Dual Role of Response Regulator StyR in Styrene Catabolism ...

APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Sept. 2005, p. 5411–5419 0099-2240/05/$08.00⫹0 doi:10.1128/AEM.71.9.5411–5419.2005 Copyright © 2005, American Society for Microbiology. All Rights Reserved.

Vol. 71, No. 9

Dual Role of Response Regulator StyR in Styrene Catabolism Regulation Livia Leoni, Giordano Rampioni, Valeria Di Stefano,† and Elisabetta Zennaro* Department of Biology, University “Roma Tre,” Viale G. Marconi 446, 00146 Rome, Italy Received 27 January 2005/Accepted 23 March 2005

In Pseudomonas fluorescens ST, the promoter of the styrene catabolic operon, PstyA, is induced by styrene and repressed by the addition of preferred carbon sources. PstyA is regulated by the StyS/StyR two-component system. The integration host factor (IHF) also plays a positive role in PstyA regulation. Three distinct StyR binding sites, which have different affinities for this response regulator, have been characterized on PstyA. The high-affinity StyR binding site (STY2) is necessary for promoter activity. The DNA region upstream of STY2 contains a lower-affinity StyR binding site, STY1, that partially overlaps the IHF binding site. Deletion of this region, designated URE (upstream regulatory element), has a dual effect on the PstyA promoter, decreasing the styrene-dependent activity and partially relieving the glucose repression. The lowest-affinity StyR binding site (STY3) is located downstream of the transcription start point. Deletion of the URE region and inactivation of the STY3 site completely abolished glucose-mediated repression of PstyA. In the proposed model StyR can act either as an activator or as a repressor, depending on which sites it occupies in the different growth conditions. We suggest that the cellular levels of phosphorylated StyR, as determined by StyS sensor kinase activity, and the interplay of this molecule with IHF modulate the activity of the promoter in different growth conditions. genes are organized in the same way and are highly homologous. Pseudomonas fluorescens ST is the best-characterized styrene-degrading strain. The catabolic operon styABCD encodes enzymes for the conversion of styrene to phenylacetic acid, a central metabolite that is a common substrate for Pseudomonas spp. (Fig. 1A) (2). Expression of the catabolic genes is induced by styrene and is repressed in the presence of preferred carbon sources (18). The styrene catabolic pathway is controlled by the StyS/StyR two-component regulatory system consisting of the StyS sensor kinase and the StyR DNA-binding response regulator. Very few examples of involvement of a two-component regulatory system in the degradation of an aromatic compound are known. This kind of regulation has been described only for toluene degradation in Pseudomonas spp. and in Thauera spp. and for degradation of biphenyls in Rhodococcus sp. strain M5 (4, 7, 8, 16). StyS and the sensor kinase involved in regulation of toluene catabolism are unique among the histidine kinase family members because they contain two perfectly duplicated kinase cores separated by an internal receiver domain and two input domains (8, 14, 23). A SMART (http://smart.embl-heidelberg.de/) analysis has shown that both the input domains could contain the PAS domain (Drosophila period clock protein, vertebrate aryl-hydrocarbon receptor nuclear translocator, and Drosophila single-minded protein). Versatile PAS domains are found in a variety of different proteins in prokaryotes, eukaryotes, and archaea and monitor changes in light, redox potential, oxygen, and small ligands depending on their associated cofactors (24). StyR belongs to the FixJ family of response regulators and is essential for styrene-induced expression of the styABCD operon (15, 25). In the last few years, studies have been focused on the interplay of cis- and trans-acting regulatory elements involved

The massive production and use of styrene in the petrochemical and polymer industries have led to increasing interest in styrene-degrading strains because of the toxic effects of this aromatic compound and its intermediates on human health. Understanding the relationships between the expression of a nonessential pathway (such as degradation of an aromatic compound) and the preservation of adequate fitness in the environment is essential for the development of biodegradation processes with natural or engineered strains (22). As a general rule, in the transcriptional control of a catabolic pathway, overimposed regulatory mechanisms connect the activity of individual promoters to the metabolic and energetic status of the cell. The most thoroughly studied relationship between the expression of a specific degradation pathway and general cell metabolism is carbon catabolite repression. The few mechanisms studied so far in pseudomonads for downregulating aromatic degradative pathways in the presence of a preferred carbon source seem to be very different from the cyclic AMP-cyclic AMP receptor protein-dependent glucose repression paradigm of Escherichia coli (3, 22). It has been suggested that integration of a catabolic pathway into the general cell metabolism could occur with different strategies in different catabolic systems (22). Despite the large number of strains isolated due to their ability to grow on styrene, genetic studies have been performed with essentially four strains belonging to the genus Pseudomonas (14). In all these strains styrene catabolic and regulatory * Corresponding author. Mailing address: Department of Biology, University “Roma Tre,” Viale G. Marconi 446, 00146 Rome, Italy. Phone: (39) 06 55176318. Fax: (39) 06 55176321. E-mail: zennaro @bio.uniroma3.it. † Present address: Department of Experimental Oncology, Molecular Oncogenesis Laboratory, Regina Elena Cancer Institute, Via delle Messi d’Oro 156, 00158 Rome, Italy. 5411

5412

LEONI ET AL.

APPL. ENVIRON. MICROBIOL.

FIG. 1. Organization of the styABCD promoter region. (A) Regulatory (stySR) and catabolic (styABCD) operons for styrene degradation in P. fluorescens ST. styS, sensor; styR, response regulator; styAB, styrene monooxygenase; styC, epoxystyrene isomerase; styD, phenylacetaldehyde dehydrogenase. (B) Sequence of the styABCD promoter (PstyA). The nucleotides are numbered with respect to the transcriptional start site determined for the same promoter in Pseudomonas putida Y2 (25). The inverted arrows indicate the STY1, STY2, and STY3 binding sites for StyR. The IHF consensus is enclosed in a box (WATCAANNNNTTR, oriented in the direction opposite that of the styABCD operon). The URE region is in boldface type. The dashed lines indicate ATTTTTA motifs. The “extended” ⫺10 region for ␴70 is underlined. The potential styA ribosome binding site is overlined. The styA ATG start codon and the TGA styR stop codon are in boldface type. (C) Alignment of the STY sequences. The arrows indicate inverted repeats. Nucleotides identical to the STY2 palindrome are in uppercase boldface type. A third repeat that is homologous to the left half of the STY2 palindrome and partially overlaps the STY3 degenerated palindrome is enclosed in a box. The asterisks indicate the A3G and C3A substitutions introduced at the STY3 site in pPR9Pa1mut and pPR9Pa4mut.

in the fine regulation of PstyA, the promoter of the catabolic operon (Fig. 1B). We have demonstrated that StyR phosphorylation induces dimerization and that the dimeric form is able to bind PstyA (9). This promoter contains a noncanonical ⫺35 region that overlaps a palindromic sequence designated the sty-box, which is postulated to be the StyR binding site. Deletion analysis of PstyA has shown that the sty-box sequence is the basic element for promoter activation (20). Finally, we also showed that the integration host factor (IHF) binds PstyA and that the styrene-dependent activity of this promoter is reduced in an ihf background (20). IHF is a small heterodimeric protein that binds DNA and induces a sharp bend (⬎160°). This bending aids in the formation of a higher-order structure in processes such as recombination, transposition, replication, and transcription (12). In this paper we show that StyR is able to bind PstyA at three distinct sites with different affinities and that, depending on which site(s) it occupies, this regulator can act as an activator or as a repressor and play a major role in carbon catabolite repression control. Moreover, we found that the upstream StyR site and the IHF binding site overlap, suggesting that the interaction of StyR and IHF could play a role in the fine modulation of expression of the styrene catabolic genes. MATERIALS AND METHODS Bacterial strains, plasmids, media, and chemicals. The bacterial strains and plasmids used in this study are listed in Table 1. P. fluorescens ST and E. coli cells

were routinely grown at 30°C and 37°C, respectively, in Luria-Bertani medium (17) or mineral salts medium (6) with either styrene or 0.4% glucose or both. Styrene was added via the gas phase as previously described (10). When necessary, cultures were supplemented with ampicillin (100 ␮g/ml), kanamycin (50 ␮g/ml), or chloramphenicol (30 ␮g/ml for E. coli and 200 ␮g/ml for P. fluorescens ST). Recombinant DNA techniques. Details of the construction of plasmids are described in Table 1. Preparation of plasmid DNA, purification of DNA fragments, restriction, ligation, and transformation of E. coli were carried out by using standard procedures (9, 17). PCR amplifications were performed using Pfu polymerase (Stratagene) and the pTE50 plasmid as the DNA template (Table 1) (10). The sequences of oligonucleotides used in this study are shown in Table 2. Automated sequencing was performed by MWG Biotech Sequence Services (MWG Biotech). Construction of PstyA::lacZ fusions and ␤-galactosidase assays. Construction of the pPR9TT derivatives pPR9Pa1 and pPR9Pa4 has been described previously (20). For construction of plasmids pPR9Pa1mut and pPR9Pa4mut, site-directed mutagenesis of PstyA was performed using a two-step PCR with the P14/FW and P15/RV oligonucleotides (Table 2). These oligonucleotides are mutually complementary and correspond to a DNA region located from nucleotide 20 to nucleotide 45 with respect to the styA transcription start point. The A3G and C3A introduced substitutions are indicated in Table 2. In the first step, two distinct PCRs (PCR-1 and PCR-2) were carried out to introduce the mutation into the PCR products. In PCR-1 the reverse primer was P15/RV, and the forward primer was either P1/FW or P4/FW. In PCR-2, the forward primer was P14/FW, and the reverse primer was P17/RV. In the second PCR step the products obtained from PCR-1 and PCR-2 were used as both primers and templates. In this step the total amount of DNA (PCR-1 plus PCR-2) used in a 100-␮l reaction mixture was 125 ng. After the first five cycles (94°C for 1 min, 68°C for 1 min, and 72°C for 1 min), reverse primer P17/RV and either primer P1/FW or P4/FW were added, and the reaction was continued for 25 cycles. The different PCR products were first blunt cloned in HincII-digested pBluescript II KS(⫹) (Stratagene) and checked by sequencing. After this, the frag-

VOL. 71, 2005

DUAL ROLE OF StyR IN STYRENE CATABOLISM REGULATION

5413

TABLE 1. Bacterial strains and plasmids Strain or plasmid

Strain P. fluorescens ST E. coli DH5␣ Plasmids pBluescript II KS(⫹) pPR9TT pTE50 pRK2013 pPR9Pa1 pPR9Pa4 pPR9Pa1mut pPR9Pa4mut pPstyA5⬘ pPstyA3⬘ pSTY1 pSTY2 pSTY3 pSTY1/2 a

Relevant characteristics and/or plasmid constructiona

Reference or source

Sty⫹ endA1 hsdR17 supE44 thi-1 recA1 gyrA96 (Nalr) relA1⌬(lacIZYA-argF)U169 deoR(⌽80dlacZ⌬M15)

1 Bethesda Research Labs

Cloning vector; Apr; 2.9 kb

Stratagene

lacZ promoter probe vector; Apr Cmr pTZ19R derivative containing a P. fluorescens ST chromosomal fragment carrying the styR, styA, and styB genes; Apr Helper plasmid; ColE1 replicon, Kmr Mob⫹ Tra⫹ 355-bp fragment, encompassing nucleotides ⫺115 to 240 with respect to the styA transcription start point, ligated to the XhoI-BamHI sites of pPR9TT; Apr Cmr Derivative of pPR9Pa1 carrying a 5⬘ deletion up to nucleotide ⫺57 with respect to the styA transcription start point; Apr Cmr Same as pPR9Pa1, but the cloned sequence has a double mutation at positions 30 and 34 from the styA transcription start point; Apr Cmr Same as pPR9Pa4, but the cloned sequence has a double mutation at positions 30 and 34 from the styA transcription start point; Apr Cmr pBluescript II KS(⫹) derivative in which a 265-bp PCR fragment, obtained with primers P35/FW and P37/RV, was cloned into the EcoRI-BamHI sites of the vector; Apr pBluescript II KS(⫹) derivative in which a 258-bp PCR fragment, obtained with primers P12/FW and P37/RV, was cloned into the XbaI-BamHI sites of the vector; Apr pBluescript II KS(⫹) derivative in which a 40-bp DNA fragment, obtained in vitro by annealing of oligonucleotides P59/FW and P60/RV, was cloned into the HincII site of the vector; Apr pBluescript II KS(⫹) derivative in which a 40-bp DNA fragment, obtained in vitro by annealing of oligonucleotides P61/FW and P62/RV, was cloned into the HincII site of the vector; Apr pBluescript II KS(⫹) derivative in which a 40-bp DNA fragment, obtained in vitro by annealing of oligonucleotides P63/FW and P64/RV, was cloned into the HincII site of the vector; Apr pBluescript II KS(⫹) derivative in which a 155-bp PCR fragment, obtained with primers P35/FW and P56/RV, was cloned into the EcoRI-Pst sites of the vector; Apr

19 10 5 20 20 This study This study This study This study This study This study This study This study

Oligonucleotide primers are described in Table 2.

ments cloned in the right orientation were excised by XhoI-BamHI digestion and ligated into compatible sites of the promoter probe vector pPR9TT in frame with the lacZ reporter gene. All pPR9TT derivatives were transferred from E. coli to P. fluorescens ST by triparental mating with helper plasmid pRK2013 (5). In order to measure ␤-galactosidase activity, P. fluorescens ST cells harboring pPR9TT-derived plasmids were grown for 12 h at 30°C in mineral salts medium supplemented with styrene as a carbon source. Styrene was supplied via the gas phase using a styrene reservoir inside the flask (10). Cells were then diluted to obtain a cell density corresponding to an A600 of ⬃0.1 in the same medium and subcultured for 2 h. Cultures were then divided into three flasks; in one flask the organism was kept growing on styrene (styrene cultures), glucose (0.4%) and a styrene reservoir were added to the second flask (glucose plus styrene cultures), and only glucose (0.4%) was added to the third flask (glucose cultures). Samples were withdrawn every 1.5 h during the entire growth curve, and ␤-galactosidase activity was measured as described by Miller (13). The averages of the results obtained from at least five independent experiments with a standard deviation not greater than 8% are reported below. In vitro phosphorylation of StyR. The StyR purified protein used in this study (HE-StyR) differs from wild-type StyR by having an extended N terminus made up of 17 amino acid residues containing a six-His tag and the consensus sequence for enterokinase cleavage (9). The molar concentrations of StyR were calculated based on the monomeric form of the protein. Different quantities (70 ␮M to 100 ␮M) of StyR protein were phosphorylated in the presence of a 103-fold molar excess of acetylphosphate in phosphorylation buffer (43 mM Tris-acetate, pH 8, 30 mM potassium acetate, 8 mM MgCl2, 27 mM ammonium acetate, 1 mM dithiothreitol, 80 mM KCl, 10% [vol/vol] glycerol, 4% [wt/vol] polyethylene glycol, 100 ␮g/ml bovine serum albumin). After 80 min of incubation at 27°C, the phosphorylated StyR protein was diluted and used in footprinting, electrophoretic mobility shift assay (EMSA), and cross-linking experiments. In order to assess whether StyR was fully phosphorylated, an

aliquot of the phosphorylation reaction was routinely analyzed by native polyacrylamide gel electrophoresis (9). DNase I footprinting and EMSA. Plasmids pPstyA5⬘ (for labeling of the bottom strand) and pPstyA3⬘ (for labeling of the top strand) were utilized to generate EcoRI/SacI fragments used as probes for the footprinting analysis (Table 1). The DNA fragments were asymmetrically labeled with [␣-32P]dATP by filling in with the Klenow enzyme at the EcoRI site as previously described (20). The probes (0.5 nM) were mixed with different amounts of phosphorylated StyR (StyR-P) (0.26 to 8.30 ␮M) in phosphorylation buffer (see above) containing 0.1 ␮g/␮l poly(dI-dC) and 2 mM CaCl2. DNA-protein complexes were allowed to form at 30°C for 15 min in 50-␮l (total volume) reaction mixtures. After incubation for 1 min at 25°C, DNase I (0.4 U; Roche Biochemicals) was added to the reaction mixtures. The reaction mixtures were incubated for 1 min at 25°C, and then the reactions were stopped by addition of 150 ␮l of a stop mixture (0.2 M sodium acetate, pH 7, 0.1 M EDTA, pH 8, 0.15% sodium dodecyl sulfate, 100 ␮g/ml tRNA). DNA from the footprinting mixtures was phenol-chloroform extracted, ethanol precipitated, and dissolved in 5 ␮l of sequence loading buffer (17). After 3 min of denaturation at 95°C, DNA was loaded onto a 7% (wt/vol) DNA sequencing gel (17). A⫹G Maxam-Gilbert reactions were carried out with the same probes, and the mixtures were loaded onto the gels along with the footprinting samples (17). The EMSA experiments were performed as previously described (9), with the following modifications: probes STY1, STY2, and STY3 were obtained from plasmids pSTY1, pSTY2, and pSTY3 (Table 1) by EcoRI/HincII digestion, and [␣-32P]dATP was end labeled by filling in (see above). In a typical assay, the labeled DNA probe (1 nM) was incubated with different amounts of StyR-P (0.1 to 21.8 ␮M) in binding buffer (9). After 15 min of incubation at 30°C, the reaction mixtures were loaded onto a 30-min prerun 10% (wt/vol) polyacrylamide gel under nondenaturing conditions. The ratio of acrylamide to bisacrylamide was 29:1.

5414

LEONI ET AL.

APPL. ENVIRON. MICROBIOL. TABLE 2. Oligonucleotides used in this study

Oligonucleotide

Sequence (5⬘-3⬘)a

Positionb

P1/FW P4/FW P12/FW P14/FW P15/RV P17/RV P35/FW P37/RV P56/RV P59/FW P60/RV P61/FW P62/RV P63/FW P64/RV

GCTCTAGAGGTGTAGTAAATATAAGT GCTCTAGATATACCGCATAAACCAC GCTCTAGATGCTTCGGGCTCTGC AACAAGGTATGAGCAATGAAAAAGCG CGCTTTTTCATTGCTCATACCTTGTT GGGGTACCTACGTAGTAGTAGTGG GGGAATTCCGTTGACTGCTTCGGG CGGGATCCCTGACGGAGGAAGAGG AAACTGCAGAGCTAACACCAGCAGC CTCGCTTGGTGTAGTAAATATAAGTTTATGATTTTTAATA TATTAAAAATCATAAACTTATATTTACTACACCAAGCGAG ATTTTTATACCGCATAAACCACGGTTTATTTCCTTTTTTG CAAAAAAGGAAATAAACCGTGGTTTATGCGGTATAAAAAT AACAACCCACAACAAAAACAAGGTATAAGCCATGAAAAAG CTTTTTCATGGCTTATACCTTGTTTTTGTTGTGGGTTGTT

⫺115 ⫺57 ⫺139 20 45 274 ⫺145 103 ⫺8 ⫺122 ⫺83 ⫺62 ⫺23 4 43

Sitec

XbaI XbaI XbaI KpnI EcoRI BamHI PstI

a Introduced restriction sites are underlined; the nucleotides in boldface type correspond to the A3G and C3A introduced substitutions compared with the styA wild-type sequence. b Distance from the PstyA transcription start point. c Restriction recognition site.

RESULTS Molecular characterization of StyR-P and IHF binding sites. The organization of the regulatory (stySR) and catabolic (styABCD) genes and the sequence of the PstyA promoter are shown in Fig. 1A and B, respectively. In order to determine the precise location of the StyR binding sites, a DNase I protection assay was performed on both strands of the PstyA DNA probe by using different amounts of StyR. To allow the binding of StyR to DNA, this protein was phosphorylated in vitro with acetylphosphate (9). As shown in Fig. 2, phosphorylated StyR protected three distinct DNA regions encompassing the STY1, STY2, and STY3 sites (Fig. 1B). The extent of StyR-P-mediated protection at the STY1 and STY2 sites spans from nucleotide ⫺114 to nucleotide ⫺85 and from nucleotide ⫺53 to nucleotide ⫺27, respectively. The third region protected by StyR-P spans from nucleotide 7 to nucleotide 38 downstream of the transcription start point (25). The STY2 site contains the 5⬘-ATAAACCACGGTTTAT-3⬘ palindrome formerly designated the sty-box. This motif is necessary for PstyA promoter activity and was predicted to be a StyR binding site (8, 20). STY1 and STY3 contain sequences homologous to the left half and the right half of the sty-box, respectively (20). However, the extension of the protected regions is similar for all three sites, approximately 30 bp, indicating that each site interacts with a distinct StyR-P dimer. Actually, an alignment of the three protected sites showed that the STY1 and STY3 sites also contain degenerated palindromic structures. The STY3 site has distinctive features since a third repeat, overlapping part of the palindrome and homologous to the left half of the STY2 site, is also present (Fig. 1C). The binding affinity of the dimeric StyR-P for the three distinct binding sites was studied by EMSA titration using DNA probes corresponding to STY1, STY2, or STY3 (Fig. 3). A comparative analysis of the three EMSA patterns showed that STY2 has the highest binding affinity for StyR-P. In fact, a StyR-P/STY2 stable complex became evident at a StyR-P concentration that was about 4-fold and about 22-fold lower

than the concentrations able to shift probes STY1 and STY3, respectively (compare Fig. 3B, lane 7, with Fig. 3A, lane 6, and with Fig. 3C, lane 10). Although the affinity of the STY1 site for StyR-P is lower than that of the STY2 site, the protection from DNase I digestion for these sites became visible simultaneously. This result confirms the data obtained in previous work, in which we showed that binding of StyR-P to PstyA is cooperative (9). Moreover, hypersensitive sites became detectable in the DNA region between STY1 and STY2 concurrent with the appearance of the protected regions (Fig. 2). The presence of such hypersensitive sites suggests that binding of StyR-P to PstyA leads to major changes in the three-dimensional structure of the promoter. In addition to StyR, the IHF protein can bind to PstyA (20). The IHF binding site was characterized by a DNase I protection assay, as shown in Fig. 4. The protection spans from nucleotide ⫺114 to nucleotide ⫺67 of PstyA (Fig. 4). Interestingly, the DNA regions protected by StyR at the STY1 site and by IHF overlap, suggesting that these proteins could compete for binding to this DNA region, which is referred to as URE (upstream regulatory element) below. The analysis of the protected region revealed the presence of a consensus sequence for IHF (5⬘-WATCAANNNNTTR-3⬘), oriented in the opposite direction compared with the styABCD operon (Fig. 1B). In previous work, the IHF binding site was determined by EMSA with a DNA probe corresponding to PstyA, using a 200-fold molar excess of different 5⬘ deletion fragments of PstyA as competitors. The shortest 5⬘ deletion fragment that was able to compete with IHF (spanning from nucleotide ⫺76 to nucleotide 240 of PstyA) lacks the consensus but contains an A-T-rich region predicted to be intrinsically curved (20). It has been reported that this kind of DNA region can bind to IHF in the absence of a consensus element, although at a lower affinity (21). This led us to locate the IHF binding site about 15 bp downstream of the actual location. However, the DNase I protection assay showed that in the full-length promoter binding of IHF occurs only at the URE region.

VOL. 71, 2005


5415

FIG. 2. DNase I footprints of StyR in the PstyA promoter region. DNA fragments extending from position ⫺139 to position 103 (Top strand) or from position ⫺145 to position 103 (Bottom strand) of the PstyA promoter were incubated with different amounts of phosphorylated StyR protein prior to DNase I digestion. Brackets indicate the regions showing specific protection by StyR-P; arrows indicate the positions of hypersensitive sites. All numbering refers to the transcriptional start from the PstyA promoter. Lane M, Maxam-Gilbert sequencing reactions (A⫹G); lane 1, no StyR-P added; lanes 2 to 10, StyR-P added to final concentrations of 0.26, 0.52, 1.04, 1.50, 2.08, 3.00, 4.16, 6.00, and 8.30 ␮M, respectively.

Functional role of the URE region and the STY3 site. Previous studies showed that PstyA activity was repressed to various extents by the presence of an alternative carbon source in addition to styrene (18). The presence on PstyA of StyR binding sites with different affinities and of an IHF binding site overlapping the STY1 site in the URE region led us to speculate that the activity of this promoter could be finely modulated depending on the differential binding of StyR and IHF to these cis-acting elements, in response to different metabolic conditions. In order to address this hypothesis, we evaluated the role of the URE region and

of the STY3 StyR binding site in cells grown on styrene (full promoter activity) and on styrene plus glucose (repressing conditions). The binding sites for StyR and IHF are strictly interwoven in the URE region, impairing the ability to inactivate the STY1 site without interfering with the IHF binding and vice versa. Therefore, we eliminated the entire URE region by performing PstyA 5⬘ deletion up to nucleotide ⫺57. The low-affinity STY3 site has a peculiar structure; it is composed of two inverted repeats that form a degenerated palindromic structure and an overlapping third repeat (Fig.

5416

LEONI ET AL.

FIG. 3. EMSA of StyR-P binding to distinct sites. Different amounts of StyR-P (concentrations are indicated below the lanes) were incubated with different DNA probes prior to nondenaturing gel electrophoresis on 10% (wt/vol) acrylamide gels. The arrows indicate the positions of unshifted DNA probes. Nucleotide numbering refers to the transcriptional start from the PstyA promoter. (A) EMSA of StyR-P binding to the STY1 probe. The labeled fragment contained nucleotides ⫺122 to ⫺83 of PstyA. (B) EMSA of StyR-P binding to the STY2 probe. The labeled fragment contained nucleotides ⫺62 to ⫺23 of PstyA. (C) EMSA of StyR-P binding to the STY3 probe. The labeled fragment contained nucleotides 4 to 43 of PstyA.

1C). We reasoned that the whole structure of this site could be involved in StyR binding. Thus, to inactivate STY3, two nucleotide substitutions were introduced into the repeats showing the higher degree of homology with the STY2 inverted repeats (Fig. 1C). We did not inactivate STY2 since this site is essential for promoter activity (20). The different promoter variants were cloned in the promoter-probe vector pPR9TT, fused to the reporter gene lacZ, and introduced into P. fluorescens ST (Fig. 5A). After growth on styrene, the derivative strains were diluted in the same medium, subcultured for 2 h, and divided into three flasks containing styrene, styrene plus glucose, and glucose alone, as described in Materials and Methods. ␤-Galactosidase activity and the optical density at 600 nm were monitored during growth for 6 h after division. We found that the fully styreneinduced strains with the different constructs diluted the accumulated ␤-galactosidase at the same rate during growth on glucose, conditions in which the PstyA promoter is not induced (Fig. 5B and C) (18). We considered the ␤-galactosidase activity values obtained under these culture conditions, for each


FIG. 4. DNase I footprints of IHF in the PstyA promoter region. DNA fragments extending from position ⫺139 to position 103 (Top strand) or from position ⫺145 to position 103 (Bottom strand) of the PstyA promoter were mixed with different amounts of IHF protein prior to DNase I digestion. Brackets indicate the regions showing specific protection by IHF; all numbering refers to the transcriptional start from the PstyA promoter. Lane M, Maxam-Gilbert sequencing reactions (A⫹G); lane 1, no IHF added; lanes 2 to 5, IHF added to final concentrations of 0.80, 1.60, 3.20, and 6.40 ␮M, respectively.

strain and for each point of the curve, the 100% repression values (no promoter activity) for the PstyA promoter. Similarly, we considered the ␤-galactosidase values observed during exponential growth on styrene (full inducing conditions) the 100% values for PstyA activity (no repression). Moreover, since during growth ␤-galactosidase dilution and production occurred at the same time, we compared the ␤-galactosidase levels obtained with the different constructs after two exponential cell divisions in the different cultural conditions (Fig. 5D). The level of ␤-galactosidase activity when styrene was the sole carbon source was reduced to 33% for the strain carrying the deletion in the URE region (pPR9Pa4) compared with the full-length promoter (pPR9Pa1). This result indicates that the URE region has a positive role in promoter activity under

VOL. 71, 2005


5417

inducing conditions. On the other hand, mutation of the STY3 site in pPR9Pa1mut and in pPR9Pa4mut had no effect on the promoter activity under inducing conditions compared to pPR9Pa1 and pPR9Pa4. Thus, this StyR binding site does not seem to be involved in promoter activation. In repressing conditions (styrene plus glucose), the activity of the pPR9Pa1 construct was about 59% reduced compared with the activity under inducing conditions. The level of repression was 38% in the construct lacking the URE region (pPR9Pa4). These results suggest that the URE region, besides being required for full promoter activation under inducing conditions, could also play a role in glucose-mediated repression. Mutation of STY3 in the full-length promoter (pPR9P a1mut) relieved the promoter from glucose repression (26% repression), indicating that STY3 has a negative regulatory role. This result is consistent with the location of this site downstream of the transcription start point. The same mutation in the pPR9Pa4 derivative (pPR9Pa4mut) produced similar results; the difference was that promoter activity was not repressed at all by glucose addition. Thus, when both STY3 and the URE region are inactivated simultaneously, as in pPR9Pa4mut, the glucose-mediated repression is totally abolished. The STY3 site is located very close to the Shine-Dalgarno consensus for translation initiation. Therefore, the introduced mutations could have an effect on the styA::lacZ translation efficiency rather than on its transcription. To address this issue, we measured the lacZ mRNA levels by semiquantitative reverse transcription-PCR in P. fluorescens ST carrying pPR9Pa4 or pPR9Pa4mut under repressing conditions. The ratio of the lacZ mRNA levels to the ␤-galactosidase activities with pPR9Pa4 and pPR9Pa4mut were comparable, showing that the mutations introduced into pPR9Pa4mut do have an effect on the transcription efficiency (data not shown). DISCUSSION The results presented here suggest a model for PstyA fine regulation in which StyR-P can work either as an activator or as a repressor of styABCD transcription, depending on which sites it occupies. StyR-P acts as an activator when it is bound to

FIG. 5. Functional analysis of PstyA regulative elements. (A) Schematic representation of the PstyA deleted or mutated derivative fragments cloned in the promoter probe vector pPR9TT. Plasmid designations are given on the left. The large solid inverted arrows indicate the StyR binding sites. The open inverted arrows indicate the mutated STY3 site. The IHF consensus is enclosed in a box. Nucleotide numbering refers to the PstyA transcription start site. The solid rectangle indicates the styA open reading frame. The open arrow indicates the lacZ gene fused to styA. (B) ␤-Galactosidase activities of P. fluorescens ST carrying the pPR9Pa1 or pPR9Pa1mut plasmid. Early-exponentialphase cultures growing on styrene as the sole carbon source were divided at time zero into three flasks, and either styrene or glucose (0.4%) or both were added (see Materials and Methods). ␤-Galactosidase activity was measured during the growth for 6 h after the division. Symbols: }, cultures growing on styrene, pPR9Pa1; 〫, cultures growing on styrene, pPR9Pa1mut; Œ, styrene-grown precultures to which only 0.4% glucose was added at time zero, pPR9Pa1; ‚, styrenegrown precultures to which only 0.4% glucose was added at time zero, pPR9Pa1mut; F, styrene-grown cultures to which both styrene and 0.4% glucose were added at time zero, pPR9Pa1; E, styrene-grown

cultures to which both styrene and 0.4% glucose were added at time zero, pPR9Pa1mut. (C) Same experimental conditions as those described above for panel B. Symbols: }, cultures grown on styrene, pPR9Pa4; 〫, cultures grown on styrene, pPR9Pa4mut; Œ, styrenegrown precultures to which only 0.4% glucose was added at time zero, pPR9Pa4; ‚, styrene-grown precultures to which only 0.4% glucose was added at time zero, pPR9Pa4mut; F, styrene-grown cultures to which both styrene and 0.4% glucose were added at time zero, pPR9Pa4; E, styrene-grown cultures to which both styrene and 0.4% glucose were added at time zero, pPR9Pa4mut. (D) Promoter activity (in Miller units [M.U.]) of the constructs shown in panel A after two exponential cell divisions, corresponding to 4.5 h of growth on glucose (Glu) and glucose plus styrene (Sty ⫹ Glu) and 6 h of growth on styrene (Sty) for the experiments whose results are shown in panels B and C. The level of repression revealed by each construct during growth on styrene plus glucose was calculated by assuming that the promoter activity in styrene was 100% and the promoter activity in glucose corresponded to 100% repression. All the data reported are the averages of the results obtained in at least five independent experiments in which the standard deviation was not more than 8%.

5418

LEONI ET AL.

STY2, since this site is necessary for promoter activity (20). Conversely, StyR-P acts as a repressor when it is bound to the negative regulatory site STY3. This is a low-affinity site and must be occupied after the STY1 and STY2 sites, after an increase in the cellular levels of StyR-P. Another hypothesis is that StyR acts as a repressor when it is not phosphorylated. However, we have ruled out this possibility, since we did not detect any binding at the STY3 site using unphosphorylated StyR (data not shown). How an increase in StyR-P is related to a glucose effect is not easy to explain. However, our hypothesis is that the sensor kinase activity is enhanced when, besides styrene, cells are in conditions that determine a high redox potential. This hypothesis is based on the presence of two PAS domains and two kinase domains in the StyS sensor, which is a strong indication that two different signals can be sensed by this protein. If the two signals are styrene and the cell redox potential, a signal often perceived by PAS domains, their integration could modulate the kinase activity of the sensor. The DNase I data presented above show that there is contemporary binding of StyR-P to the STY1 and STY2 sites with different affinities, indicating that the binding is cooperative, as shown in a previous paper (9). Moreover, the presence of strong hypersensitive sites in the DNA region between STY1 and STY2 suggests that two dimers of StyR-P bound at this site could interact, leading to DNA looping. In vivo, the cooperative binding of StyR-P to STY1 and STY2 is probably counteracted by IHF, which, competing with StyR-P for binding to the URE, would have a positive modulatory role in promoter activity, consistent with previous data showing that PstyA activity is reduced in an ihf heterologous background (20). In this case, the fine modulation of PstyA would depend on the relative cellular levels of StyR-P and IHF in the different growth conditions. On the other hand, IHF cannot only have a role in displacing StyR from the STY1 site, since in this case the pPR9Pa1 and pPR9Pa4 constructs should have had the same activity in fully inducing conditions (growth on styrene). Thus, IHF must have a positive role, and the reduction in the promoter activity observed in inducing conditions when the URE region was deleted was most probably due to the lack of the IHF binding site. Deletion of the URE also results in partial relief from glucose repression. This can be due to the lack of promoter sequences recognized by other regulatory factors. However, it is tempting to speculate that, in accord with the view that a higher cell redox potential results in higher levels of StyR-P, in the presence of glucose both STY1 and STY2 are occupied by StyR-P, producing a looped promoter structure, which partially represses promoter activity. The finding that in the PstyA variant carrying both a URE deletion and a STY3 mutation glucose repression is completely relieved also supports this hypothesis. Our preliminary results indicate that IHF levels do not change significantly during exponential growth both on styrene and on styrene plus glucose and that there is no relationship between the amount of the StyR protein and the promoter activity. These findings strongly suggest that the level of the activated form of the response regulator StyR is a main element determining the activity of the PstyA promoter in different growth conditions. One could speculate that styrenedegrading microorganisms evolved so that they could rapidly


switch their metabolism toward the utilization of more favorable carbon sources simply by increasing the phosphorylation level of the regulator, through sensor kinase activity. The regulatory system for the ortho-cleavage pathway of 3-chlorocatechol degradation exhibits some similarities with our system (11). The specific inducer of the system (the metabolic intermediate 2-chloro-cis,cis-muconate) and the tricarboxylic acid cycle intermediate fumarate, acting as a key signaling molecule of the metabolic status of the cell, compete for direct binding to the LysR-type regulator ClcR and modulate its activity positively and negatively, respectively (11). Therefore, the study reported here represents the second example of aromatic compound catabolism in which specific regulation and catabolite repression rely on the same regulator. ACKNOWLEDGMENTS We express our gratitude to Victor de Lorenzo for his generous donation of the IHF protein. We are also grateful to Cecilia Ambrosi for critical reading of the manuscript and to Rodolfo Negri for helpful discussions. This work was supported by grants from ISPESL (B/98-1/DIPIA/03) and from University “Roma Tre” (CLAR 2004). REFERENCES 1. Baggi, G., M. M. Boga, E. Catelani, E. Galli, and V. Treccani. 1983. Styrene catabolism by a strain of Pseudomonas fluorescens. Syst. Appl. Microbiol. 4:141–147. 2. Beltrametti, F., A. M. Marconi, G. Bestetti, C. Colombo, E. Galli, M. Ruzzi, and E. Zennaro. 1997. Sequencing and functional analysis of styrene catabolism genes from Pseudomonas fluorescens ST. Appl. Environ. Microbiol. 63:2232–2239. 3. Cases, I., and V. de Lorenzo. 2001. The black cat/white cat principle of signal integration in bacterial promoters. EMBO J. 20:1–11. 4. Coschigano, P. W., and L. Y. Young. 1997. Identification and sequence analysis of two regulatory genes involved in anaerobic toluene metabolism by strain T1. Appl. Environ. Microbiol. 63:652–660. 5. Figursky, D. H., and D. R. Helinski. 1979. Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid function provided in trans. Proc. Natl. Acad. Sci. USA 76:1648–1652. 6. Hartmans, S., J. P. Smits, M. J. Van der Werf, F. Volkering, and J. A. M. de Bont. 1989. Metabolism of styrene oxide and 2-phenylethanol in the styrenedegrading Xanthobacter strain 124X. Appl. Environ. Microbiol. 55:2850– 2855. 7. Labbe`, D., J. Garnon, and P. C. Lau. 1997. Characterization of the genes encoding a receptor-like histidine kinase and a cognate response regulator from a biphenyl/polychlorobiphenyl-degrading bacterium, Rhodococcus sp. strain M5. J. Bacteriol. 179:2772–2776. 8. Lau, P. C. K., Y. Wang, A. Patel, D. Labbe`, H. Bergeron, R. Brousseau, Y. Konishi, and M. Rawlings. 1997. A bacterial basic region leucine zipper histidine kinase regulating toluene degradation. Proc. Natl. Acad. Sci. USA 94:1453–1458. 9. Leoni, L., P. Ascenzi, A. Bocedi, G. Rampioni, L. Castellini, and E. Zennaro. 2003. Styrene-catabolism regulation in Pseudomonas fluorescens ST: phosphorylation of StyR induces dimerization and cooperative DNA-binding. Biochem. Biophys. Res. Commun. 303:926–931. 10. Marconi, A. M., F. Beltrametti, G. Bestetti, F. Solinas, M. Ruzzi, E. Galli, and E. Zennaro. 1996. Cloning and characterization of styrene catabolism genes from Pseudomonas fluorescens ST. Appl. Environ. Microbiol. 62:121– 127. 11. McFall, S. M., B. Abraham, C. G. Narsolis, and A. M. Chakrabarty. 1997. A tricarboxylic acid cycle intermediate regulating transcription of a chloroaromatic biodegradative pathway: fumarate-mediated repression of the clcABD operon. J. Bacteriol. 179:6729–6735. 12. McLeod, S. M., and R. C. Johnson. 2001. Control of transcription by nucleoid proteins. Curr. Opin. Microbiol. 4:152–159. 13. Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 14. O’Leary, N. D., K. E. O’Connor, and A. D. W. Dobson. 2002. Biochemistry, genetics and physiology of microbial styrene degradation. FEMS Microbiol. Rev. 26:403–417. 15. Panke, S., B. Witholt, A. Schmid, and M. G. Wubbolts. 1998. Towards a biocatalyst for (S)-styrene oxide production: characterization of the styrene degradation pathway of Pseudomonas sp. strain VLB120. Appl. Environ. Microbiol. 64:2032–2043.

VOL. 71, 2005


16. Ramos-Gonzales, M. I., M. Olson, A. A. Gatenby, G. Mosqueda, M. Manzanera, M. J. Campos, S. Vichez, and J. L. Ramos. 2002. Cross-regulation between a novel two-component signal transduction system for catabolism of toluene in Pseudomonas mendocina and the TodST system from Pseudomonas putida. J. Bacteriol. 184:7062–7067. 17. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 18. Santos, P. M., J. M. Blatny, I. Di Bartolo, S. Valla, and E. Zennaro. 2000. Physiological analysis of expression of styrene degradation cluster in Pseudomonas fluorescens ST. Appl. Environ. Microbiol. 6:1305–1310. 19. Santos, P. M., I. Di Bartolo, J. M. Blatny, E. Zennaro, and S. Valla. 2001. New broad-host-range promoter probe vectors based on the plasmid RK2 replicon. FEMS Microbiol. Lett. 195:91–96. 20. Santos, P. M., L. Leoni, I. Di Bartolo, and E. Zennaro. 2002. Integration host

21.

22. 23. 24. 25.

5419

factor is essential for the optimal expression of styABCD operon in Pseudomonas fluorescens ST. Res. Microbiol. 153:527–536. Shimizu, M., M. Miyake, F. Kanke, U. Matsumoto, and H. Shindo. 1995. Characterization of the binding of HU and IHF, homologous histone-like proteins of Escherichia coli, to curved and uncurved DNA. Biochim. Biophys. Acta 1264:330–336. Shingler, V. 2003. Integrated regulation in response to aromatic compounds: from signal sensing to attractive behaviour. Environ. Microbiol. 5:1226–1241. Stock, A. M., V. L. Robinson, and P. N. Goudreau. 2000. Two-component signal transduction. Annu. Rev. Biochem. 69:183–215. Taylor, B. L., and I. B. Zhulin. 1999. PAS domains: internal sensors of oxygen, redox potential, and light. Microbiol. Mol. Biol. Rev. 63:479–506. Velasco, A., S. Alonso, J. L. Garcı`a, J. Perera, and E. Dı`az. 1998. Genetic and functional analysis of the styrene catabolic cluster of Pseudomonas sp. strain Y2. J. Bacteriol. 180:1063–1071.