHD chromosome in a w background to the w1-marked EF1gGE29510. Heterozygous females were crossed with a double-balanced stock and F1 w1; Pr males were selected. These were then crossed individually to w; DoaHD/ TM3 females. Crosses yielding only flies carrying a thirdchromosome balancer were selected and complementation tested for the presence of the HD allele. Approximately 6300 total chromosomes were screened, 90 Pr w1 chromosomes analyzed, and 4 identified as recombinants between Doa and EF1g, yielding a map distance of 0.06 cM between the two loci. Transgenic lines expressing EF1g: cDNAs encoding wildtype EF1g and a Ser294Ala substitution were subcloned into pUAS-T for P-element mediated transformation. Embryos were injected by BestGene. At least two lines were analyzed for each construct for each phenotype. Two lines producing interfering RNA (RNAi) specific for EF1g were obtained from the National Institute of Genetics (NIG), Genetic Strains Research Center. Crosses using GAL4-directed expression were performed at 29° to enhance phenotypes. Immunocytochemistry and in situ hybridization: In situ hybridization to whole embryos was carried out as described (Tautz and Pfeifle 1989). Staging of embryos was as per Campos-Ortega and Hartenstein (1997). Immunocytochemical staining of embryos was performed as described (Ashburner 1989), using rat anti-Drosophila EF1g at a dilution of 1:1000. Molecular Biology: Molecular biological methods were performed according to standard techniques (Ausubel et al. 1989). RNA preparations, Northern transfers, and probe preparation were performed as described (Kpebe and Rabinow 2008a). Loading controls were performed by rehybridizing the transfers with a probe for rp49 (O’Connell and Rosbash 1984). RT–PCR experiments utilized the following primers: 2063F, GCTGAATTTGC CACTATATCGT; 2006F, TGTTTCCGTCCCTTCTCTTC; and 2370R, TCTCGCCGAACTTGAAGTTG. Site-specific mutagenesis of Ser294 to Ala in EF1g cDNAs (nucleotide 25047082 on chromosome 3R in the EF1g locus, made use of the Quick Change kit (Stratagene), and the oligonucleotide 59-TCC AAG CGC GTG TAC GCC AAT GAG GAC GAG GCC-39, where the underlined ‘‘G’’ was substituted for the ‘‘T’’ in the wild-type sequence. Sequenced PCR products were inserted into pGEX 2T for protein expression and into pUAS-T for Drosophila germline transformation. Computerized searches of sequence databases and alignments were generated using GCG software. Yeast strains and methods and plasmid constructions: The yeast two-hybrid plasmids pAS1, pACT, and pACTII were gifts
143
from S. Elledge (Durfee et al. 1993), as was a generous gift of an unpublished Drosophila third instar cDNA library. cDNA inserts were cloned at the XhoI site of the vector. False positive control and murine Clk1 fusion plasmids were gifts of K. Colwill (Colwill et al. 1996b). The clones used to eliminate false positive interactions included fusions with the GAL4 DNA-binding domain in pAS1 and p53, lamin, and the CDK2 and SNF1 kinases. The yeast strains were Y153 (Staudinger et al. 1993) and pJ69-4A (James et al. 1996), a gift from R. Lahue. Lithium acetate transformants were selected on Leu Trp medium, single colonies selected, and streaked onto selective (Leu Trp His) medium for analysis. Many yeast two-hybrid and kinase-expression plasmids used in these studies were described previously (Du et al. 1998; Nikolakaki et al. 2002). Those generated here were: pACT: EF1gCtm (C-terminal) was the original two-hybrid cDNA clone encoding the C-terminal domain of Drosophila EF1g interacting with DOA kinase. pAS1CYH2: EF1gCtm, the 800-bp XhoI fragment encoding the C-terminal domain of Drosophila EF1g in pACT was digested with SalI, isolated, and religated into pAS1CYH2 digested with SalI. pAS1CYH2: EF1gFL (full-length), the 1.7-kb cDNA insert of BDGP EST clone LD07046 was excised from its original vector (pBluescript SK1) via digestion with NcoI and XhoI, and cloned into NcoI/SalI cut pAS1CYH2. pAS1CYH2: TaqID, digestion of LD07046 with TaqI and NcoI yielded a 0.7-kb fragment encoding the 59 end of the cDNA, which was cloned into NcoI/SmaI double-digested pAS1CYH2. pAS1CYH2: PstID, PstI digestion of pAS1CYH2: EF1gFL removed a 1.3-kb PstI/PstI internal fragment of the cDNA (see map, Figure 1), and the remaining DNA was religated on itself, leaving a 0.4-kb fragment encoding the Nterminal-most fragment of EF1g. Immunoblot analysis verified that constructs containing full-length DOA, hCLK2, the N terminus of DOA, and the Drosophila EF1g constructs were stably expressed as GAL4 activation-domain protein fusions. Protein analysis: Full-length and C-terminal domains of Drosophila EF1g proteins were expressed and affinity purified as fusions with the glutathione-S-transferase protein fusion vector pGEX2T (Pharmacia) and the maltose-binding protein vector pMalC2 (New England Biolabs), respectively. The junctions of the recombinant plasmids were sequenced to verify in-frame translation of the EF1g moiety. Thrombin cleavage of the recombinant GST–EF1g fusion proteins followed the manufacturer’s conditions. The expression and purification of recombinant DOA kinase catalytic domain and in vitro phosphorylation reactions were previously described (Lee et al. 1996; Du et al. 1998; Nikolakaki et al. 2002). Lambda and CIP phosphatases were used according to the manufacturer’s instructions (NEB). Protocols for use of potato acid phosphatase (Sigma, type III) were previously described (Papavassiliou and Bohmann 1992; Du et al. 1998). Antibodies against the full-length GST–EF1g fusion protein were produced in both chickens and rats (Eurogentec). Preimmune sera and yolk preparations (IgY) did not detect reacting material on immunoblots of Drosophila proteins or recombinant EF1g (not shown). Anti-EF1g from either source was used at 1:1000 on immunotransfers and for immunocytochemistry. SDS gel electrophoresis, protein transfers, and immunoblots were performed as described (Ausubel et al. 1989), using an 8% separating gel. Separated proteins were transferred to nitrocellulose via semi-dry transfer, blots were blocked in 5% nonfat milk, and probed with rat anti-EF1g antibody SE62
144
Y. Fan et al. Figure 1.—Drosophila EF1g interacts with DOA kinase in the yeast two-hybrid system. (A) Left: a Leu Trp plate demonstrates growth of the streaked double-transformant colonies under nonselective conditions; right: a duplicate Leu Trp His plate, revealing protein–protein interactions based upon His1 prototrophy. Streaking of the two plates was performed in parallel. The indicated kinases were expressed from the pACTII vector, and the EF1g proteins were expressed from the pAS1 vector. The initial screen was performed with DOA kinase expressed in pAS1 and the initial EF1g–C-terminal domain-encoding clone was recovered in pACT (data not shown). Similar results were obtained in expression of EF1g–Ctm, DOA and hCLK2 from reciprocal plasmids (data not shown). Ctm, C-terminal domain; FL, full length. (1) pAS1: EF1g–Ctm; (2) pAS1: EF1g–FL; (3) pAS1: EF1gTaqI; and (4) pAS1: EF1gPstI. (B) A schematic representation of the EF1g cDNA constructs screened for two-hybrid interactions in A. The C-terminal clone was the initial isolate; the full-length clone is BDGP EST LD07046. The open reading frame is contained in the diagonally slashed box.
(1:1000) and anti-rat HRP-conjugated antibody at 1:4000. ECL chemiluminescence (Amersham) was used for detection. Protein loading was controlled with anti-a-tubulin monoclonal antibody DM1A (Sigma). Immunohistochemical staining of embryos was performed as described (Ashburner 1989). Crude anti-EF1g serum was used at dilutions 1:1000. Preimmune serum was used as control. For DAB staining, tissues were fixed in 4% paraformaldehyde, and the VECTASTAIN Elite ABC kit was used. After blocking at 37° in PBT and 1% normal rabbit serum for 1 hr, embryos were incubated with diluted primary antibodies and then 1:200 diluted biotinylated anti-rat serum at 37° for 1 hr. Embryos were then incubated in ABC reagent followed by washing and staining with 0.1% DAB and 0.02% hydrogen peroxide. For immunofluorescence, tissues were fixed in 4% paraformaldehyde, 1.5% glutaraldehyde in PBS, permeabilized with 0.3% Triton X-100 in PBS, and blocked with 5% normal chicken serum in PBT. After washing, tissues were incubated in 1:2000 diluted primary antibodies and 1:2000 diluted Alexa594-conjugated chicken anti-rat secondary antibody for 2 hr and washed three to four times with PBS-Triton. Tissues were mounted in Mowiol. Images were acquired on a Zeiss LSM-410 microscope. Drosophila protein preparations: Embryos 0- to 24 hr old, first and third instar larvae, 0- to 24-hr-old pupae, and 0- to 24-hr-old adults were collected, washed in PBS, and homogenized in TBS (0.1 m NaCl, 20mm Tris pH 7.4), containing 0.2 mm PMSF, 1 mg/ml leupeptin and 0.2 mg/ml pepstatin A. Nuclear extracts from 0- to 24-hr-old pupae were prepared according to Dorsett (1990). Bacterial strains, infections, and survival analysis: Microbial septic injuries were performed as described (Romeo and Lemaitre 2008), by pricking adult flies under the wing in the lateral part of the thorax with a thin needle previously dipped into a concentrated (OD600) culture of Erwinia carotovora subsp. carotovora 15, a gift from F. Leulier. Three parallel vials with 20 flies in each were established for each genotype tested for survival. The flies were cultured at 29° and examined at different time points to monitor survival after septic injury. Infected flies were transferred to fresh vials daily.
b-galactosidase assays: Forty adults of the same age and sex were homogenized in 200 ml of Z buffer (0.01 m KCl; 0.06 m Na2HPO4; 0.04 m NaH2PO4; 0.001 m MgSO4; 0.05 m b-mercaptoethanol), to which an additional 800 ml of buffer was added. Following vortexing, the lysate was cleared by centrifugation, to which 20 ml 0.1% SDS was added to triplicate samples of 200 ml, 700 ml of ONPG solution (1 mg/ml in Z buffer), preheated to 30°, was added. Reactions were stopped by the addition of 500 ml 1 m Na2CO3. Following centrifugation, ODs were read at 420 nm.
RESULTS
DOA kinase interacts with the C terminus of Drosophila EF1g: We screened 106 transformants of a Drosophila third instar cDNA library kindly provided by S. Elledge, in a yeast two-hybrid assay to identify proteins interacting with DOA kinase, using a near-full length cDNA clone encoding the 55 kDa DOA isoform (Yun et al. 2000; Kpebe and Rabinow 2008a,b). Among the colonies displaying histidine prototrophy (Figure 1A) was a clone encoding the C-terminal portion of Drosophila translational elongation factor 1g (EF1g; CG11901; 99A1-6). This clone expressed b-galactosidase at high levels, did not autoactivate transcription and did not interact with nonspecific GAL4–DNA binding domain fusion proteins. The initial cDNA included a poly(A) tail, identifying the 39 end of the transcript. Screening of a pupal cDNA library isolated a near-full length EF1g cDNA almost completely overlapping the initial C-terminal clone, but lacking a poly(A) tail. Sequences of the initial clones were aligned and submitted to GenBank (accession no. AF148813). EST clone LD07046 encoding the fulllength open reading of EF1g was sequenced in its
Drosophila EF1g
145
TABLE 1 Yeast two-hybrid interactions between LAMMER protein kinases and EF1g constructs Vector
Vector insert
pAS1: EF1g–Ctm
pAS1: EF1g–FL
pAS1: EF1g–TaqI
pAS1: EF1y–PstI
pACTII pACTII pACTII pACTII
None DOA-FL DOA-C hCLK2-FL
() (11) () (1)
() (11) () (1)
() () () ()
() () () ()
pAS1 pAS1 pAS1 pAS1 pAS1 pAS1
None DOA-FL DOA-N DOA-C hCLK2-FL hCLK2-N
pACT: EF1g–Ctm () (11) (11) () (11) ()
(11), strong interaction; (1), moderate interaction; (), no interaction; EF1g–Ctm, C-terminal domain; FL, full-length; N, N-terminal noncatalytic domain; C, kinase catalytic domain.
entirety. The EST terminates just upstream of poly(A) sequences in our initial cDNA isolate (Figure 1B). For additional characterization and validation of twohybrid interactions, the initial EF1g cDNA and the fulllength EF1g EST clone LD07046 were both recloned into the pAS1 vector. Kinase constructs were made in the pACT II vector. Verification of previously observed interactions was made in the reciprocal orientation as an additional control (Figure 1A, Table 1). These constructs demonstrated that the human LAMMER kinase CLK2 also interacted with Drosophila EF1g protein. However, isolated catalytic and noncatalytic subdomains of DOA and human CLK2 kinases did not support two-hybrid interactions with EF1g (Table 1). The necessity for both catalytic and noncatalytic domains of LAMMER kinases for yeast two-hybrid interactions with substrates has been previously noted (Colwill et al. 1996b; Du et al. 1998; Nikolakaki et al. 2002). The EF1g domain responsible for interaction with the LAMMER kinases was refined via construction of two truncated constructs, PstID and TaqID, truncating the protein at amino acid residues 142 and 212, respectively (Figure 1B). These remove different stretches of Cterminal residues in the 431 amino acid protein. Neither truncated protein interacted with any LAMMER kinase construct, demonstrating that the C-terminal domain of EF1g is necessary and sufficient for interaction with LAMMER protein kinases. High levels of sequence identity characterize EF1g proteins from diverse species: We next embarked on characterization of Drosophila EF1g to provide further insight into its function, as well as the possible significance of its interaction with DOA kinase. Drosophila EF1g is remarkably similar in amino acid sequence when compared with orthologs from widely diverged species. For example, Drosophila EF1g is 56% identical to the human protein (supporting information, Table S1) (Le Sourd et al. 2006; Gillen et al. 2008). These
relationships span the entire length of the open reading frames. The high level of sequence identity among widely diverged species suggests essential and conserved functions for EF1g proteins. EF1g expression during development: Northern transfers show a single predominant mRNA species throughout development (Figure 2A). RT–PCR analysis, however, demonstrated the expression of an alternatively initiated mRNA with virtually identical transcript length encoding the same protein throughout development (Figure 2, B and C), as suggested by FlyBase. Transcriptional regulation of EF1gRA by E93: Gorski et al. (2003) showed that EF1g transcripts are induced at the onset of autophagy, as are those encoding Doa (Kpebe and Rabinow 2008a). We therefore asked whether the locus was under control of the ecdysone-dependent transcription factor E93, as is Doa. As shown in Figure 2, D and E, flies of genotype E931/Df(3R)93Fx2 possess roughly equivalent levels of EF1g transcripts as wild type (Canton-S, CS), at the end of the third larval instar and at 16 hr following pupation. However, at 24 hr following pupariation, EF1g transcripts are reduced by 50% in E931/Df(3R)93Fx2, compared with CS controls, as determined by quantitation of the EF1g signal, normalized to rp49 as a loading control. Semi-quantitative RT–PCR analysis further revealed that only the EF1g–RA transcript is reduced in E93 mutants (Figure 2F), demonstrating isoform specificity in the effects of ecdysone signaling on EF1g expression. C. Cocco and L. Rabinow (unpublished data) show that the transcription factor RELISH also transcriptionally regulates Doa and it co-induces additional loci during the onset of autophagy in cooperation with E93. We therefore asked whether rel mutations might also affect EF1g transcript accumulation. No effects were observed on EF1g transcripts, as analyzed by RT– PCR, (not shown), indicating divergence, as well as
146
Y. Fan et al.
Figure 2.—EF1g transcript expression is widespread and under control of E93. (A) A Northern transfer of wild-type developmentally staged RNA shows EF1g is expressed at high levels throughout development. Lane 1, embryos 0–4 hr; lane 2, embryos 4–8 hr; lane 3, embryos 8–12 hr; lane 4, embryos 12–16 hr; lane 5, embryos 16–20 hr; lane 6, embryos 20–24 hr; lane 7, third instar larvae; lane 8, pupae 0–24 hr; lane 9, male adults 0–24 hr; and lane 10, female adults 0–24 hr. (B) A map derived from the BDGP representation for CG11901 (EF1g), showing the location of the primers used for PCR analysis in C and F. Two EF1g transcripts of approximately equal length and identical protein-coding capacity are produced via the use of alternative promoters and splicing. (C) RT–PCR analysis shows that both RNA isoforms of EF1g are produced throughout development. Lane 1, embryos 0–4 hr; lane 2, embryos 0–24 hr; lane 3, first instar larvae; lane 4, third instar larvae; lane 5, pupae 0–24 hr; lane 6, adult females 0–24 hr; lane 7, adult males 0–24 hr; lane 8, female third instar larvae; and lane 9, male third instar larvae. (D) EF1g transcript accumulation is regulated by the E93 transcription factor in the ecdysone pathway. Larvae and pupae were aged at 18° as described by Gorski et al. (2003). Lanes 1 and 2, third instar larvae; lanes 3 and 4, 16-hr pupae; lanes 5 and 6, 24-hr pupae. Lanes 1, 3, and 5, E93/Df(3R)93Fx2; lanes 2, 4, and 6, Canton-S (Cs) wild type. Note the relative reduction of EF1g transcripts in 24-hr E93 pupae (lane 5), relative to similarly aged CS (lane 6). (E)
similarities in the transcriptional control networks regulating these interacting gene products. Ubiquitous but nonuniform EF1g expression during embryogenesis: In situ hybridization during embryonic development shows ubiquitous expression of EF1g, including a maternal RNA contribution (Figure 3, left column). An antibody developed in rats against a recombinant Drosophila GST–EF1g fusion protein was validated on an immunoblot of a strain carrying Df(3R)3450, a deficiency of the locus (Figure 4A). When this antibody was used to stain developing embryos for EF1g protein (Figure 3, right column; also see Figure S1), general congruence with the in situ hybridization patterns was observed. An anterior-to-posterior gradient of maternally contributed EF1g RNA is observed in precellular blastoderms (Figure 3A, left panel). Although widely distributed even at this stage when revealed with DAB staining (Figure 3A, right panel), immunofluorescent staining (Figure 3F, left) reveals that EF1g protein is predominantly concentrated at the posterior pole of the embryo, which is maintained until at least formation of the cellular blastoderm (Figure S1). Immunocytochemical staining at later stages comparing fluorescence and DAB staining showed essentially identical patterns (Figure S1 and data not shown). Immunoblot analysis of protein samples throughout development shows that EF1g protein is expressed at all stages as a single protein species (data not shown). Cellular blastoderms stained with anti-EF1g antibody reveal dispersed cytoplasmic staining but also stained punctae (Figure 4B). Inspection of embryos costained with anti-tubulin reveal that the punctae of concentrated EF1g colocalize with tubulin (arrows), providing independent evidence supporting association of the proteins, as noted previously ( Janssen and Moller 1988; Hughes et al. 2008). Although largely, if not exclusively cytoplasmic during embryogenesis, a nuclear EF1g component was observed on immunotransfers in subcellular fractionations of 0- to 24-hr pupae (Figure 4C). This finding supports the notion that the protein may shuttle between the two compartments and that it possesses functions in addition to its presumed role in protein elongation.
Quantitation of the transfer shown in D, normalized to the rp49 loading control demonstrates that E93 mutant 24-hr pupae possess 50% of the level of EF1g transcripts as wild-type pupae at this stage. Quantitation was performed using ImageJ software. (F) RT–PCR of individual EF1g transcripts in E93 mutant pupae shows that only the RA transcript is under ecdysone control. Lanes 1 and 3, E93/Df(3R)93Fx2; lanes 2 and 4, CS. Lanes 1 and 2, 16-hr pupae; lanes 3 and 4, 24-hr pupae. Note the equivalent amplification in 16-hr samples (lanes 1 and 2), compared with the relative reduction of the RA transcript in the 24-hr E93/Df(3R)93Fx2 sample, (lane 3) compared to CS (lane 4), despite being evenly loaded (rp49 or RB).
Drosophila EF1g
Figure 3.—Ubiquitous but dynamic expression of EF1g during embryogenesis. EF1g expression during embryogenesis via in situ hybridization (A–E, left) and immunocytochemical staining (A–E, right). Anterior is to the left. Developmental stages based on Campos-Ortega and Hartenstein (1997). In A, precellular blastoderms show an anterior-to-posterior gradient of EF1g RNA, which, however, is not clearly reflected with an antibody raised against the protein and DAB staining (however, see F). In cellularized blastoderms just prior to gastrulation (B), high levels of EF1g RNA are observed ventrally (left, white arrow) and also at the posterior pole (white arrowhead). Curiously, EF1g RNA is virtually absent at the ventralanterior margin (black arrow). Lowered protein levels are also observed at the ventral-anterior margin (right, arrow), although posterior and ventral protein levels do not reflect the dramatic differences in mRNA concentrations. (C) An early stage-6 (left) and stage-8 embryo (right). mRNA is seen accumulating in a more uniform pattern at stage 6 than in previous stages (left). The beginnings of the cephalic furrow are just visible (white arrow and arrowhead). EF1g protein at stage 8 (right) appears more heavily expressed in the developing ventral neurogenic region (arrows). (D) Stage-12 embryos, showing accumulation of particularly high RNA and protein levels in the developing and extending midgut (arrows). (E) Stage 13/14 embryos in which the midgut has fused. Higher levels of EF1g continue to be expressed in the midgut, but protein accumulation is also noticeable in the condensing ventral nerve cord (arrow). (F) Immunofluorescence staining of precellular blastoderms demonstrates that EF1g protein is localized to the posterior pole, (arrow, left). Hoechst staining of the same embryo (right). The posterior concentration of EF1g is deposited maternally. Even the
147
EF1g encodes a vital function: Pbac{PB}Ef1gc01148 is inserted at the penultimate codon of EF1g (CG11901), (http://flybase.org/; Figure 5), but completely complements Df(3R)Exel6212 (99A1–99A5), which deletes the locus. In contrast, GE29510, a P-element insertion, obtained from Genexel, carries an insertion at nucleotide 25,045,881 on 3R near the 59 end of the EF1g transcript (Figure 5), is recessive lethal, and fails to complement Df(3R)Exel6212. To determine whether the recessive lethality was due to a mutation induced in EF1g and to generate a null allele, we mobilized the Pelement in GE29510. Of 104 w revertants recovered, 76 chromosomes complemented Df(3R)Exel6212. Four were sequenced and are precise excisions of the GE29510 P-element (accession no. EF192543). Among 28 imprecise excisions generating small deficiencies removing part or all of EF1g or retaining only part of the original P-element insertion, allele A70 is a presumed null, since it deletes the 59 third of EF1g coding sequences, including the translation start site (Figure 5, accession no. EF192542). A70 fails to complement the recessive lethality of Df(3R)Exel6212 and of GE29510, demonstrating that the initial P-element insertion is also an authentic EF1g allele. Three hypomorphic alleles, A15, A28, and A42 carry partial excisions of the original P-element and partial deletions of EF1g (accession nos. EF192544, EF192545, and EF192546, respectively). Although they fail to complement Df(3R)Exel6212, they are homozygous viable and produce EF1g protein at reduced quantities compared with wild-type (data not shown). The vast majority of EF1gA28 homozygotes die during pupation, and escaping adults cannot walk. They also display rough eyes and duplicated scutellar bristles. A42 homozygotes possess slightly rough eyes and duplicated scutellar bristles, while A15 homozygotes display no abnormal phenotypes. Recessive lethality of the null EF1gA70 homozygotes occurs during larval stages, since 96% of embryos hatch as larvae in crosses between heterozygotes. Subsequently 73% of larvae emerge as pupae, 98% of which eclose as adults. Similar results were obtained in crosses between GE29510 heterozygotes. These observations are consistent with the maternally provided EF1g RNA and protein providing function to the developing embryo and larvae. Cell clones of the A70 null allele generated with FLP site-specific recombinase showed survival of the wildtype w twinspot in the eye, but no homozygous mutant cells (Figure 6A). Additionally, induction of transgenes expressing interfering RNA (IR), for EF1g in sensory organ precursor cells with the sca–GAL4 driver elimitwo pronuclei have not yet fused (white arrow). Similar posterior localization of EF1g is also observed in later precellular blastoderms, in which nuclei have migrated to the embryonic cortex (Figure S1 C).
148
Y. Fan et al.
Figure 5.—Genomic structure of wild-type and EF1g insertion and imprecise excision mutants. The region encoding EF1g is 1948 bp long. The two transcripts, RA and RB, are shown under the scale bar. Both encode the same protein. The initial P-element insertion used in generation of alleles, EP(3) GE29510 is inserted at the beginning of the transcribed region. The null allele EF1gA70 was recovered by imprecise excision of the GE29510 P-element, deleting 662 bp and removing the first third of the coding region, but retaining 21 bp of the initial P-element insertion. The insertion site of PBac{PB}Ef1gc01148 at the penultimate codon of the locus is also indicated, although this insertion produces no phenotype. Untranslated regions of the transcripts are hatchmarked. Figure 4.—EF1g protein is both cytoplasmic and partially microtubule-associated, but also nuclearly localized. (A) The specificity of antisera raised against a GST–EF1g fusion protein was confirmed by probing protein extracts from Drosophila strain Df(3R)3450/TM6B, thus carrying only a single copy of the region 98E3 to 99A6-8, which includes EF1g at 99A1-6. Extracts were compared for EF1g immunoreactivity with CS (wild type) protein extracts on immunoblots. Lanes 1 and 3, Df(3R)3450/TM6B; lanes 2 and 4, CS. Equal amounts of total protein were loaded in lanes 1 and 2 (5 mg) and lanes 3 and 4 (10 mg). The same immunoblot was reprobed with anti-tubulin as a loading control. As an example, although lane 3 contains twice as much protein as lane 2, as shown by the tubulin-loading control, equal EF1g signal is observed in these two lanes, demonstrating that the protein detected is encoded in the region deleted in Df(3R)3450. Similarly, twice as much EF1g signal is observed in lane 4 compared with lane 3, although total protein loaded is equal. (B) EF1g antibody diffusely labels the cytoplasm of Drosophila embryos at the cellular blastoderm stage (red), as shown by its exclusion from nuclei, but also colocalizes with the tubulin cytoskeleton (green), as indicated by the arrows showing some examples of colabeling. (C) EF1g is found in total extracts (lane 1), but also in nuclear fractions (lane 2), in 0- to 24-hr pupal extracts.
nated thoracic bristles (data not shown), while their induction in the eye with GMR–GAL4 resulted in disrupted morphology (Figure 6D). Finally, expression of EF1g–IR alleles with the strong ubiquitous da–GAL4 driver yielded lethality. Taken together with the results demonstrating recessive larval lethality, we conclude that EF1g protein is required for both organismal and cellular viability. We also generated transformants of a full-length EF1g cDNA in the pUAS-T vector. No aberrant phenotypes were observed when expression of the construct was driven with da–GAL4 or sca–GAL4 in wild-type backgrounds. Slightly roughened eyes were induced by expression of wild-type EF1g transgenes via GMR–GAL4
(Figure 6C). Expression of EF1g from these constructs using the ubiquitous da–GAL4 driver efficiently rescued recessive lethality of the EF1gA70 allele, demonstrating the functionality of the transgene. No evident role for EF1g in innate immunity: Because EF1g had been implicated in the innate immune response and as a component of the Drosophila phagosome (Foley and O’Farrell 2004; Stuart et al. 2007), we tested whether mutants at the locus were particularly susceptible to bacterial infection. However, survival times of either A15 homozygotes or A70 heterozygotes following septic injury were not different from wild-type controls (data not shown). Moreover, no differences in b-galactosidase activity expressed from a dipt–lacZ transgene in response to septic or aseptic injury were observed in A70 heterozygotes (data not shown). We conclude that EF1g plays at best a subtle role in innate immunity in response to septic injury. Genetic interactions of EF1g: We tested for genetic interactions between EF1g alleles and those in one of the two paralogous EF1a loci in Drosophila melanogaster. Trans-heterozygotes between EF1gGE29510 and two recessive lethal alleles of the EF1a 48D locus, EF1a01275 or EF1ak06102, revealed no aberrant phenotypes and were also fertile. We also tested the A70 allele of EF1g as a heterozygote for interactions with homozygous mutations in thor, the Drosophila ortholog of eIF4E-binding protein, since thor alleles both presumably affect translation and the immune response (Bernal and Kimbrell 2000). No visible phenotypes were observed. In contrast to the lack of visible genetic interactions with EF1a or thor, we observed slight abnormalities in trans-heterozygous DoaHD EF1gGE29510/DoaDEM flies. Ectopic wing venation, failure of either of the cross-veins to attach, particularly the posterior cross-vein in males
Drosophila EF1g
149
Figure 6.—EF1g mutant and overexpression phenotypes. (A) GMR–GAL4/1, wild-type control. (B) GMR–GAL4/1; UAS–EF1gWT, line 1-2M. Note slightly roughened eyes in the color photo and occasional fused facets in the scanning electron micrograph (arrows). (C) GMR– GAL4/1; UAS–EF1gSer294Ala line 2-6M, also with slightly roughened eyes. Fused facets are also seen in the scanning electron micrograph. (D) EF1g cell clones are cell lethal, since only wild-type homozygous (w) recombinant clones were observed; no w1/w1 homozygous mutant cells were recovered. (E) UAS–EF1gIR driven with GMR–GAL4 also yields roughened eyes. (F) Mild enhancement of Doa phenotypes was observed in EF1gGE29510 DoaHD/DoaDEM animals. This example shows failure of the posterior cross-vein to attach and ectopic wing venation (arrows). Other malformed wings showed misplaced posterior cross-veins and spurs on posterior cross-veins.
(Figure 6F), aberrantly formed cross-veins, occasional eye roughness, curved wings, and rarely, partial rotation of the female genitalia were noted (data not shown). We also crossed both the GE29510 and A70 alleles to tra/1, tra2/1 and double-heterozygous tra2/1; tra/1 flies, to test whether EF1g had any role in somatic sex determination, as does Doa. Because EF1g was recently identified as a component of the 39 end cleavage process, and Doa alleles reduce accumulation of RNA prematurely terminated in the copia element inserted in the apricot allele of white, we also tested whether heterozygous or homozygous EF1g alleles would act as second-site modifiers of wa. No interactions in any of these mutant combinations were observed, however. LAMMER kinases phosphorylate Drosophila EF1g in vitro: To further investigate the interactions between EF1g and DOA kinase we first asked whether the former was an in vitro substrate for the latter. The cDNA encoding full-length EF1g from BDGP EST clone LD07046 was expressed and purified as a fusion protein from the pGEX2T vector. The initial EF1g cDNA clone interacting with DOA in the two-hybrid screen encoding the carboxy-terminal third of the protein was inserted into the pMalC2 plasmid, expressed, and purified on amylose columns. Both purified EF1g fusion proteins were phosphorylated in vitro by recombinant DOA kinase (Figure 7), whereas the isolated GST or maltose binding domains were not (data not shown), demonstrating that phosphorylation of the recombinant EF1g sequences occurs in its carboxy terminal, and not on the fusion domains. To examine the generality of EF1g as a LAMMER kinase substrate, we tested both fusion proteins for phosphorylation by the tobacco LAMMER kinase PK12 (Sessa et al. 1996; Savaldi-Goldstein et al.
2000). Both EF1g proteins were phosphorylated, demonstrating their generality as LAMMER kinase substrates. Attempts to further demonstrate direct protein–protein interactions between DOA and EF1g via GST ‘‘pull-down’’ experiments to precipitate DOA kinase from Drosophila extracts were unsuccessful (data not shown), but it may be that the complex is insufficiently stable to survive. The principal LAMMER kinase in vitro phosphorylation site is conserved in all EF1g orthologs: Scanning of the translated protein sequence of Drosophila EF1g at Scansite (http://scansite.mit.edu/) (Yaffe et al. 2001), identified a single likely LAMMER kinase phosphorylation site (Nikolakaki et al. 2002), at amino acid residue 294 in the Drosophila sequence. The essential features of this site (Arg at 3, Ser at P, are identical in EF1g proteins from widely diverged species (Table 2). Moreover, acidic or highly charged residues (Glu/Asp at 7, 6, 12, and 13 relative to the phosphorylation site), are invariant among EF1g proteins and also constitute important features of LAMMER kinase phosphorylation sites. The extreme conservation of these sequences suggests that they are critical to EF1g function and that their phosphorylation by LAMMER kinases is also conserved. We eliminated Ser294 via site-directed mutagenesis (Ser294Ala) to test whether it was a LAMMER kinase phosphorylation site, and tested the wild-type and modified full-length and C-terminal fusion proteins as substrates for both DOA and PK12 LAMMER kinases. The Ser294Ala amino acid replacement almost completely eliminated phosphorylation of the full-length EF1g protein by both kinases, suggesting that we had identified the major LAMMER kinase phosphorylation site, but that additional minor sites also may exist
150
Y. Fan et al.
Figure 7.—LAMMER kinases phosphorylate Drosophila EF1g. (A–D) Purified recombinant EF1g proteins were subjected to in vitro phosphorylation by DOA (A and B) and the tobacco LAMMER kinase, PK12 (C and D). (A and C) Coomassie stained gels, autoradiographed in B and D. (A and B) Lane 1, purified recombinant DOA kinase catalytic domain, showing autophosphorylation at 84 kDa and a presumed partial degradation product at roughly 25 kDa. Lane 2, DOA 1 wild-type full-length GST–EF1g. Lane 3, DOA 1 GST–EF1g Ser294Ala full-length protein. Note the virtual elimination of labeling of the intact 60 kDa EF1g protein in lane 3 (Ser294Ala) compared with lane 2 (wild-type EF1g protein), although the purified protein concentrations were equal (A). Some labeling of a presumed partially degraded EF1g protein is observed in lane 3, as well as lane 2 at roughly 50 kDa, suggesting the existence of one or more secondary DOA phosphorylation sites in EF1g. (C and D) Lane 1, purified PK12 kinase; lane 2, PK12 1 full-length wild type EF1g (the kinase and the full-length EF1g fusion protein comigrate); lane 3, PK12 1 full-length Ser193Ala EF1g; lane 4, PK12 1 C-terminal wildtype EF1g fusion protein; PK12 1 C-terminal Ser294Ala EF1g. Drastically reduced phosphorylation of not only the mutant EF1g protein, but also the autophosphorylation of PK12 kinase (lane 5), despite identical protein concentrations (C) suggests that the Ser294Ala mutation generated a competitive inhibitor. Similarresults were obtained with DOA (data not shown). (E) EF1g protein fromDoa mutants migrates aberrantly. Lane 1, wild-type (Canton-S)0- to 24-hr-old pupalprotein extracts were compared forEF1g protein mobility with extracts from Doa heteroallelic mutants (DoaHD/DoaDEM, lane 2). Aberrant migration of EF1g from this mutant combination was observed repeatedly, whereas it was not observed in protein extracts prepared from heterozygotes for several Doa alleles, including these two (data not shown).
(Figure 7). Phosphorylation of the modified C-terminal fusion EF1g protein was completely eliminated by the Ser294Ala replacement for both DOA and PK12 kinases. Interestingly, reduced autophosphorylation of both DOA and PK12 was also observed when incubated with the Ser294Ala EF1g C-terminal protein, suggesting that this modification generated a competitive inhibitor of these kinases. Doa mutations induce altered mobility of EF1g protein in vivo: Mobility of EF1g was examined on immunoblots of wild-type Drosophila protein extracts compared to those of a combination of Doa alleles (DoaDEM/DoaHD), to determine whether its phosphorylation was altered. EF1g migrating at a molecular weight of 45 kDa was observed in both wild-type and Doa mutant extracts (Figure 7E). However, an additional band slightly lower in apparent molecular weight was observed in the Doa heteroallelic extracts, as well as a third band at a slightly higher apparent molecular weight of 48 kDa. To rule out the possibility of different genetic backgrounds producing EF1g proteins of different molecular weights, we tested the dependence of the novel band in Doa heteroallelic mutants as being dependent on the genotype at the Doa locus. Protein extracts from
heterozygotes for the two alleles used in the heteroallelic test (DoaHD/1 and DoaDEM/1), as well as several additional alleles were examined on immunoblots. No aberrant migration of EF1g protein was observed (data not shown), confirming that altered EF1g migration depends upon the combination of mutant alleles at Doa and supporting the hypothesis that EF1g is a DOA kinase substrate in vivo as well as in vitro. EF1g migrating at the wild-type molecular weight in Doa mutant extracts is presumably due to the fact that the heteroallelic Doa combination is hypomorphic, and thus residual amounts of kinase are present. We next tested whether treatment with three different nonspecific phosphatases (calf intestinal phosphatase, lambda phosphatase, and potato acid phosphatase), could induce EF1g from wild-type Drosophila protein extracts to migrate aberrantly. Our prediction was that reduced phosphorylation would induce aberrant migration of the wild-type protein. However, none of the three phosphatases altered the mobility of wild-type EF1g on immunoblots (data not shown). Treatment of Doa heteroallelic mutant extracts with the same phosphatases also failed to alter mobility EF1g mobility (data not shown). Our results suggest that phosphorylation of EF1g by DOA kinase prevents a secondary type of post-
Drosophila EF1g
151
TABLE 2 Comparison of LAMMER protein kinase consensus phosphorylation sites with a sequence present in all EF1g orthologs Position LAMMER kinase consensus EF1g consensus
7
6
5
4
3
2
1
0
11
12
13
R/D
R/K D D/E
R/H E F/Y/W
E/R
R
R
R
H/R E Y
S
K
E/R A —
S
N
R/E D E
D/R E D
D
The one-letter amino acid code is used. Boldface letters in the LAMMER kinase consensus sequence indicate amino acids that were most preferentially selected (selectivity value .2.0), while underlined residues are invariant in all identified substrates. Residues are numbered relative to the phosphorylation site at 0, data from Nikolakaki et al. (2002). Boldface letters in the EF1g consensus indicate identical amino acids present in at least 9 of the 10 arbitrarily selected species compared; underlined residues are invariant. Serine 294 is the principal residue phosphorylated in Drosophila EF1g by DOA and and PK12 kinases. The 9 arbitrarily chosen species and 11 orthologs compared were: D. melanogaster, Homo sapiens, Oryctolagus cuniculus, Artemia salina, Caenorhabditis elegans, Trypanosoma cruzi, Schizosaccharomyces pombe, and two paralogs each from Xenopus laevis and Saccharomyces cerevisiae.
translational modification, whose nature remains unknown. Alternatively, DOA might be interacting with EF1g at least in part via some indirect intermediate, which in turn could modify the latter protein. These two alternatives are not mutually exclusive. Attempts to analyze the presumed post-translational modification on EF1g in Doa mutants by mass spectrometry were blocked because our antibodies were incapable of immunoprecipitation. Rescue of EF1g recessive lethality by transgene constructs is compromised by Ser294Ala mutations: As noted above, a wild-type UAS–EF1g cDNA transgene rescued recessive lethality of the EF1gA70 null allele when expressed via the da–GAL4 driver. Overexpression of this construct in the eye via the GMR–GAL4 driver also produced slightly roughened eyes (Figure 6C). To characterize further the role of DOA kinase phosphorylation might play in EF1g function, we constructed Drosophila lines carrying cDNA transgenes carrying the Ser294Ala site-directed substitution. When expressed via GMR–GAL4, the mutant EF1g transgenes also roughened the fly eye to approximately the same extent as the wild type (Figure 6, compare E and C). However, we noted distinctly lower survival of females in lines in which the mutant EF1g transgene was used to rescue recessive lethality of the A70 null allele, in comparison with those expressing the wild-type cDNA (Table S2). To recapitulate the table, transgenes expressing the wildtype EF1g cDNA rescued the approximate percentage of expected zygotes of both sexes (25% of the cross) for the two lines tested (n ¼ 92 total for line 1-2M; 25.4% females and 27.3% males were of the rescued genotype; for line 1-4M, n ¼ 157 total; 16.7% of the F1 were rescued females, 22.8% were rescued males). Transgenes expressing the Ser294Ala cDNA construct rescued males approximately as well as the wild type for both lines tested (line 2-3M, n ¼ 28, 28.6% survival; line 2-4M, n ¼ 69, 18.8% survival). In contrast, the Ser294Ala transgenes rescued female A70 homozygotes only poorly (line 2-3M, n ¼ 60, 8.3% survival; line 2-4M, n ¼ 73, 8.2% survival).
These results are supported by the observation that each of the two stocks of the wild-type and mutant UAS-driven transgenes behave differently. Two lines balanced for the wild-type transgene on the second chromosome and the EF1gA70 null allele on the third lose the TM6 balancer and become homozygous mutant, even without the presence of a GAL4 driver element. However, these lines still carry the A70 allele, as verified via complementation tests. The presence of low levels of EF1g protein in these flies was confirmed on immunoblots (data not shown). The survival of homozygotes is thus apparently due to leaky transcription from the UAS promoter, yielding sufficient EF1g expression to rescue the recessive lethality of the A70 allele. In contrast to the wild-type lines, neither of the two lines carrying the Ser294Ala transgene on the second chromosome lose their third-chromosome balancers, suggesting that they are impaired in their ability to rescue recessive lethality of A70 at low expression levels. Taken together, these results suggest that the Ser294Ala substitution partially compromises EF1g activity, but that the protein retains the ability to perform some of its functions, particularly in males. DISCUSSION
Our data show that the EF1g locus is essential for both organismal and cellular viability and that the protein partially colocalizes to the microtubule network, as suggested by biochemical studies. We also detected EF1g in pupal nuclear extracts, implying a role for it in processes in addition to translational elongation. Our observation is supported by the recent finding that EF1g participates in the pre-mRNA 39 end cleavage complex (Shi et al. 2009), which is also consistent with demonstrations that the protein binds RNA. Expression patterns of EF1g suggest that it may function in the formation of the anterior/posterior axis during Drosophila embryogenesis. We did not obtain
152
Y. Fan et al.
any evidence suggesting a role for the protein in the innate immune response, in contrast to previously reported results. This discrepancy may be due to the use of a cell-culture model in the previous study, although we cannot rule out the possibility that other bacterial challenges might have elicited aberrant immune responses in EF1g mutants. Xenopus EF1g is phosphorylated by cdc2 (CDK1) kinase at residue 230 at the onset of oocyte maturation (Belle´ et al. 1989; Cormier et al. 1991; MulnerLorillon et al. 1992), but the function of this phosphorylation remains unknown. A possible role in elongation rates of protein synthesis is suggested by the finding that in vitro translation rates were affected, albeit in different and message-specific directions, by CDK1/cyclin B phosphorylation of EF1d and EF1g (Monnier et al. 2001). Sequence alignments reveal, however, that the CDK1 phosphorylation site in EF1g is not conserved outside of vertebrate species (data not shown), in contrast to the LAMMER kinase phosphorylation site found in all orthologs described here. Thus the CDK1 phosphorylation presumably serves a function restricted to vertebrates, whereas the LAMMER kinase phosphorylation would appear to be more universal. Although we did not identify a specific cellular function for EF1g, our data show that it interacts with and is a substrate for DOA kinase in vitro and is also likely to be one in vivo. Several lines of evidence demonstrate interaction between the Doa and EF1g loci and their proteins. Genetic interactions between the two loci suggest a functional role for this interaction in patterning wing venation and in other tissues as well. The reduced ability of a Ser294Ala EF1g construct to rescue lethality of a null allele compared with the wild type suggests that this phosphorylatable residue, an in vitro phosphorylation site for DOA and other LAMMER kinases, is required for full EF1g activity. Moreover, the extreme conservation of the LAMMER kinase phosphorylation site in all EF1g orthologs, as well as the interaction and phosphorylation of EF1g with human and plant LAMMER protein kinases support the hypothesis that this phosphorylation is universally conserved among eukaryotes. Our results also suggest that phosphorylation of EF1g by DOA kinase prevents a secondary and unknown post-translational modification. DOA kinase was isolated in genomewide yeast two-hybrid screens with a number of ubiquitin-related conjugating or hydrolyzing enzymes (Giot et al. 2003; Stanyon et al. 2004), and EF1g is associated with proteosomal components during oocyte maturation in Xenopus (Tokumoto et al. 2003). It is thus tempting to speculate that phosphorylation of EF1g by LAMMER kinases may also play a role in this association and the subsequent modification of EF1g.
The advice of Lenore Neigeborn was essential to the success of the two-hybrid screen. We thank Steve Elledge, Karen Colwill, Bruce Edgar, and Bob Lahue for providing published and unpublished materials and Franc xois Leulier for bacterial strains and detailed protocols for the immunity assays. Flies were obtained from the Indiana University Drosophila stock center, the Japanese National Institute of Genetics Genetic Strains Research Center, and Genexel. Sheila Norton of the University of Nebraska Medical Center (UNMC) Molecular Biology Core Laboratory at the National Cancer Institute (NCI)-supported UNMC/Eppley Cancer Center performed initial DNA sequencing, and Severine Domenichini (Plateforme Microscopie Electronique, Imagerie-Biocellulaire IFR87, Orsay-Gif, Universite´ Paris 11), the scanning electron micrography. This work was supported by grants IBN9724006 from the National Science Foundation, the Centre National de la Recherche Scientifique (CNRS), and the Universite´ Paris Sud 11. Additional funding was provided by the French Ministry of Research and the CNRS (03G138), in the Biological Resource Center program for fundamental research: ‘‘Natural and induced variants in Drosophila’’ and by the Division de la Recherche, Universite´ Paris 11. Y.F. was supported by graduate fellowships from the Universite´ de Paris Sud 11 and the China Scholarship Council.
LITERATURE CITED Al-Maghrebi, M., H. Brule, M. Padkina, C. Allen, W. M. Holmes et al., 2002 The 39 untranslated region of human vimentin mRNA interacts with protein complexes containing eEF-1gamma and HAX-1. Nucleic Acids Res. 30: 5017–5028. Ashburner, M., 1989 Drosophila: A Laboratory Handbook. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman et al. (Editors), 1989 Current Protocols in Molecular Biology. Greene/Wiley Publishing, New York. Belle´, R., J. Derancourt, R. Poulhe, J.-P. Capony, R. Ozon et al., 1989 A purified complex from Xenopus oocytes contains a P-47 protein, an in vivo substrate of MPF, and a p30 protein respectively homologous to elongation factors EF1g and EF1B. FEBS Lett. 255: 101–104. Bernal, A., and D. A. Kimbrell, 2000 Drosophila Thor participates in host immune defense and connects a translational regulator with innate immunity. Proc. Natl. Acad. Sci. USA 97: 6019–6024. Campos-Ortega, J. A., and V. Hartenstein, 1997 The Embryonic Development of Drosophila melanogaster. Springer, Berlin. Carvalho, M. G., J. F. Carvalho and W. C. Merrick, 1984 Biological characterization of various forms of elongation factor 1 from rabbit reticulocytes. Arch. Biochem. Biophys. 234: 603–611. Colwill, K., L. L. Feng, J. M. Yeakley, G. D. Gish, J. F. Caceres et al., 1996a SRPK1 and Clk/STY protein kinases show distinct substrate specificities for Serine/Arginine-rich splicing factors. J. Biol. Chem. 271: 24569–24575. Colwill, K., T. Pawson, B. Andrews, J. Prasad, J. L. Manley et al., 1996b The Clk/STY protein kinase phosphorylates SR splicing factors and regulates their intranuclear distribution. EMBO J. 15: 265–275. Cormier, P., H. B. Osborne, J. Morales, T. Bassez, R. Poule et al., 1991 Molecular cloning of Xenopus elongation factor 1g, major M-phase promoting factor substrate. Nucleic Acids Res. 19: 6644. Dasmahapatra, B., L. Skogerson and K. Chakraburtty, 1981 Protein synthesis in yeast II. Purification and properties of elongation factor 1 from Saccharomyces cerevisiae. J. Biol. Chem. 256: 10005–10011. Dorsett, D., 1990 Potentiation of a polyadenylation site by a downstream protein-DNA interaction. Proc. Natl. Acad. Sci. USA 87: 4373–4377. Du, C., M. E. McGuffin, B. Dauwalder, L. Rabinow and W. Mattox, 1998 Protein phosphorylation plays an essential role in the regulation of alternative splicing and sex determination in Drosophila. Mol. Cell 2: 741–750.
Drosophila EF1g Durfee, T., K. Becherer, P. L. Chen, S. H. Yeh, Y. Yang et al., 1993 The retinoblastoma protein associates with the protein phosphatase type 1 catalytic subunit. Genes Dev. 7: 555–569. Ejiri, S., 2002 Moonlighting functions of polypeptide elongation factor 1: from actin bundling to zinc finger protein R1-associated nuclear localization. Biosci. Biotechnol. Biochem. 66: 1–21. Foley, E., and P. H. O’Farrell, 2004 Functional dissection of an innate immune response by a genome-wide RNAi screen. PLoS Biol. 2: 1091–1106. Gillen, C. M., Y. Gao, M. M. Niehaus-Sauter, M. R. Wylde and M. G. Wheatly, 2008 Elongation factor 1Bgamma (eEF1Bgamma) expression during the molting cycle and cold acclimation in the crayfish Procambarus clarkii. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 150: 170–176. Giot, L., J. S. Bader, C. Brouwer, A. Chaudhuri, B. Kuang et al., 2003 A protein interaction map of Drosophila melanogaster. Science 302: 1727–1736. Gorski, S. M., S. Chittaranjan, E. D. Pleasance, J. D. Freeman, C. L. Anderson et al., 2003 A SAGE approach to discovery of genes involved in autophagic cell death. Curr. Biol. 13: 358–363. Hughes, J. R., A. M. Meireles, K. H. Fisher, A. Garcia, P. R. Antrobus et al., 2008 A microtubule interactome: complexes with roles in cell cycle and mitosis. PLoS Biol. 6: 785–795. James, P., J. Halladay and E. A. Craig, 1996 Genomic libraries and a host strain designed for highly efficient two-hybrid selection in yeast. Genetics 144: 1425–1436. Janssen, G. M. C., and W. Moller, 1988 Elongation factor 1bg from Artemia: purification and properties of its subunits. Eur. J. Biochem. 171: 119–129. Jeppesen, M. G., P. Ortiz, W. Shepard, T. G. Kinzy, J. Nyborg et al., 2003 The crystal structure of the glutathione S-transferase-like domain of elongation factor 1Bgamma from Saccharomyces cerevisiae. J. Biol. Chem. 278: 47190–47198. Kim, S., J. Kellner, C. H. Lee and P. A. Coulombe, 2007 Interaction between the keratin cytoskeleton and eEF1Bg affects protein synthesis in epithelial cells. Nat. Struct. Mol. Biol. 14: 982–983. Kpebe, A., and L. Rabinow, 2008a Alternative promoter usage generates multiple evolutionarily conserved isoforms of Drosophila DOA kinase. Genesis 46: 132–143. Kpebe, A., and L. Rabinow, 2008b Dissection of DOA kinase isoform functions in Drosophila. Genetics 179: 1973–1987. Le Sourd, F., S. Boulben, R. Le Bouffant, P. Cormier, J. Morales et al., 2006 eEF1B: at the dawn of the 21st century. Biochim. Biophys. Acta 1759: 13–31. Lee, K., C. Du, M. Horn and L. Rabinow, 1996 Activity and autophosphorylation of LAMMER protein kinases. J. Biol. Chem. 271: 27299–27303. Lee, C. Y., E. A. Clough, P. Yellon, T. M. Teslovich, D. A. Stephan et al., 2003 Genome-wide analyses of steroid- and radiation-triggered programmed cell death in Drosophila. Curr. Biol. 13: 350–357. Lew, Y., D. V. Jones, W. M. Mars, D. Evans, D. Byrd et al., 1992 Expression of elongation factor-1 gamma-related sequence in human pancreatic cancer. Pancreas 7: 144–152. Lopez, A. J., 1998 Alternative splicing of pre-mRNA: developmental consequences and mechanisms of regulation. Annu. Rev. Genet. 32: 279–305. Mathur, S., K. R. Cleary, N. Inamdar, Y. H. Kim, P. Steck et al., 1998 Overexpression of elongation factor-1gamma protein in colorectal carcinoma. Cancer 82: 816–821. Menegay, H. J., M. P. Myers, F. M. Moeslein and G. E. Landreth, 2000 Biochemical characterization and localization of the dual specificity kinase CLK1. J. Cell Sci. 113: 3241–3253. Merrick, W. C., and J. Nyborg (Editors), 2000 The Protein Synthesis Elongation Cycle. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Mimori, K., M. Mori, S. Tanaka, T. Akiyoshi and K. Sugimachi, 1995 The overexpression of elongation factor 1 gamma mRNA in gastric carcinoma. Cancer 75: 1446–1449. Mimori, K., M. Mori, H. Inoue, H. Ueo, K. Mafune et al., 1996 Elongation factor 1 gamma mRNA expression in oesophageal carcinoma. Gut 38: 66–70. Moeslein, F. M., M. P. Myers and G. E. Landreth, 1999 The CLK family kinases CLK1 and CLK2 phosphoryate and activate the tyrosine phosphatase PTP-1B. J. Biol. Chem. 274: 26697– 26704.
153
Monnier, A., R. Belle, J. Morales, P. Cormier, S. Boulben et al., 2001 Evidence for regulation of protein synthesis at the elongation step by CDK1/cyclin B phosphorylation. Nucleic Acids Res. 29: 1453–1457. Mulner-Lorillon, O., P. Cormier, J. Cavadore, J. Morales, R. Poulhe et al., 1992 Phosphorylation of Xenopus elongation factor-1g by cdc2 protein kinase: identification of the phosphorylation site. Exp. Cell Res. 202: 549–551. Nayler, O., S. Stamm and A. Ullrich, 1997 Characterization and comparison of four serine- and arginine-rich (SR) protein kinases. Biochem. J. 326: 693–700. Nayler, O., F. Schnorrer, S. Stamm and A. Ullrich, 1998 The cellular localization of the murine Serine/Arginine-rich protein kinase CLK2 is regulated by Serine 141 autophosphorylation. J. Biol. Chem. 273: 34341–34348. Nikolakaki, E., C. Du, J. Lai, L. Cantley, T. Giannakouros et al., 2002 Phosphorylation by LAMMER protein kinases: determination of a consensus site, identification of in vitro substrates and implications for substrate preferences. Biochemistry 41: 2055– 2066. O’Connell, P. O., and M. Rosbash, 1984 Sequence, structure and codon preference of the Drosophila ribosomal protein 49 gene. Nucleic Acids Res. 12: 5495–5513. Olarewaju, O., P. A. Ortiz, W. Q. Chowdhury, I. Chatterjee and T. G. Kinzy, 2004 The translation elongation factor eEF1B plays a role in the oxidative stress response pathway. RNA Biol. 1: e12–e17. Papavassiliou, A. G., and D. Bohmann, 1992 Dephosphorylation of phosphoproteins with potato acid phosphatase. Methods Mol. Cell. Biol. 3: 149–152. Prasad, J., and J. L. Manley, 2003 Regulation and substrate specificity of the SR protein kinase Clk/Sty. Mol. Cell. Biol. 23: 4139– 4149. Rabinow, L., S. L. Chiang and J. A. Birchler, 1993 Mutations at the Darkener of apricot locus modulate transcript levels of copia and copia-induced mutations in Drosophila melanogaster. Genetics 134: 1175–1185. Riis, B., S. I. S. Rattan, B. F. C. Clark and W. C. Merrick, 1990 Eukaryotic protein elongation factors. Trends Biol. Chem. 15: 420–424. Romeo, Y., and B. Lemaitre, 2008 Drosophila immunity: methods for monitoring the activity of Toll and Imd signaling pathways. Methods Mol. Biol. 415: 379–394. Savaldi-Goldstein, S., G. Sessa and R. Fluhr, 2000 The ethyleneinducible PK12 kinase mediates the phosphorylation of SR splicing factors. Plant J. 21: 91–96. Sessa, G., V. Raz, S. Savaldi and R. Fluhr, 1996 PK12, a plant dual-specificity protein kinase of the LAMMER family, is regulated by the hormone ethylene. Plant Cell 8: 2223– 2234. Shi, Y., D. Campigli Di Giammartino, D. Taylor, A. Sarkeshik, W. J. Rice et al., 2009 Molecular architecture of the human premRNA 39 processing complex. Mol. Cell 33: 365–375. Slobin, L. I., and W. Moller, 1978 Purification and properties of an elongation factor functionally analogous to bacterial elongation factor Ts from embryos of Artemia salina. Eur. J. Biochem. 84: 69–77. Stanyon, C. A., G. Liu, B. A. Mangiola, N. Patel, L. Giot et al., 2004 A Drosophila protein-interaction map centered on cellcycle regulators. Genome Biol. 5: R96. Staudinger, J., M. Perry, S. J. Elledge and E. N. Olson, 1993 Interactions among vertebrate helix-loop-helix proteins in yeast using the two-hybrid system. J. Biol. Chem. 268: 4608– 4611. Stuart, L. M., J. Boulais, G. M. Charriere, E. J. Hennessy, S. Brunet et al., 2007 A systems biology analysis of the Drosophila phagosome. Nature 445: 95–101. Tautz, D., and C. Pfeifle, 1989 A non-radioactive in situ hybridization method for the localization of specific RNAs in Drosophila embryos reveals translational control of the segmentation gene hunchback. Chromosoma 98: 81–85. Tokumoto, T., A. Kondo, J. Miwa, R. Horiguchi, M. Tokumoto et al., 2003 Regulated interaction between polypeptide chain elongation factor-1 complex with the 26S proteasome during Xenopus oocyte maturation. BMC Biochem. 4: 6.
154
Y. Fan et al.
Xu, T., and G. M. Rubin, 1993 Analysis of genetic mosaics in developing and adult Drosophila tissues. Development 117: 1223–1237. Yaffe, M. B., G. G. Leparc, J. Lai, T. Obata, S. Volinia et al., 2001 A motif-based scanning approach for genome-wide prediction of signaling pathways. Nat. Biotech. 19: 348–353. Yun, B., R. Farkas, K. Lee and L. Rabinow, 1994 The Doa locus encodes a member of a new protein kinase family, and is essential for eye and embryonic development in Drosophila melanogaster. Genes Dev. 8: 1160–1173.
Yun, B., K. Lee, R. Farkas, C. Hitte and L. Rabinow, 2000 The LAMMER protein kinase encoded by the Doa locus of Drosophila is required in both somatic and germ-line cells, and is expressed as both nuclear and cytoplasmic isoforms throughout development. Genetics 156: 749–761.
Communicating editor: T. Schu¨pbach
Supporting Information http://www.genetics.org/cgi/content/full/genetics.109.109553/DC1
Drosophila Translational Elongation Factor-1γ Is Modified in Response to DOA Kinase Activity and Is Essential for Cellular Viability Yujie Fan, Michael Schlierf, Ana Cuervo Gaspar, Catherine Dreux, Arlette Kpebe, Linda Chaney, Aurelie Mathieu, Christophe Hitte, Olivier Grémy, Emeline Sarot, Mark Horn, Yunlong Zhao, Terri Goss Kinzy and Leonard Rabinow
Copyright © 2009 by the Genetics Society of America DOI: 10.1534/genetics.109.109553
2 SI
Y. Fan et al.
FIGURE S1.—Staining with fluoresence or DAB reveals identical EF1g staining patterns at later embryonic stages. In Fig. 3, early pre-cellular blastoderms stained with fluorescent secondary antibodies reveal significant localization of EF1g protein at the posterior pole of the oocyte (Fig. 3F, left or. Fig. S1A), an aspect not revealed in the DAB-stained embryo of the same age (Fig. 3A, right). Pre-cellular blastoderms at later times (Fig. S1D) also show this localization (Fig. S1C). However, shortly following cellularization, the posterior cap of EF1g protein is dispersed or degraded, as seen in Fig. S1E. The ubiqutious expression of EF1g seen in embryos stained with fluorescent secondary antibodies is also observed in DAB-stained embryos (G) at this and all later times. Left column (A, C, E, G): Anti-EF1g-stained embryos. Right column (B, D. F): The same embryos as in A, C and E, stained with Hoechst reagent. The embryos in panels A, B and G are the same as those shown in Figure 3.
Y. Fan et al.
TABLE S1 Amino-acid similarity (identity) among some arbitrarily selected EF1γ orthologues.
Values are expressed in percent.
3 SI
4 SI
Y. Fan et al.
TABLE S2 Rescue of EF1gA70 recessive lethality by wild-type and Ser294Ala cDNA transgenes
Transgenic Line (P) Pupae / Sex (Adults) F1 Genotype
1-2M ♀
UAS-EF1gWT 1-4M ♂ ♀ ♂
UAS-EF1gSer294>Ala 2-3M 2-4M ♀ ♂ ♀ ♂
P[UAS-EF1g]/+; da-GAL4 EF1g A70/EF1g A70
15
9
13
18
5
8
6
13
P[UAS-EF1g]/+; da-GAL4 EF1g A70/TM6 P[UAS-EF1g]/+; EF1g A70/TM6 CyO/+; da-GAL4 EF1g A70/TM6 CyO/+; EF1g A70/TM6
44
24
65
61
55
20
67
56
59
33
78
79
60
28
73
69
25.4
27.3
16.7
22.8
8.3
28.6
8.2
18.8
Total P[UAS-EF1g]/+; da-GAL4 EF1g A70/EF1gA70 (%)
F1 segregating from: ♀ P(UAS-EF1g)/CyO; EF1gA70/TM6 X ♂ da-GAL4 EF1gA70/TM6
