ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Apr. 2008, p. 1438–1445 0066-4804/08/$08.00⫹0 doi:10.1128/AAC.01392-07 Copyright © 2008, American Society for Microbiology. All Rights Reserved.
Vol. 52, No. 4
Drug-Regulated Expression of Plasmodium falciparum P-Glycoprotein Homologue 1: a Putative Role for Nuclear Receptors䌤 David J. Johnson,1* Andrew Owen,2 Nick Plant,3 Patrick G. Bray,1 and Stephen A. Ward1 Molecular and Biochemical Parasitology, Liverpool School of Tropical Medicine, Pembroke Place, Liverpool, Merseyside L3 5QA, United Kingdom1; Department of Pharmacology and Therapeutics, 70 Pembroke Place, University of Liverpool, Liverpool L69 3GF, United Kingdom2; and Molecular Toxicology Group, School of Biomedical and Molecular Sciences, University of Surrey, Guildford, Surrey GU2 7XH, United Kingdom3 Received 29 October 2007/Returned for modification 6 December 2007/Accepted 3 January 2008
Acquired resistance to therapeutic agents is a major clinical concern in the prevention/treatment of malaria. The parasite has developed resistance to specific drugs through two mechanisms: mutations in target proteins such as dihydrofolate reductase and the bc1 complex for antifolates and nathoquinones, respectively, and alterations in predicted parasite transporter molecules such as P-glycoprotein homologue 1 (Pgh1) and Plasmodium falciparum CRT (PfCRT). Alterations in the expression of Pgh1 have been associated with modified susceptibility to a range of unrelated drugs. The molecular mechanism(s) that is responsible for this phenotype is unknown. We have shown previously (A. M. Ndifor, R. E. Howells, P. G. Bray, J. L. Ngu, and S. A. Ward, Antimicrob. Agents Chemother. 37:1318–1323, 2003) that the anticonvulsant phenobarbitone (PB) can induce reduced susceptibility to chloroquine (CQ) in P. falciparum, and in the current study, we provide the first evidence for a molecular mechanism underlying this phenomenon. We demonstrate that pretreatment with PB can elicit decreased susceptibility to CQ in both CQ-resistant and CQ-sensitive parasite lines and that this is associated with the increased expression of the drug transporter Pgh1 but not PfCRT. Furthermore, we have investigated the proximal promoter regions from both pfmdr1 and pfcrt and identified a number of putative binding sites for nuclear receptors with sequence similarities to regions known to be activated by PB in mammals. Whole-genome analysis has revealed a putative nuclear receptor gene, providing the first evidence that nuclear receptor-mediated responses to drug exposure may be a mechanism of gene regulation in P. falciparum.
P. falciparum P-glycoprotein homologue protein 1 (Pgh1), encoded by pfmdr1, was identified over a decade before pfcrt was identified (17). Like pfcrt, there are a number of mutations in pfmdr1 that have been associated with multidrug resistance (7). However, despite these correlations with CQR, genetic studies have shown that these mutations exert a greater influence on parasite susceptibility to a range of other antimalarials including mefloquine, halofantrine, and artemisinin than they do on CQ susceptibility (30, 37, 38). The multidrug-resistant (MDR) phenotype in mammalian tumor cells involves the amplification of MDR genes and the subsequent overexpression of P glycoprotein (3, 5). Studies of P. falciparum focused on this phenomenon and noted a correlation between pfmdr1 expression and CQR (7). However, a number of further studies failed to corroborate this observation, and since then, it has been conclusively demonstrated that pfmdr1 copy number and the expression of Pgh1 are more tightly associated with resistance to mefloquine than to CQR in field isolates and drug-pressured laboratory lines (7, 23, 26, 27). The molecular processes that govern the changes in pfmdr1 and pfcrt expression described above are poorly understood, with little known about the roles of promoters, terminators, and transcription factors in the regulation of gene expression. P. falciparum promoters appear to conform to the classical eukaryotic bipartite structure consisting of a proximal promoter regulated by upstream enhancer elements (cis-acting elements) (12), yet a classical regulatory motif, which can be
Malaria remains one of the largest global health problems, with between 1 and 2 million deaths each year, mostly in young African children. Chloroquine (CQ), the most widely used antimalarial drug for many decades, is now essentially useless, with resistance being reported in all areas where malaria is endemic; indeed, it has been reported that CQ resistance (CQR) is a major factor behind the increasing burden of malaria worldwide (9). Recent studies have implicated two genes in antimalarial drug resistance, the Plasmodium falciparum chloroquine resistance transporter gene (pfcrt), which confers CQR, and pfmdr1, which modulates CQR and resistance to the quinoline methanols and related structures (6, 7, 14, 18, 24, 25, 30, 47). The pfcrt gene is highly polymorphic, with a lysine-to-threonine substitution at codon 76 (K76T) present in all CQR isolates identified to date. Independent genetic experiments have confirmed the importance of mutations and in particular the K76T mutation in pfcrt as being responsible for the verapamil (VP)-sensitive element of the CQR phenotype (18, 39). Furthermore, genetic manipulation of the expression level of PfCRT in a CQR parasite was shown to correlate with an increased susceptibility to CQ, presumably due to a reduced transport of drug through PfCRT (45). * Corresponding author. Mailing address: Molecular and Biochemical Parasitology, Liverpool School of Tropical Medicine, Pembroke Place, Liverpool, Merseyside L3 5QA, United Kingdom. Phone: 44151-705-3151. Fax: 44-151-705-3371. E-mail:
[email protected]. 䌤 Published ahead of print on 14 January 2008. 1438
VOL. 52, 2008
Pgh1 EXPRESSION AND CQ SUSCEPTIBILITY
identified in multiple unrelated genes, has yet to be identified (20). In stark contrast is the wealth of information available about the role of transcription factors and promoters in gene regulation in mammals: one such example is the regulation of phase I and phase II drug-metabolizing enzymes and drug transporters by members of the nuclear receptor superfamily, such as pregnane X receptor (PXR) and constitutive androstane receptor (CAR), and their roles in modulating drug resistance patterns in mammals (1, 16, 19, 49). P. falciparum is known to possess orthologues for several nuclear receptor target genes, including cytochrome P450 (CYP) enzymes, Pgp, and multiresistance proteins, and previous work in our laboratory has shown that the pretreatment of parasite cultures with phenobarbitone (PB), a potent inducer of CYPs and Pgp, resulted in a decreased susceptibility to CQ (22). However, at the time of the initial observation, the molecular processes that regulate drug-induced changes in gene expression were unknown. We propose a novel system of nuclear receptor-inducible gene regulation based on the extensively characterized human system that includes drug activation of nuclear receptors and the subsequent translocation to the nucleus, resulting in an increased rate of transcription mediated by RNA polymerases and a subsequent increase in transporter protein levels. MATERIALS AND METHODS P. falciparum strains. Strain K1 (Thailand), a parasite isolate with a classical CQR phenotype and genotype, was kindly donated by D. Walliker (University of Edinburgh) and was cloned twice by the method of limiting dilution (33) to give the CQR clone K1H6/2. K1HF and K1AM are halofantrine-and amantadineresistant parasite lines, respectively, selected from the CQR isolate K1H6/2 (14, 32). These particular lines of P. falciparum have been extensively characterized both phenotypically and genetically and were chosen for this study because of their unique changes in drug susceptibility that were associated with the acquisition of novel mutations in pfcrt and not due to changes in expression levels of either PfCRT or Pgh1. Parasites were maintained in continuous culture. Cultures contained a 2% suspension of O⫹ erythrocytes in RPMI 1640 (R8758) medium supplemented with 10% pooled human AB serum, 25 mM HEPES (pH 7.4), and 20 M gentamicin sulfate (44). Pretreatment with PB. Synchronized ring-stage cultures of P. falciparum parasites were exposed to 0.1 M of PB for a total period of 48 h. Parasites were washed twice with drug-free RPMI 1640 medium to remove traces of PB, and samples were processed for in vitro drug susceptibility testing. To determine the effect of PB treatment on protein expression, trophozoite-stage parasites were exposed to 0.1 M PB for a total period of 48 h and processed as described below. The effect of PB on the growth rate of the P. falciparum lines used in this study was determined by microscopic analysis of Giemsa-stained blood films at regular intervals throughout the 48-h pretreatment period and compared against untreated control lines. It was observed that pretreatment with PB had no noticeable effect on parasite growth rates in any of the P. falciparum lines used in this study. In vitro drug susceptibility assays. The effect of PB pretreatment on CQ sensitivity in the absence or presence of 5 M VP was determined from the incorporation of [3H]hypoxanthine into parasite nucleic acids (4). Assays were initiated at 1% parasitemia and 1% hematocrit. Fifty percent inhibitory concentration (IC50) values were calculated for each assay using the four-parameter logistic method (Grafit program; Erithacus Software, Surrey, United Kingdom). Analysis of Pgh1 and PfCRT expression. Suspensions of trophozoite parasites at 10 to 15% parasitemia were isolated using saponin lysis, washed twice in ice-cold phosphate-buffered saline (PBS) to remove cell debris and hemoglobin, and resuspended in ice-cold PBS. A series of liquid nitrogen freeze-thaw cycles was performed to ensure sufficient cell lysis. The protein content of each sample was determined by the modified Bradford assay (Bio-Rad, United Kingdom). In order to normalize for loading, each sample was diluted appropriately with PBS to give the same protein concentration before an equal volume of 2⫻ sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis loading buffer (125 mM Tris-Cl [pH 6.8], 4% [wt/vol] SDS, 20% [vol/vol] glycerol, 10% [wt/vol]
1439
TABLE 1. Effect of pretreatment with PB on CQ susceptibility in CQ-resistant isolate K1H6/2 and CQ-sensitive isolates K1AM and K1HFa Parasite isolate
Drug
Mean IC50 (nM) ⫾ SEM Control
PB treated
K1H6/2
CQ CQ ⫹ VP
101 ⫾ 1 31 ⫾ 9
262 ⫾ 7 79 ⫾ 1
K1AM
CQ CQ ⫹ VP
26 ⫾ 9 25 ⫾ 9
84 ⫾ 9 21 ⫾ 2
K1Hf
CQ CQ ⫹ VP
38 ⫾ 7 32 ⫾ 7
70 ⫾ 2 31 ⫾ 7
a Assays were performed in the absence and presence of 5 M VP at 1% hematocrit and 1% parasitemia after pretreatment for 48 h with 0.1 M PB. IC50 values (nM) are presented as means ⫾ SEM (where n ⫽ ⬍3).
2-mercaptoethanol, 0.02% [wt/vol] bromophenol blue) was added. The samples were mixed vigorously with the 2⫻ SDS-polyacrylamide gel electrophoresis loading buffer and heated at 60°C for 15 min. Equal amounts of parasite protein from control and drug-treated cultures were loaded onto a 4 to 15% gradient SDSpolyacrylamide gel and electroblotted onto a polyvinylidene difluoride membrane. Protein expression was assessed by immunoblotting using antibodies raised against either the C terminus of PfCRT or the N terminus of Pgh1 and controlled for loading using anti-HSP70 antibodies. Immunoreactive bands were visualized by enhanced chemiluminescence (ECL; Pharmacia Biotech, United Kingdom) and analyzed by densitometry using GeneTools software (Syngene, United Kingdom).
RESULTS In vitro sensitivity testing. Pretreatment with PB resulted in a decreased susceptibility to CQ in all parasite lines tested (Table 1). Interestingly, the two drug-selected parasites, K1AM and K1HF, also exhibited a decreased susceptibility to CQ and had a partial return of the VP-sensitive CQR phenotype (Table 1). This observation is unique and unexpected considering that the drug-selected parasite lines had lost the VP-sensitive CQR phenotype on selection for resistance to amantadine and halofantrine, respectively (14). The observation that pretreatment with PB results in an increased resistance to CQ confirms the observations made by Ndifor et al. (21, 22). The effect of PB on the growth rate of the parasite lines was determined by microscopic analysis. Effect of PB on expression of Pgh1 and PfCRT. Pretreatment with PB resulted in a marked increase in the expression of Pgh1, the protein product of pfmdr1, in all parasite lines tested (Fig. 1A and B). Pgh1 expression was most pronounced in the halofantrine-resistant line K1HF compared to the control line K1H6/2 and the amantadine-resistant line K1AM; semiquantitative measurements indicate a 6.4-fold increase, versus 4.7-fold and 5.4-fold increases, in Pgh1 expression, respectively (Fig. 1F). However, PB treatment had no effect on the protein expression level of PfCRT in the lines tested (Fig. 1D and E). In silico search for transcription factors in 5ⴕ untranslated regions of pfmdr1 and pfcrt. Approximately 5 kb of the putative proximal promoter from pfmdr1 and pfcrt was examined for putative transcription factor binding sites using MatInspector software (28). The MatInspector search matrix included transcription factors from vertebrates, insects, plants, fungi, nematodes, and bacteria. This approach, utilizing a matrix and core
1440
JOHNSON ET AL.
ANTIMICROB. AGENTS CHEMOTHER.
FIG. 1. Effect of pretreatment with PB on expression of Pgh1 and PfCRT. Densitometric analysis of Western blots enabled the expression levels of Pgh1 and PfCRT to be determined in untreated controls (A and D) and PB-treated samples (B and E). Equal amounts of protein for each isolate were separated on a 4 to 15% gradient gel, and the protein was detected using antibodies raised against Pgh1 (⬃ 160 kDa), PfCRT (⬃ 44 kDa), and HSP-70 (⬃ 70 kDa). Bands were visualized by ECL and quantified by densitometry using GeneTools software (Syngene, United Kingdom). The ratios of Pgh1/HSP-70 and PfCRT/HSP-70 were used as an indicator of changes in the expression of Pgh1 and PfCRT after treatment compared to controls (C and F). Data are presented as means ⫾ standard errors of the means (where n ⫽ 3). ⴱⴱ, statistical significance compared to untreated controls, where P was ⬍0.05.
VOL. 52, 2008
Pgh1 EXPRESSION AND CQ SUSCEPTIBILITY
1441
FIG. 2. Schematic representation of the locations of putative transcription factor binding sites, predicted transcription start sites (arrow), and putative TATAA boxes in the 5⬘ promoter sequences of pfmdr1 and pfcrt as identified by interrogation of the MatInspector database (28). Abbreviations: BARBIE, barbiturate-inducible element; PRE, progesterone receptor binding site; AhR, aryl hydrocarbon receptor; GRE, glucocorticoid receptor.
similarity of 0.75, identified 1,975 and 1,798 putative transcription factor binding sites in the proximal promoters of pfmdr1 and pfcrt, respectively, with a large percentage of these hits corresponding to regulators of the cell cycle and the control of gene expression. A manual filter was then applied to the data set, limiting hits to those transcription factors known to be involved in the regulation of mammalian MDR genes, multiresistance proteins, and CYP enzymes. From this more refined analysis, 8 and 10 putative transcription factor binding sites were identified in the pfmdr1 and pfcrt proximal promoter regions, respectively. Figure 2 depicts the positions of these transcription factors relative to the transcription start site and the start codon of the gene. Table 2 shows the consensus
nucleotide binding sequences identified by MatInspector, the transcription factor commonly associated with binding at that site, plus details of the exact sequence identified and its similarity to the consensus. Base pairs in boldface type are important, show a high level of conservation to the transcription factor motif, and are critical for ligand binding. Base pairs in capital letters indicate the core sequence used by the MatInspector algorithm to identify the transcription factor motif in the DNA sequence. Preliminary analysis of the predicted parasite proteome using the NuReBaSe nuclear receptor database (http://www .ens-lyon.fr/LBMC/laudet/nurebase/nurebase.html) revealed a number of putative proteins with between 20 and 36% amino
TABLE 2. DNA sequence and matrix similarity of transcription factors identified in pfmdr1 and pfcrt Gene
Transcription factor
Consensus transcription factor binding sequencea
Core similarityb
Matrix similarityc
DNA sequenced
pfmdr1
Barbiturate-inducible element Barbiturate-inducible element Barbiturate-inducible element Progesterone receptor binding site Progesterone receptor binding site PXR half-site/RXR receptor RAR
atnnAAAGcngrngg atnnAAAGcngrngg atnnAAAGcngrngg nnrgnacnnknTGTTCTnn nnrgnacnnknTGTTCTnn nnTGAACTynn nwawnnAGGTCAnnnnn
1 1 1 1 1 1 1
0.90 0.88 0.89 0.88 0.90 0.98 0.93
atgaAAAGgaaaaggg ttaaAAAGttgaaag atggAAAGgagagga cttatccgaatTGTTcttc tacgcaaaactTGTTctta gtTGAActtgt agtaagaGGTCaagagg
pfcrt
Barbiturate-inducible element Barbiturate-inducible element Barbiturate-inducible element Glucocorticoid receptor Progesterone receptor binding site AhR nuclear translocator homodimers PPAR/RXR heterodimers PPAR/RXR heterodimers RAR
atnnAAAGcngrngg atnnAAAGcngrngg atnnAAAGcngrngg nngGTACAannTGTYCTnn nnrgnacnnknTGTTCTnn nnnnnCACGTGnn cwrawctTAGGnCAAAGGTCAn cwrawctTAGGnCAAAGGTCAn nwawnnAGGTCAnnnnn
1 1 1 0.93 1 1 1 1 0.75
0.897 0.88 0.88 0.89 0.89 0.90 0.74 0.75 0.832
aaaaAAAGcagatga tttcAAAGcttgaag aggaAAAGgaaaagg gttttacatattGTCCtga tatcatcatttTGTTcttg ttagcaaCGTGtt aaaaaagatgcaaaagatcaa caaaatgatgatAAAGatcaa ataattgGGTAaattgt
a Consensus binding sequence indicates the core nucleotides (uppercase and boldface type) and the possibilities for nucleotide matches at other positions of the transcription factor motif, where Y is pyrimidine (C and T), R is purine (A and G), W is weak (A and T), S is strong (G and C), K is keto (T and G), and N is any nucleotide. AhR, ary1 hydrocarbon receptor. b Core similarity is the match against the nucleotides representing the core motif of the transcription factor, where 1 is 100% identity. c Matrix similarity is the overall similarity to the transcription factor binding motif, where 1 is 100% identity. d Actual genomic DNA sequence from either the pfmdr1 or pfcrt promoter, with the nucleotides in boldface type representing critical residues for binding based on a high conservation profile, with the matrix and base pairs in boldface capital letters indicating the core sequence used by MatInspector to identify the motif in the DNA sequence.
1442
JOHNSON ET AL.
ANTIMICROB. AGENTS CHEMOTHER.
FIG. 3. Proposed hypothesis for the inducible regulation of gene expression by PB in P. falciparum. (A) The molecular and cellular effects of PB in humans have been extensively characterized. PB enters the cell and activates the CAR, resulting in the dephosphorylation of CAR, which subsequently translocates to the nucleus. CAR heterodimerizes with RXR in the nucleus, with the resulting complex interacting directly with the PB response element (PBRE) in the promoter, resulting in the transactivation of the gene. In humans, this activation can result in the increased expression of drug transporters such as MDR1, MRP1, and BCRP. (B) Proposed model for PB regulation of gene expression in malarial parasites. PB enters the parasite and activates nuclear receptor 1 (NR1), presumably through the dephosphorylation of the protein. The activated NR1 translocates to the nucleus, forming a dimer with NR2, which subsequently binds to the PB response element, resulting in an increased turnover of RNA polymerase and transcription of the gene. The changes in Pgh1 observed after PB treatment suggest that pfmdr1 is a target for PB-regulated gene expression, with an additional candidate being the P. falciparum multiresistance protein 1 gene, pfmrp1.
VOL. 52, 2008
Pgh1 EXPRESSION AND CQ SUSCEPTIBILITY
acid identity to peroxisome proliferator-activated receptor (PPAR␥), retinoic acid receptor half-site (RXR), RAR, related orphan receptor ␣2 (RAR), mineralcorticoid receptor, and hepatic nuclear factor 4a on chromosomes 2, 3, 4, 10, 11, 12, and 13. DISCUSSION The observation that the potent anticonvulsant PB produces a shift in the susceptibility of P. falciparum parasites to CQ was first noted by Ndifor et al. (22). The parasite lines chosen for this study were the parental isolated K1H6/2 and two drugselected isolates, K1AM and K1HF (14). All three parasite lines were previously extensively characterized both phenotypically and genotypically, with the major difference between them being the acquisition of the novel S163R mutation in PfCRT and the return to CQ sensitivity coupled with a loss of the VP-sensitive component in the K1AM and K1HF lines (14, 32). However, pretreatment of the parasites with 0.1 M PB had little effect on parasite viability, and each isolate continued to grow in 0.1 M PB at similar proliferation rates compared to those of control parasite cultures over the 48-h pretreatment period (data not shown), yet in vitro sensitivity testing for CQ susceptibility showed that all parasite isolates exhibited a marked decrease in susceptibility to CQ following PB pretreatment (Table 1). Furthermore, the K1AM and K1HF lines displayed phenotypic characteristics of CQR including the return of a partially VP-sensitive component of CQR (Table 1). This observation is made more interesting since the K1AM and K1HF parasites were previously shown to have lost the VPsensitive component of CQR upon selection with amantadine or halofantrine, a trait typically associated with CQ-sensitive parasite lines (6, 14, 18, 32, 39). Since the incubation time was insufficient to elicit a genotypic change in the parasite, the unique pattern of changes in CQ susceptibility produced by PB treatment suggests an adaptive response to PB. It is well known that PB induces the expression of CYPs and ABC transporter proteins in mammals via nuclear receptor-dependent mechanisms (10, 11, 13, 16, 34–36, 42, 48). The changes in CQ susceptibility observed after PB treatment could feasibly be controlled by an increased metabolism of CQ by CYPs, a hypothesis originally put forward by Ndifor et al. (21, 22). However, it has been shown that CQ is not metabolized by malarial parasites (29, 43). We therefore propose an alternate explanation, in keeping with the known effects of PB in other systems, that PB influences CQ susceptibility levels by regulating the expression of drug transporter genes such as pfmdr1 and pfcrt, reducing the intracellular availability of CQ due to increased intracellular drug clearance. Such a hypothesis is supported by the similarity of Pgh1 with mammalian Pgps, with Pgh1 being a likely evolutionary antecedent of these mammalian proteins. Western blot analysis after treatment of parasites with PB resulted in a marked increase in the expression of the P. falciparum ABC transporter Pgh1 compared to the untreated controls in all parasite lines tested (Fig. 1). PB had the most pronounced effect on Pgh1 expression in the parent clone K1H6/2 and the halofantrine-resistant isolate K1HF, with all lines showing at least a threefold increase in protein expression (Fig. 1). Interestingly, PB treatment had no effect on the ex-
1443
pression of PfCRT, with all parasite lines showing similar protein levels. This observation strongly implicates the increased expression of Pgh1 in K1H6/2, K1AM, and K1HF as being responsible for the decreased CQ susceptibility and suggests a molecular link between these phenotypes. The increased expression of Pgh1 by PB in P. falciparum could be rationalized based on the accepted mechanisms for xenobiotic-mediated increases in drug transporter expression seen in mammals under the influence of the same chemicals: the activation of ligand-activated transcription factors such as members of the nuclear receptor superfamily (11, 16, 41, 46). In mammals, this occurs via two distinct mechanisms. First, ligands such as pregnenalone-16␣-carbonitrile are able to bind to the ligand binding domain of the PXR, which triggers dissociation from cytosolic chaperones and nuclear translocation of the receptor, resulting in the transactivation of target genes (40). Second, PB elicits phosphorylation of the CAR via a signal transduction mechanism initiated at the cell membrane, which results in the activation of the receptor, with the same result (31) (Fig. 3). Importantly, many mammalian nuclear receptors bind to similar response elements. For example, PXR and CAR mediate the induction of CYP3A (48), CYP2B6 (8), and ABCB1 (2) via the same ER-6, DR-4, and PBREM motifs, and ER-8 mediates the induction of ABCC2 by PXR, CAR, and FXR (15). With this in mind, we have utilized a bioinformatic approach to screen the 5⬘ regulatory regions of parasite transporter genes for putative nuclear receptor response elements. The pfmdr1 promoter sequence contains a total of two ligand-activated transcription factor binding motifs that could conceivably be activated and increase the expression of Pgh1, with these being the barbiturate-inducible element (Barbie box) and the PXR/RXR response element. This study provides the first evidence of a malarial parasite drug-inducible system of gene expression that is closely related to the mechanism used in a range of evolutionarily diverse classes including mammalia, aves, and chromadorea. Despite these strong similarities, there are a number of components of the system that have not been identified in the malaria parasite, and in order to fully validate this system, these need to be identified and characterized (Fig. 3). However, we propose that the induction of Pgh1 observed after PB treatment is a direct cellular response to the drug in an attempt by the parasite to remove the drug, thereby preventing toxicity. The fact that the increased expression of Pgh1 was associated with an increased resistance to CQ further adds support for the role of this protein in conferring reduced parasite susceptibility to this important antimalarial. However, as stated above, many components of the model have yet to be identified or tested, and only the cloning and functional characterization of these proteins with respect to the PB-responsive induction of Pgh1 will provide further insight into the gene regulation mechanisms adopted by the parasite. ACKNOWLEDGMENTS D.J.J., P.G.B., and S.A.W. are supported by grants from the BBSRC, MRC, and Wellcome Trust. A.O. is supported by funding from United Kingdom Department of Health Biomedical Research Centre for Microbial Diseases, Monument Trust, AstraZeneca, and Merck. N.P. is supported by funding from the BBSRC.
1444
JOHNSON ET AL. REFERENCES
1. Bookout, A. L., Y. Jeong, M. Downes, R. T. Yu, R. M. Evans, and D. J. Mangelsdorf. 2006. Anatomical profiling of nuclear receptor expression reveals a hierarchical transcriptional network. Cell 126:789–799. 2. Burk, O., K. A. Arnold, A. Geick, H. Tegude, and M. Eichelbaum. 2005. A role for constitutive androstane receptor in the regulation of human intestinal MDR1 expression. Biol. Chem. 386:503–513. 3. Cowman, A. F. 1991. The P-glycoprotein homologues of Plasmodium falciparum: are they involved in chloroquine resistance? Parasitol. Today 7:70–76. 4. Desjardins, R. E., C. J. Canfield, J. D. Haynes, and J. D. Chulay. 1979. Quantitative assessment of antimalarial activity in vitro by a semiautomated microdilution technique. Antimicrob. Agents Chemother. 16:710–718. 5. Endicott, J. A., and V. Ling. 1989. The biochemistry of P-glycoproteinmediated multidrug resistance. Annu. Rev. Biochem. 58:137–171. 6. Fidock, D. A., T. Nomura, A. K. Talley, R. A. Cooper, S. M. Dzekunov, M. T. Ferdig, L. M. Ursos, A. B. Sidhu, B. Naude, K. W. Deitsch, X. Z. Su, J. C. Wootton, P. D. Roepe, and T. E. Wellems. 2000. Mutations in the P. falciparum digestive vacuole transmembrane protein PfCRT and evidence for their role in chloroquine resistance. Mol. Cell 6:861–871. 7. Foote, S. J., J. K. Thompson, A. F. Cowman, and D. J. Kemp. 1989. Amplification of the multidrug resistance gene in some chloroquine-resistant isolates of P. falciparum. Cell 57:921–930. 8. Goodwin, B., L. B. Moore, C. M. Stoltz, D. D. McKee, and S. A. Kliewer. 2001. Regulation of the human CYP2B6 gene by the nuclear pregnane X receptor. Mol. Pharmacol. 60:427–431. 9. Greenwood, B. 2002. The molecular epidemiology of malaria. Trop. Med. Int. Health 7:1012–1021. 10. Honkakoski, P., R. Moore, K. A. Washburn, and M. Negishi. 1998. Activation by diverse xenochemicals of the 51-base pair phenobarbitalresponsive enhancer module in the CYP2B10 gene. Mol. Pharmacol. 53:597–601. 11. Honkakoski, P., I. Zelko, T. Sueyoshi, and M. Negishi. 1998. The nuclear orphan receptor CAR-retinoid X receptor heterodimer activates the phenobarbital-responsive enhancer module of the CYP2B gene. Mol. Cell. Biol. 18:5652–5658. 12. Horrocks, P., K. Dechering, and M. Lanzer. 1998. Control of gene expression in Plasmodium falciparum. Mol. Biochem. Parasitol. 95:171–181. 13. Jigorel, E., M. Le Vee, C. Boursier-Neyret, Y. Parmentier, and O. Fardel. 2006. Differential regulation of sinusoidal and canalicular hepatic drug transporter expression by xenobiotics activating drug-sensing receptors in primary human hepatocytes. Drug Metab. Dispos. 34:1756–1763. 14. Johnson, D. J., D. A. Fidock, M. Mungthin, V. Lakshmanan, A. B. Sidhu, P. G. Bray, and S. A. Ward. 2004. Evidence for a central role for PfCRT in conferring Plasmodium falciparum resistance to diverse antimalarial agents. Mol. Cell 15:867–877. 15. Kast, H. R., B. Goodwin, P. T. Tarr, S. A. Jones, A. M. Anisfeld, C. M. Stoltz, P. Tontonoz, S. Kliewer, T. M. Willson, and P. A. Edwards. 2002. Regulation of multidrug resistance-associated protein 2 (ABCC2) by the nuclear receptors pregnane X receptor, farnesoid X-activated receptor, and constitutive androstane receptor. J. Biol. Chem. 277:2908–2915. 16. Kodama, S., and M. Negishi. 2006. Phenobarbital confers its diverse effects by activating the orphan nuclear receptor car. Drug Metab. Rev. 38:75–87. 17. Krogstad, D. J., I. Y. Gluzman, D. E. Kyle, A. M. Oduola, S. K. Martin, W. K. Milhous, and P. H. Schlesinger. 1987. Efflux of chloroquine from Plasmodium falciparum: mechanism of chloroquine resistance. Science 238:1283– 1285. 18. Lakshmanan, V., P. G. Bray, D. Verdier-Pinard, D. J. Johnson, P. Horrocks, R. A. Muhle, G. E. Alakpa, R. H. Hughes, S. A. Ward, D. J. Krogstad, A. B. Sidhu, and D. A. Fidock. 2005. A critical role for PfCRT K76T in Plasmodium falciparum verapamil-reversible chloroquine resistance. EMBO J. 24: 2294–2305. 19. Lehmann, J. M., D. D. McKee, M. A. Watson, T. M. Willson, J. T. Moore, and S. A. Kliewer. 1998. The human orphan nuclear receptor PXR is activated by compounds that regulate CYP3A4 gene expression and cause drug interactions. J. Clin. Investig. 102:1016–1023. 20. Myrick, A., A. Munasinghe, S. Patankar, and D. F. Wirth. 2003. Mapping of the Plasmodium falciparum multidrug resistance gene 5⬘-upstream region, and evidence of induction of transcript levels by antimalarial drugs in chloroquine sensitive parasites. Mol. Microbiol. 49:671–683. 21. Ndifor, A. M., R. E. Howells, P. G. Bray, J. L. Ngu, and S. A. Ward. 1993. Enhancement of drug susceptibility in Plasmodium falciparum in vitro and Plasmodium berghei in vivo by mixed-function oxidase inhibitors. Antimicrob. Agents Chemother. 37:1318–1323. 22. Ndifor, A. M., S. A. Ward, and R. E. Howells. 1990. Cytochrome P-450 activity in malarial parasites and its possible relationship to chloroquine resistance. Mol. Biochem. Parasitol. 41:251–257. 23. Nelson, A. L., A. Purfield, P. McDaniel, N. Uthaimongkol, N. Buathong, S. Sriwichai, R. S. Miller, C. Wongsrichanalai, and S. R. Meshnick. 2005. pfmdr1 genotyping and in vivo mefloquine resistance on the Thai-Myanmar border. Am. J. Trop. Med. Hyg. 72:586–592.
ANTIMICROB. AGENTS CHEMOTHER. 24. Peel, S. A. 2001. The ABC transporter genes of Plasmodium falciparum and drug resistance. Drug Resist. Updat. 4:66–74. 25. Peel, S. A., P. Bright, B. Yount, J. Handy, and R. S. Baric. 1994. A strong association between mefloquine and halofantrine resistance and amplification, overexpression, and mutation in the P-glycoprotein gene homolog (pfmdr) of Plasmodium falciparum in vitro. Am. J. Trop. Med. Hyg. 51:648– 658. 26. Price, R. N., C. Cassar, A. Brockman, M. Duraisingh, M. van Vugt, N. J. White, F. Nosten, and S. Krishna. 1999. The pfmdr1 gene is associated with a multidrug-resistant phenotype in Plasmodium falciparum from the western border of Thailand. Antimicrob. Agents Chemother. 43:2943–2949. 27. Price, R. N., A. C. Uhlemann, A. Brockman, R. McGready, E. Ashley, L. Phaipun, R. Patel, K. Laing, S. Looareesuwan, N. J. White, F. Nosten, and S. Krishna. 2004. Mefloquine resistance in Plasmodium falciparum and increased pfmdr1 gene copy number. Lancet 364:438–447. 28. Quandt, K., K. Frech, H. Karas, E. Wingender, and T. Werner. 1995. MatInd and MatInspector: new fast and versatile tools for detection of consensus matches in nucleotide sequence data. Nucleic Acids Res. 23: 4878–4884. 29. Rabinovich, S. A., I. M. Kulikovskaya, E. V. Maksakovskaya, T. V. Chekhonadskikh, T. G. Pankova, and R. I. Salganik. 1987. Suppression of the chloroquine resistance of Plasmodium berghei by treatment of infected mice with a microsomal monooxygenase inhibitor. Bull. W. H. O. 65:387–389. 30. Reed, M. B., K. J. Saliba, S. R. Caruana, K. Kirk, and A. F. Cowman. 2000. Pgh1 modulates sensitivity and resistance to multiple antimalarials in Plasmodium falciparum. Nature 403:906–909. 31. Rencurel, F., A. Stenhouse, S. A. Hawley, T. Friedberg, D. G. Hardie, C. Sutherland, and C. R. Wolf. 2005. AMP-activated protein kinase mediates phenobarbital induction of CYP2B gene expression in hepatocytes and a newly derived human hepatoma cell line. J. Biol. Chem. 280:4367– 4373. 32. Ritchie, G. Y., M. Mungthin, J. E. Green, P. G. Bray, S. R. Hawley, and S. A. Ward. 1996. In vitro selection of halofantrine resistance in Plasmodium falciparum is not associated with increased expression of Pgh1. Mol. Biochem. Parasitol. 83:35–46. 33. Rosario, V. 1981. Cloning of naturally occurring mixed infections of malaria parasites. Science 212:1037–1038. 34. Salphati, L., and L. Z. Benet. 1998. Modulation of P-glycoprotein expression by cytochrome P450 3A inducers in male and female rat livers. Biochem. Pharmacol. 55:387–395. 35. Schuetz, E. G., W. T. Beck, and J. D. Schuetz. 1996. Modulators and substrates of P-glycoprotein and cytochrome P4503A coordinately up-regulate these proteins in human colon carcinoma cells. Mol. Pharmacol. 49:311–318. 36. Schuetz, E. G., A. H. Schinkel, M. V. Relling, and J. D. Schuetz. 1996. P-glycoprotein: a major determinant of rifampicin-inducible expression of cytochrome P4503A in mice and humans. Proc. Natl. Acad. Sci. USA 93: 4001–4005. 37. Sidhu, A. B., A. C. Uhlemann, S. G. Valderramos, J. C. Valderramos, S. Krishna, and D. A. Fidock. 2006. Decreasing pfmdr1 copy number in Plasmodium falciparum malaria heightens susceptibility to mefloquine, lumefantrine, halofantrine, quinine, and artemisinin. J. Infect. Dis. 194: 528–535. 38. Sidhu, A. B., S. G. Valderramos, and D. A. Fidock. 2005. pfmdr1 mutations contribute to quinine resistance and enhance mefloquine and artemisinin sensitivity in Plasmodium falciparum. Mol. Microbiol. 57:913–926. 39. Sidhu, A. B., D. Verdier-Pinard, and D. A. Fidock. 2002. Chloroquine resistance in Plasmodium falciparum malaria parasites conferred by pfcrt mutations. Science 298:210–213. 40. Squires, E. J., T. Sueyoshi, and M. Negishi. 2004. Cytoplasmic localization of pregnane X receptor and ligand-dependent nuclear translocation in mouse liver. J. Biol. Chem. 279:49307–49314. 41. Staudinger, J. L., A. Madan, K. M. Carol, and A. Parkinson. 2003. Regulation of drug transporter gene expression by nuclear receptors. Drug Metab. Dispos. 31:523–527. 42. Sueyoshi, T., and M. Negishi. 2001. Phenobarbital response elements of cytochrome P450 genes and nuclear receptors. Annu. Rev. Pharmacol. Toxicol. 41:123–143. 43. Surolia, N., G. Karthikeyan, and G. Padmanaban. 1993. Involvement of cytochrome P-450 in conferring chloroquine resistance to the malarial parasite, Plasmodium falciparum. Biochem. Biophys. Res. Commun. 197:562– 569. 44. Trager, W., and J. B. Jensen. 1976. Human malaria parasites in continuous culture. Science 193:673–675. 45. Waller, K. L., R. A. Muhle, L. M. Ursos, P. Horrocks, D. Verdier-Pinard, A. B. Sidhu, H. Fujioka, P. D. Roepe, and D. A. Fidock. 2003. Chloroquine resistance modulated in vitro by expression levels of the Plasmodium falciparum chloroquine resistance transporter. J. Biol. Chem. 278:33593–33601. 46. Willson, T. M., and S. A. Kliewer. 2002. PXR, CAR and drug metabolism. Nat. Rev. Drug Discov. 1:259–266.
VOL. 52, 2008 47. Wilson, C. M., A. E. Serrano, A. Wasley, M. P. Bogenschutz, A. H. Shankar, and D. F. Wirth. 1989. Amplification of a gene related to mammalian mdr genes in drug-resistant Plasmodium falciparum. Science 244:1184–1186. 48. Xie, W., J. L. Barwick, C. M. Simon, A. M. Pierce, S. Safe, B. Blumberg, P. S. Guzelian, and R. M. Evans. 2000. Reciprocal activation of xenobiotic re-
Pgh1 EXPRESSION AND CQ SUSCEPTIBILITY
1445
sponse genes by nuclear receptors SXR/PXR and CAR. Genes Dev. 14: 3014–3023. 49. Zhang, Z., P. E. Burch, A. J. Cooney, R. B. Lanz, F. A. Pereira, J. Wu, R. A. Gibbs, G. Weinstock, and D. A. Wheeler. 2004. Genomic analysis of the nuclear receptor family: new insights into structure, regulation, and evolution from the rat genome. Genome Res. 14:580–590.
