Early and late promoters of BK polyomavirus, Merkel cell polyomavirus ...

Journal of General Virology (2015), 96, 2293 – 2303

DOI 10.1099/vir.0.000181

Early and late promoters of BK polyomavirus, Merkel cell polyomavirus, Trichodysplasia spinulosa-associated polyomavirus and human polyomavirus 12 are among the strongest of all known human polyomaviruses in 10 different cell lines Ugo Moens,1 Marijke Van Ghelue,2,3 Maria Ludvigsen,1 Sarah KorupSchulz4 and Bernhard Ehlers4 Correspondence

1

University of Tromsø, Faculty of Health Sciences, Institute of Medical Biology, Norway

Ugo Moens

2

University Hospital of North Norway, Department of Medical Genetics, Norway

3

University of Tromsø, Faculty of Health Sciences, Institute of Clinical Biology, Norway

4

Division 12 Measles, Mumps, Rubella and Viruses Affecting Immunocompromised Patients, Robert Koch Institute, Berlin, Germany

[email protected]

Received 17 February 2015 Accepted 8 May 2015

Recently, 11 new human polyomaviruses (HPyVs) have been isolated and named KI, WU, Merkel cell polyomavirus (MCPyV), HPyV6, 27, 29, 210 and 212, Trichodysplasia spinulosaassociated polyomavirus (TSPyV), STLPyV and NJPyV-2013. Little is known about cell tropism of the novel HPyVs, and cell cultures allowing virus propagation are lacking. Because viral tropism partially depends on the interaction of cellular transcription factors with the viral promoter, we monitored the promoter activity of all known HPyVs. Therefore, we compared the relative early and late promoter activity of the BK polyomavirus (BKPyV) (WW strain) with the corresponding activities of the other HPyVs in 10 different cell lines derived from brain, colon, kidney, liver, lung, the oral cavity and skin. Our results show that the BKPyV, MCPyV, TSPyV and HPyV12 early promoters displayed the strongest activity in most cell lines tested, while the remaining HPyV had relative low early promoter activity. HPyV12 showed the highest late promoter activity of all HPyVs in most cell lines, but also the BKPyV, MCPyV and TSPyV late promoters belonged to the stronger ones among HPyVs. The HPyVs with weak early promoter activity had in general also weak late promoter activity, except for HPyV10 whose late promoter was relatively strong in six of the 10 cell lines. A 20 bp deletion in the promoter of an HPyV12 variant significantly affected both early and late promoter activity in most cell lines. In conclusion, our findings suggest which cell lines may be suitable for virus propagation and may give an indication of the cell tropism of the HPyVs.

INTRODUCTION Polyomaviruses are non-enveloped viruses with a dsDNA genome infecting birds and mammals. Thirteen human polyomaviruses (HPyVs) have been described so far: BKPyV, JCPyV, KIPyV, WUPyV, Merkel cell PyV (MCPyV), HPyV6, HPyV7, Trichodysplasia spinulosa-associated polyomavirus (TSPyV), HPyV9, HPyV10 and the isolates MW and MX, STLPyV, HPyV12 and NJPyV-2013 (Allander Two supplementary tables and two supplementary figures are available with the online Supplementary Material.

000181 G 2015 The Authors

et al., 2007; Buck et al., 2012; Feng et al., 2008; Gardner et al., 1971; Gaynor et al., 2007; Korup et al., 2013; Lim et al., 2013; Mishra et al., 2014; Padgett et al., 1971; Schowalter et al., 2010; Scuda et al., 2011; Siebrasse et al., 2012a; van der Meijden et al., 2010; Yu et al., 2012). Seropositivity for most HPyVs is w50 %, implying that individuals are co-infected with several different HPyVs. The role of HPyVs in disease remains largely unclear. BKPyV is associated with nephropathy in renal transplant patients and with haemorrhagic cystitis in bone marrow recipients (Hirsch & Steiger, 2003), while JCPyV is the aetiological agent of progressive multifocal leukoencephalopathy (Tan & Koralnik, 2010). MCPyV is the

Downloaded from www.microbiologyresearch.org by IP: 195.45.102.195 On: Sat, 03 Oct 2015 12:07:31

Printed in Great Britain

2293

U. Moens and others

cause of 80 % of Merkel cell carcinoma (Feng et al., 2008), while TSPyV is linked to the rare skin disease trichodysplasia spinulosa in immunocompromised patients (van der Meijden et al., 2010). HPyV7 DNA was discovered in peripheral blood of two and in gastric mucosal tissues of one of two lung transplant patients who developed pruritic rash, and DNA and large T-antigen expression was found to be common in thymomas (23/37) and thymic hyperplasias (8/20) (Ho et al., 2015; Rennspiess et al., 2015). Whether the other HPyVs contribute to diseases is not known (DeCaprio & Garcea, 2013). Little is known about the genuine host cells for most HPyVs. Although BKPyV is considered a nephrotropic virus, viral proteins and nucleic acids have been detected in several other tissues and organs including bladder, blood, bone, brain and central nervous system (CNS), male and female genitals, heart, lung, liver, skin, salivary glands and spleen (Burger-Calderon et al., 2014; Rekvig & Moens, 2002). Brain and CNS, peripheral blood cells, kidney, lungs, lymphoid organs, tonsils and gastrointestinal tract have been shown to harbour JCPyV (Boothpur & Brennan, 2010; Do¨rries et al., 2003; Ravichandran & Major, 2006). KIPyV and WUPyV were originally discovered in respiratory tract secretions, but DNA of these viruses has also been detected in blood, lymphoid tissue, stool, tonsil tissue and brain (Barzon et al., 2009a; Moens et al., 2010; Sharp et al., 2009). WUPyV DNA was also detected in cerebral spinal fluid (CSF) of one patient (Barzon et al., 2009b). KIPyV DNA or VP1 protein was found in lung cancer tissue and in alveolar macrophages and spleen (Babakir-Mina et al., 2009; Siebrasse et al., 2014). MCPyV seems to be a common skin commensal (Bellaud et al., 2014; Hampras et al., 2015; Mertz et al., 2013; Schowalter et al., 2010), but DNA is also found in blood, eyebrow hairs, tonsils, gall bladder, intestine, appendix, liver, lung, lymphoid tissue, saliva and oral samples, and urine (reviewed by Baez et al., 2013; Hampras et al., 2015; Moens & Van Ghelue, 2011; Signorini et al., 2014). HPyV6 and HPyV7 are common in skin and eyebrow hairs (Bellaud et al., 2014; Hampras et al., 2015; Schowalter et al., 2010; Wieland et al., 2014), but have in very few cases been isolated from nasopharyngeal swabs, faeces or urine (Siebrasse et al., 2012b). TSPyV resides in the skin (van der Meijden et al., 2010), but viral nucleotide sequences have also been detected in tonsillar biopsies of healthy individuals, in heart, lung, liver, spleen, bronchus, small intestine, colon tissue from a patient with myocarditis, and in renal allograft of a kidney transplant patient (Fischer et al., 2012; Sadeghi et al., 2014; Tsuzuki et al., 2014). HPyV9 was identified in a serum sample from a kidney transplant patient and in the skin of a patient with Merkel cell carcinoma (Sauvage et al., 2011; Scuda et al., 2011). The presence of HPyV9 DNA was confirmed in 21 serum specimens of 101 kidney transplant patients, in PBMCs of an AIDS patient and in skin from a healthy person (Hampras et al., 2015; Lednicky et al., 2014; van der Meijden et al., 2014). HPyV10 isolate MW was originally isolated from faeces (Siebrasse et al., 2012a), while 2294

isolate 10ww was first described in skin from a patient with warts, hypogammaglobulinaemia, infections and myelokathexis (WHIM) syndrome (Buck et al., 2012). MX, another HPyV10 isolate, was found in stool and in respiratory samples (Yu et al., 2012). Later studies have described the presence of HPyV10 in forehead swabs of both human immunodeficiency virus (HIV)-infected and HIV-negative men, confirming skin tropism for this virus (Wieland et al., 2014). STLPyV DNA was amplified from faeces and urine (Lim et al., 2013). A STLPyV variant sharing 92 % genome identity with the originally described MA138 and WD972 strains, was isolated from skin warts of a patient suffering from WHIM syndrome (Pastrana et al., 2013a). HPyV12 was found in organs of the digestive tract, in particular the liver but also in colon, rectum and faeces (Korup et al., 2013). NJPyV-2013 cDNA sequences and virions were originally detected in a muscle biopsy of a pancreatic transplant recipient, but viral sequences were also found in endothelial cells in muscle and skin of the same patient (Mishra et al., 2014). Many studies have detected HPyV DNA by PCR, which is a very sensitive method allowing the detection of less than one genome copy per cell. Since most of these studies relied on the uncovering of viral genomes in extracts from biopsies, the specific cell types that harbour HPyVs have not been identified. Moreover, the presence of viral DNA provides no information on the state of the viral genome (episomal or integrated) and activity of the virus. Identifying the natural host cells of HPyVs may increase our knowledge of these viruses and enable us to establish cell cultures allowing productive infection. Studies on HPyV cell tropism have focused on cell-surface entry receptors and co-receptors (Khan et al., 2014; Neu et al., 2013; O’Hara et al., 2014; Pastrana et al., 2013b; Stro¨h et al., 2014). While the presence of these receptors is essential for infection, cellular factors that bind the HPyV promoter or HPyV regulatory proteins will affect viral transcription and replication and effect viral production (e.g. Gorrill & Khalili, 2005; Feng et al., 2011; Ferenczy et al., 2013; Jordan et al., 2010; Liang et al., 2012; Marshall et al., 2012; Ravichandran & Major, 2006; Romagnoli et al., 2009; Safak & Khalili, 2001; Wang et al., 2012; White et al., 2014; Wollebo et al., 2012). Hence, these interactions will determine the cell tropism of the HPyV. To obtain an indication for the cell tropism of HPyVs, the relative early and late promoter activity of all known HPyVs was examined in 10 different human cell lines. We also examined the effect on the early and late promoter activities of a deletion in the non-coding control region (NCCR) of a naturally occurring HPyV12 variant. Our results show that the early and late promoter activities of the HPyVs varied in the different cell lines and the mutation in the HPyV12 promoter significantly affected its early and late promoter activities. These findings underscore the role of the HPyV promoter in cell tropism and may facilitate the hunt for suitable cell lines allowing propagation of these viruses.


Journal of General Virology 96

Human polyomavirus promoter activities

RESULTS Transfection efficiency of the different cell lines Because HPyV DNA can be detected in cells of the respiratory tract, the gastrointestinal tract, the urogenital tract, the skin and the brain, human cell lines derived from these different tissues and organs were selected (Table 1). Before comparing the relative strength of the HPyV promoters in different cell lines, we estimated the transfection efficiency by Lipofectamine 2000-mediated transfection of cells with an expression plasmid for green fluorescence protein and monitored green fluorescent cells under the microscope. The cell lines HEK293 and A375 had w90 % transfection efficiency, while the other cell lines had an estimated transfection efficiency of *75 % (SK-N-BE and SW480), *60 % (A549 and HSC-3) and *50 % (A64 and BEL7402). HaCaT cells had the lowest transfection efficiency (*25 %) in our hands (results not shown). NCCRs of the different HPyV The complete NCCR of all 13 known HPyVs was cloned in both orientations in the luciferase reporter plasmid pGL3basic. This allowed us to monitor the early and late activity of these promoters. For BKPyV, the archetypal (WW) promoter was chosen as this is the naturally occurring strain (Moens et al., 1995; Moens & Van Ghelue, 2005). For JCPyV, the non-rearranged archetypal (CY) strain NCCR was cloned (Newman & Frisque, 1997; Yogo & Sugimoto, 2001). For HPyV10, the NCCR of the isolate described by Buck et al. (2012) was selected. The GenBank accession numbers on which the cloned NCCRs are based are given in Table S1 (available in the online Supplementary Material). Relative promoter activities of the HPyV The reader is referred to Fig. 1 for the relative strength of the HPyV promoters. The activity of the BKPyV early (respectively late) promoter was arbitrarily set as 100 %.

Figures S1 and S2 depict the promoter activities in relative luciferase units (RLU). The early promoters of BKPyV and MCPyV were the strongest in HEK293 cells, while all the other HPyV NCCRs had a transcriptional activity which was j15 % of the BKPyV promoter. Only KIPyV early promoter possessed an intermediate activity, which was *50 % of that of BKPyV. Similarly, the late promoters of BKPyV, MCPyV and KIPyV were also strongest among the HPyV. In the neuroblastoma cell line SK-N-BE, the TSPyV, NJPyV2013, BKPyV and HPyV10 early promoters were among the strongest, whereas MCPyV, HPyV9 and KIPyV displayed intermediate activity, and the early promoters of the other HPyV were relatively weak. While the late promoters of TSPyV and BKPyV were still among the strongest, NJPyV2013 and HPyV10 late promoters were relatively weak. The JCPyV early promoter was the weakest, but its late promoter was among the stronger HPyV promoters. Three skin-derived cell lines were tested: A375, A431 and HaCaT. In A375 cells, the early promoters of HPyV12, WUPyV, TSPyV, BKPyV and MCPyV demonstrated highest activity. This was also true for their late promoters, except TSPyV. The other viruses demonstrated medium to low early and late promoter activity. The only exception was the HPyV10 early promoter which was of medium relative strength, while its late promoter was the second strongest one. The BKPyV early, as well as the late promoter was the strongest of all HPyV in A431 cells, with exception of the TSPyV and HPyV12 late promoters. All promoters (as measured in RLU) were weak in HaCaT cells. This can be partially explained by the low transfection efficiency of these cells. BKPyV, MCPyV and HPyV10 had the highest relative early promoter activity, the transcriptional strength of the KIPyV and WUPyV early promoters was approximately half of that of BKPyV, whereas it was w20 % for the other HPyV. The HPyV12 late promoter was relatively strong in HaCaT cells, but also KIPyV, MCPyV and HPyV10 had late promoter activity which was 13–59 % higher compared with the BKPyV late promoter.

Table 1. Cell lines used in this study Cell line

Origin

Supplier

A375 A431 A549 A64-CLS BEL7402 HaCaT

Human malignant melanoma Human epidermoid carcinoma Human epithelial lung adenocarcinoma Adenoma of the submaxillary gland Human hepatocellular carcinoma In vitro spontaneously transformed keratinocytes from histologically normal skin Human embryonic kidney cells transformed with human adenovirus 5 Human oral squamous cell carcinoma from tongue Human neuroblastoma Human colorectal adenocarcinoma

European Collection of Cell Cultures American Type Culture Collection (ATCC) ATCC Cell Lines Services, Eppelheim, Germany Donated by Jihua Shi, Oslo University Hospital, Norway Cell Lines Services, Eppelheim, Germany

HEK293 HSC-3 SK-N-BE SW480

http://vir.sgmjournals.org

Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ), Braunschweig, Germany Gift of Gunbjørg Svineng, University of Tromsø DSMZ, Braunschweig, Germany ATCC


2295

U. Moens and others

(a)

A375

A431

A549

A64

BEL7402

HaCaT

HEK293

HSC-3

SK-N-BE

SW480

BK-E

100

100

100

100

100

100

100

100

100

100

JC-E

6

4

2

4

10

15

3

22

5

29

KI-E

14

45

60

8

36

44

49

120

53

100

WU-E

257

16

40

16

31

48

9

181

11

1817

MC-E

95

26

48

26

167

100

115

312

64

1086

H6-E

4

3

11

2

11

16

4

20

10

218

H7-E

33

17

28

3

26

17

4

59

15

145

TS-E

121

6

101

28

54

13

9

22

153

148

H9-E

26

19

17

7

36

9

15

38

63

1149

H10-E

56

16

74

16

36

40

9

116

87

228

STL-E

17

8

25

1

13

6

10

51

7

92

H12-E

303

15

271

14

79

21

22

84

24

1164

8

10

146

3

39

24

7

34

108

12

A375

A431

A549

A64

BEL7402

HaCaT

HEK293

NJ-E

(b)

HSC-3 SK-N-BE

SW480

BK-L

100

100

100

100

100

100

100

100

100

100

JC-L

41

16

22

37

54

25

30

15

55

155

KI-L

35

57

81

17

73

120

66

29

45

27

WU-L

118

54

52

16

135

58

8

25

4

139

MC-L

60

71

311

111

400

113

63

40

127

326

H6-L

13

15

61

13

75

20

18

9

62

186

H7-L

25

58

50

20

103

23

31

24

64

194

TS-L

19

123

199

108

215

24

53

16

165

333

H9-L

4

29

36

23

56

10

43

9

46

466

H10-L

175

44

292

84

328

159

20

43

39

203

STL-L

11

21

49

23

323

49

32

25

3

123

H12-L

2340

164

1773

265

1018

1256

43

352

45

1390

9

31

936

10

122

36

9

9

193

10

NJ-L

Fig. 1. Heat map presentation of the relative promoter activity of the 13 known HPyVs tested in 10 different cell lines. The activity of the BKPyV promoter was arbitrarily set as 100 % and the activities of the other promoters were related to the BKPyV promoter. (a) Early promoter activity; (b) late promoter activity.

2296




As for cell lines originating from oral and respiratory tissue, HPyV12, NJPyV-2013, BKPyV and TSPyV possessed the strongest early and late promoter activity in A549 cells. The early and late promoters of the other HPyV displayed medium or low activity, with exception of the HPyV10 late promoter which was among the stronger promoters. All early promoters were w70 % weaker than BKPyV in A64-CSL cells. The late promoters of most HPyV were also relatively weak in these cells, except for HPyV12, MCPyV and TSPyV, which had stronger or similar activity compared with BKPyV. BKPyV and HPyV12 had relative strong early and late promoter activity in HSC-3 cells, while MCPyV, WUPyV, KIPyV and HPyV10 had a stronger early, but a weaker late promoter than BKPyV in these cells. The transcriptional activities of the JCPyV, HPyV6, HPyV7, TSPyV, HPyV9, STLPyV and NJPyV-2013 early and late promoters were lower than the corresponding BKPyV promoters. In the colon cancer cell line SW480, the early promoters of WUPyV, MCPyV, HPyV9 and H12PyV were 10–18-fold stronger compared with BKPyV, whereas JCPyV and NJPyV-2013 had only 29 % and 12 % of the activity of the BKPyV promoter. The remaining HPyV had early promoter activity comparable (KIPyV) or stronger than BKPyV. The late promoters behaved similarly, except for JCPyV which had a relatively strong late promoter and KIPyV for which relatively weak late promoter activity was observed.

activity, we compared the early and late promoter strength of HPyV12 and a naturally derived deletion variant (DHPyV12) that lacks 26 nt (TAACCGCGGTCAGAACAAGTTAGAAC). This deletion significantly decreased early and late promoter activity in all cell lines tested, except for BEL7402 and HEK293 cells, where the early promoter activity of DHPyV12 increased (Fig. 2).

DISCUSSION The genuine host cells for most of the known HPyVs remain elusive and cell systems that allow propagation of these viruses are lacking. Because the life cycle of a virus not only depends on entering its host, but also on the appropriate cell factors to support viral gene expression and DNA replication, we investigated for the first time to our knowledge the early and late promoter activities of all known HPyVs in 10 different human cell lines derived from the skin, CNS, oral cavity, kidney, liver, lung and colon.

Effect of deletion on promoter activity

BKPyV, JCPyV and TSPyV can be found in the kidney (Doerries, 2006; Fischer et al., 2012), whereas KIPyV, MCPyV, HPyV9 and STLPyV DNA can be detected in urine (Csoma et al., 2012, 2015; Husseiny et al., 2010; Lim et al., 2013; Mertz et al., 2010; Rockett et al., 2013). The BKPyV, MCPyV and TSPyV early and late promoters were among the strongest in HEK293 cells. BKPyV with archetypal NCCR can replicate in HEK293 cells, whereas transfection of HEK293 cells with the complete MCPyV genome resulted in moderate production of virions (Feng et al., 2011; Sundsfjord et al., 1990). However, no secondary infection was observed when fractions containing these virions were used to infect HEK293 cells (Feng et al., 2011). These findings question the role of the kidney as a genuine host for MCPyV. The relatively low early and late promoter activities of KIPyV and HPyV9 may suggest that the kidneys are not genuine host organs for these viruses.

BKPyV and JCPyV clinical isolates with rearranged NCCR have been isolated and the architecture of the NCCR has been shown to be a major determinant of viral gene expression and replication in vitro (Ault, 1997; Broekema et al., 2010; Gosert et al., 2008, 2010; Johnsen et al., 1995). Less is known about the NCCR of the novel HPyV that circulate in the human population. So far, NCCR variants have been described for KIPyV, WUPyV, MCPyV, HPyV7, TSPyV, HPyV9, HPyV11, STLPyV and HPyV12 (Table S2). Most changes are point mutations, and a few insertions and deletion of several nucleotides have been reported. Large duplications or deletions as described for BKPyV and JCPyV have not been observed yet (Ho et al., 2015; Lednicky et al., 2014; Schowalter et al., 2010; our unpublished results). It is not known whether the NCCR of the newly discovered HPyVs is the most common one, nor has the impact of these mutations on viral transcription and replication been examined. In an effort to elucidate the effect of variation in the NCCR on promoter

We tested only one neural-derived cell line: neuroblastoma SK-N-BE cells. JCPyV is a neurotropic JCPyV, and BKPyV with archetypal NCCR has been found in CSF (Ba´rcenaPanero et al., 2012; Chen & Atwood, 2002). The BKPyV early and late promoters were among the strongest in SK-N-BE cells, whereas JCPyV had the weakest early promoter activity of all HPyV, while its late promoter had about half of the activity of BKPyV. The poor JCPyV promoter activity may be because we examined the archetypal CY promoter, which differs from the PML-type Mad-1 strain. The TSPyV promoters were among the strongest early and late promoters but so far this virus has not been found in CNS and CSF. NJPyV-2013, which has only been detected in muscle (Mishra et al., 2014), displayed relatively strong early, but weak late promoter activity in SK-N-BE cells. Brain or CNS may be worth investigating for the presence of NJPyV-2013. KIPyV, WUPyV and MCPyV DNA were not detected in 31 neuroblastoma biopsies (Giraud et al., 2009). The KIPyV and

Finally, liver carcinoma-derived BEL7402 cells supported best BKPyV and MCPyV early promoter activity, the HPyV10, KIPyV and WUPyV early promoters had intermediate relative activity, and the other HPyV early promoters were weak (v21 %) compared with BKPyV. All HPyV late promoters, except the ones of JCPyV, KIPyV and HPyV6 were relatively stronger than the BKPyV late promoter.



2297

Percentage activity

U. Moens and others

150

150

A375

150

A431

100

100

100

50

50

50

0

12E Δ12E

0

12L Δ12L

150

12E Δ12E

0

BEL7402

100

200

50

100

50

12E Δ12E 200

0

12L Δ12L

ns

12E Δ12E

150

HEK293

150

12L Δ12L

100

100

12E Δ12E

ns

12L Δ12L

SK-N-BE

80 60

50

50

40 20

0

100

0 120

HSC-3

100

120

12L Δ12L

HaCaT 100

0

12E Δ12E

150

300

A64

12L Δ12L

A549

0

12E Δ12E

12L Δ12L

0

12E Δ12E

12L Δ12L

SW480

80 60 EARLY

40 20 0

297 1

12E Δ12E

322

449 LATE

12L Δ12L

Fig. 2. The effect of a 26 bp deletion in the HPyV12 NCCR on early and late promoter activity. The activity of the WT promoter was arbitrarily set as 100 %. Each experiment was repeated two to three times and a representative result is shown. Each bar represents the mean of three independent parallels. ns, Not significant; *P,0.001; **P,0.0001.12E, HPyV12 early promoter; 12L, HPyV12 late promoter; D, deletion variant of HPyV12 promoter. The position of the deletion is shown in the bottom panel on the right. Numbers refer to the nucleotides in the NCCR. The deletion removes nt 297–322.

WUPyV promoters displayed relatively low activity, while the MCPyV late promoter was among the strongest of all HPyV in SK-N-BE cells. MCPyV, HPyV6, HPyV7, TSPyV, HPyV9, HPyV10 and STLPyV, but not the other HPyVs have been found in skin (Bellaud et al., 2014; Fischer et al., 2012; Giraud et al., 2008; Hampras et al., 2015; Ho et al., 2015; Imajoh et al., 2013; Pastrana et al., 2013a; Ramqvist et al., 2014; Sauvage et al., 2011; Schowalter et al., 2010; Schrama et al., 2014; Urbano et al., 2014; van der Meijden et al., 2010; Wanat et al., 2012; Wieland et al., 2014). BKPyV, which is not 2298

common in the skin (Moens et al., 2011), had in general higher early and late promoter activity than most of these viruses in skin-derived A375, A431 and HaCaT cells. The low promoter activity of the dermatropic MCPyV, HPyV6, HPyV7 and TSPyV may be because other skin cell types represent the genuine host cells or because differentiation of skin cells is required to trigger viral expression and replication (like in human papillomavirus infection). HPyV12 DNA has not been reported in skin so far, but its early and late promoter was the strongest of all HPyV in A375 cells, while its late promoter was the strongest in A431 cells and




HaCaT cells. Hence, a possible role of the skin as target organ for HPyV12 might be considered. We used three cell lines from tissues that are likely to be encountered during an oral/respiratory route of infection: lung adenocarcinoma A549 cells, submaxillary-glandderived cells (A64), and oral squamous carcinoma from the tongue (HSC-3 cells). KIPyV and WUPyV have been predominantly associated with sites of the respiratory tract (Babakir-Mina et al., 2013). In A549 and A64 cells, their early and late promoters were less active than BKPyV, but in HSC-3 the activity of their early promoters was higher than the BKPyV early promoter. Transfection of A549 cells with KIPyV DNA did not result in the production of infectious virus particles (our unpublished results). HPyV6 and HPyV7 DNA have been found in one nasopharyngeal aspirate sample of, respectively, a heart-transplant patient and a liver transplant patient (Siebrasse et al., 2012b). Relatively low HPyV6 and HPyV7 promoter activity was monitored in cell lines derived from the respiratory tract, suggesting that the respiratory tract may not be a genuine host tissue for these viruses. TSPyV DNA has also been detected in tonsillar biopsies (Sadeghi et al., 2014). Accordingly, the TSPyV early and late promoters were among the strongest of the HPyV in A64 and A549 cells. HPyV9 and HPyV10 are rarely detected in throat and nasal swabs (Csoma et al., 2012; Yu et al., 2012). HPyV9 promoter activity was relatively weak in A549, A64 and HSC-3 cells, while the HPyV10 late promoter had relatively high activity compared with the other HPyV promoters in A549 cells. These findings suggest that a possible association of HPyV10 with cells from the respiratory tract may exist, but further studies are required. A liver cancer cell line (BEL7402) and the colon cancer cells SW480 represented cell lines of the gastrointestinal tract. JCPyV has been associated with colon cancer and strains with CY-like NCCR have been isolated from colon cancer tissue (Lin et al., 2008; Ricciardiello et al., 2001). We found that in SW480 cells the JCPyV early promoter was very weak compared with the other HPyV promoters. Using chloramphenicol acetyltransferase as a reporter gene, the Mad-1 early and late promoter was shown to be active in SW480 cells, but no comparison with other HPyV was made, nor was the promoter activity of CY tested (Enam et al., 2006). MCPyV has been detected in healthy and malignant colon biopsies and TSPyV can be found in cells from the gastrointestinal tract (Campello et al., 2011; Tsuzuki et al., 2014). Strong early and late promoter activities of both viruses were measured in SW480 and BEL7402 cells. HPyV12 was originally isolated from metastatic liver tissue of colon cancer patients (Korup et al., 2013). The HPyV12 early promoter was among the strongest, while the late promoter was by far the strongest of all HPyV promoters in SW480 and BEL7402 cells. These observations may indicate that both colon and liver cells may be suitable cells for HPyV12 replication. Preliminary data from transfection of the HPyV12 genome in different http://vir.sgmjournals.org

cell lines indicate that on the mRNA level HPyV12 VP1 is better expressed in SW480 cells than in A375, A549 or HEK293 cells. Further studies on HPyV12 protein expression and particle formation in SW480 cells are needed. HPyV9 has not been described in faeces or colon, but its promoter activity was relatively high in SW480 cells, indicating that these cells may be suitable to propagate HPyV9. The tropism of HPyVs has predominantly been investigated using PCR-based methods to detect viral DNA in samples and (quantitative) analyses of viral gene expression are scarce. Schowalter et al. (2012) explored an alternative strategy to determine the cell tropism of BKPyV and MCPyV. They performed transductions with BKPyV and MCPyV pseudoviruses containing plasmids encoding GFP or luciferase in melanocytes, melanomas, keratinocytes and tumour cell lines derived from breast, blood, CNS, colon, kidney, lung, prostate and ovaries. The most BKPyV-transducible cells (viral titre w4|106) were the breast cancer T-47D cell line, several ovarian cancer cell lines, the non-small cell lung cancer cell lines NCI-H226 and A549, the colon cancer cells HCT-116 and SW-620, the CNS cancer cells SF-539 and SNB-75, and the renal cancer line RXF393. High MCPyV transducibility (viral titre w4|106) was achieved in A549 cells, melanoma cells MALME-3M, SK-MEL-2, SK-MEL-5, ovarian cancer NCI/ADR-RES cells, and the breast cancer cell line MDA-MB-468. The only cell line that was used both by us and by Schowalter et al. (2012) was A549. The HPyV promoter activities were among the strongest in these cells. Because of relatively strong promoter activity and high transducibility, A549 cells may be a suitable cell system to study HPyV. Colon cancer, melanoma and CNS cancer cells gave high transducibility for BKPyV or MCPyV. Similar cell lines tested by us were SW480, A375 and SK-N-BE, respectively. The HPyV promoter activities were among the highest in these cells. Whether these cells are permissive for productive HPyV replication remains to be tested. Rearrangements in the NCCR of the BKPyV and JCPyV have been shown to affect virus propagation in vitro (Ault, 1997; Broekema et al., 2010; Gosert et al., 2008, 2010; Johnsen et al., 1995). The NCCR structure in novel HPyV isolates has been studied less and the effect of mutations on viral gene expression and replication has not been investigated. We compared the activities of the promoter of HPyV12 and a naturally occurring variant containing a 26 bp deletion, and found that this deletion reduced early and late promoter activity in all cell lines, except in BEL7402 and HEK293 where the early promoter was stronger than the non-deletion variant. This 26 bp motif contains putative binding sites for the oestrogen, glucocorticoid, progesterone, androgen and retinoic acid receptors, and for AP1, AP3, c-Myb, E2F, non-histone protein 1, paired box 2, sex determining region Y protein, and upstream stimulatory factor 2b. Whether any of these factors actually bind to the 26 bp motif and the role of this sequence in viral replication remain to be established.


2299

U. Moens and others

While this study for the first time, to the best of our knowledge, compares the relative promoter activities of all known HPyVs in a large panel of cell lines, the method used has obvious limitations. The promoters were not in their authentic context and promoter activity was determined from a non-replicating reporter plasmid that was transfected and not from viral genomes that were released from virions after viral infection. Promoter activity was measured in the absence of other viral proteins (e.g. large T-antigen), which have been shown to modulate viral promoter activity. Another drawback is that the number of viral genome copies will increase during infection while in transient transfection studies the plasmids will not replicate. Moreover, the number of plasmid copies in a transfected cell may not reflect the number of viral genomes in an infected cell. Transcriptional activators or repressors that are present in limited concentrations will affect viral promoter activity, especially when the number of promoter copies is high. In an elegant study, Bethge et al. (2015) showed, by using a bidirectional reporter assay, that mutations in BKPyV NCCR resulted in a loss of function for late viral gene region expression, but a gain of function for early viral gene region expression. Although such bidirectional measurements are excluded with unidirectional reporter systems, our observation that the deletion in the late promoter region of HPyV12 decreased the late promoter but increased the early promoter activity in HEK293 and BEL7402 cells, indicates a similar mutational effect. Nevertheless, our study provides a basis for identifying suitable cell systems to propagate HPyV.

the early or late promoter. The luciferase reporter plasmids containing the early or late promoters of NCCRs from HPyV 10, STLPyV, HPyV12 and NJPyV-2013 were generated by GenScript. The complete NCCR was synthesized with cohesive HindIII sites at both ends and subsequently cloned in the HindIII site of pUC58. The NCCR was then cloned in either orientation in the corresponding HindIII site of pGL3-basic. The deletion mutants of the HPyV12 early and late promoter were generated by site-directed mutagenesis using the primer 59-GGACACGCGCACTTCCTGTTCCAACAACCAGCCCATAACCTC-39 and its complementary primer. All constructs were verified by sequencing. Transfections. Cells were seeded out in 12-well cell culture plates

and transfected the following day. Cells were approximately 70–85 % confluent at the day of transfection. Lipofectamine 2000 (Life Technologies) was used as transfection reagent. Cells were transfected with 0.5 mg plasmid DNA according to the manufacturer’s instructions. Medium was replaced after 4 h. Luciferase assays. Cells were lysed approximately 24 h post-trans-

fection in 100 ml Luciferase Assay Tropix Lysis solution with 0.5 mM DTT freshly added. Cells were scraped and transferred to Eppendorf tubes, followed by 3 min centrifugation at 12 000 g. Twenty microlitres supernatant was transferred to a 96-well microtitre plate and luciferase buffer (Promega) was added. Light units were measured in a luminometer (Labsystem, Luminoscan RT). The activity of the early (respectively late) BKPyV promoter was arbitrarily set as 100 and the activity of the promoters of the other HPyV was related to this. Each experiment was repeated two to four times with three independent parallels. Co-transfection with another reporter plasmid to normalize luciferase activity was not done because it is our experience that correcting for protein concentrations in each cell lysate or co-transfection with a b-galactosidase reporter plasmid had negligible effect on the results (Johannessen et al., 2003).

Statistical analysis. A t-test was employed to determine statistical

differences between the promoters of the different HPyVs.

METHODS Cell lines. The cell lines used in this study are summarized in Table 1.

All cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM; Sigma) with 10 % FBS (Life Technologies), except BEL-7402 which was grown in DMEM with low glucose (Sigma) and HSC-3 which was kept in 1 : 1 DMEM/F-12 medium (Life Technologies) supplemented with 50 mg ascorbic acid ml21 (Sigma-Aldrich), 0.4 mg hydrocortisone ml21 (Sigma-Aldrich) and 10 % FBS. Plasmids. The plasmids containing the complete genomes of MCPyV, HPyV6 and HPyV7 were purchased from Addgene. Plasmids containing KIPyV, WUPyV and TSPyV genome sequences were kindly provided by Drs Allander (Allander et al., 2007), Wang (Gaynor et al., 2007) and Feltkamp (van der Meijden et al., 2010), respectively. The luciferase reporter plasmids with the early or late promoter of the archetypal BKPyV WW strain has been described previously (Ba´rcena-Panero et al., 2012). Luciferase reporter plasmids with the promoters of JCPyV strain CY were a generous gift of Dr Sawa (Okada et al., 2000). The NCCRs of KIPyV, WUPyV, MCPyV, HPyV6, HPyV7, TSPyV and HPyV9 were amplified with specific primers using plasmids containing the complete genomes of these viruses as template. The primers had a restriction site for Mlu I at the 59 end and a restriction site for HindIII at their 39 end, or a HindIII site at the 59 end and a Mlu I motif at the 39 end. The PCR products were cloned in pCR2.1-TOPO vector (Life Technologies). PCR products were excised by Mlu I/HindIII digestion and cloned in the corresponding sites of pGL3-basic. Depending on the location of the HindIII and Mlu I sites, the NCCR was cloned in one or the opposite orientation generating luciferase-expressing plasmids under control of

2300

ACKNOWLEDGEMENTS The authors wish to thank Dr Hirofumi Sawa for the generous gift of the luciferase reporter plasmids with the early (respectively late) promoter of JCPyV strain CY, and Dr Tobias Allander, Dr David Wang and Dr Mariet Feltkamp for kindly providing plasmids containing the KIPyV, WUPyV and TSPyV genomes. This work was supported by the Blix Foundation (A20374) and the Aakre Foundation (A20309).

REFERENCES Allander, T., Andreasson, K., Gupta, S., Bjerkner, A., Bogdanovic, G., Persson, M. A., Dalianis, T., Ramqvist, T. & Andersson, B. (2007).

Identification of a third human polyomavirus. J Virol 81, 4130–4136. Ault, G. S. (1997). Activity of JC virus archetype and PML-type

regulatory regions in glial cells. J Gen Virol 78, 163–169. Babakir-Mina, M., Ciccozzi, M., Campitelli, L., Aquaro, S., Lo Coco, A., Perno, C. F. & Ciotti, M. (2009). Identification of the novel KI

polyomavirus in paranasal and lung tissues. J Med Virol 81, 558–561. Babakir-Mina, M., Ciccozzi, M., Perno, C. F. & Ciotti, M. (2013). The

human polyomaviruses KI and WU: virological background and clinical implications. APMIS 121, 746–754. Baez, C. F., Guimara˜es, M. A., Martins, R. A., Zalona, A. C., Cossatis, J. J., Zalis, M. G., Cavalcanti, S. M. & Varella, R. B. (2013). Detection of




Merkel cell polyomavirus in oral samples of renal transplant recipients without Merkel cell carcinoma. J Med Virol 85, 2016–2019. Ba´rcena-Panero, A., Echevarrıá, J. E., Van Ghelue, M., Fedele, G., Royuela, E., Gerits, N. & Moens, U. (2012). BK polyomavirus with

archetypal and rearranged non-coding control regions is present in cerebrospinal fluids from patients with neurological complications. J Gen Virol 93, 1780–1794. Barzon, L., Squarzon, L., Militello, V., Trevisan, M., Porzionato, A., Macchi, V., De Caro, R. & Palu`, G. (2009a). WU and KI

polyomaviruses in the brains of HIV-positive patients with and without progressive multifocal leukoencephalopathy. J Infect Dis 200, 1755–1758. Barzon, L., Squarzon, L., Pacenti, M., Scotton, P. G. & Palu`, G. (2009b). Detection of WU polyomavirus in cerebrospinal fluid

specimen from a patient with AIDS and suspected progressive multifocal leukoencephalopathy. J Infect Dis 200, 314–315. Bellaud, G., Gheit, T., Pugin, A., Pre´tet, J. L., Tommasino, M., Mougin, C. & Aubin, F. (2014). Prevalence of human polyomavirus DNA in

eyebrow hairs plucked from patients with psoriasis treated with TNF inhibitors. J Eur Acad Deramtol Venereol 29, 1019–1021. Bethge, T., Hachemi, H. A., Manzetti, J., Gosert, R., Schaffner, W. & Hirsch, H. H. (2015). Sp1 sites in the noncoding control region of

BK polyomavirus are key regulators of bidirectional viral early and late gene expression. J Virol 89, 3396–3411. Boothpur, R. & Brennan, D. C. (2010). Human polyoma viruses and

disease with emphasis on clinical BK and JC. J Clin Virol 47, 306–312. Broekema, N. M., Abend, J. R., Bennett, S. M., Butel, J. S., Vanchiere, J. A. & Imperiale, M. J. (2010). A system for the analysis of BKV non-

coding control regions: application to clinical isolates from an HIV/ AIDS patient. Virology 407, 368–373. Buck, C. B., Phan, G. Q., Raiji, M. T., Murphy, P. M., McDermott, D. H. & McBride, A. A. (2012). Complete genome sequence of a tenth

human polyomavirus. J Virol 86, 10887. Burger-Calderon, R., Madden, V., Hallett, R. A., Gingerich, A. D., Nickeleit, V. & Webster-Cyriaque, J. (2014). Replication of oral BK

Feng, H., Shuda, M., Chang, Y. & Moore, P. S. (2008). Clonal

integration of a polyomavirus in human Merkel cell carcinoma. Science 319, 1096–1100. Feng, H., Kwun, H. J., Liu, X., Gjoerup, O., Stolz, D. B., Chang, Y. & Moore, P. S. (2011). Cellular and viral factors regulating Merkel cell

polyomavirus replication. PLoS One 6, e22468. Ferenczy, M. W., Johnson, K. R., Marshall, L. J., Monaco, M. C. & Major, E. O. (2013). Differentiation of human fetal multipotential

neural progenitor cells to astrocytes reveals susceptibility factors for JC virus. J Virol 87, 6221–6231. Fischer, M. K., Kao, G. F., Nguyen, H. P., Drachenberg, C. B., Rady, P. L., Tyring, S. K. & Gaspari, A. A. (2012). Specific detection of

trichodysplasia spinulosa-associated polyomavirus DNA in skin and renal allograft tissues in a patient with trichodysplasia spinulosa. Arch Dermatol 148, 726–733. Gardner, S. D., Field, A. M., Coleman, D. V. & Hulme, B. (1971). New

human papovavirus (B.K.) isolated from urine after renal transplantation. Lancet 297, 1253–1257. Gaynor, A. M., Nissen, M. D., Whiley, D. M., Mackay, I. M., Lambert, S. B., Wu, G., Brennan, D. C., Storch, G. A., Sloots, T. P. & Wang, D. (2007). Identification of a novel polyomavirus from patients with

acute respiratory tract infections. PLoS Pathog 3, e64. Giraud, G., Ramqvist, T., Ragnarsson-Olding, B. & Dalianis, T. (2008). DNA from BK virus and JC virus and from KI, WU, and

MC polyomaviruses as well as from simian virus 40 is not detected in non-UV-light-associated primary malignant melanomas of mucous membranes. J Clin Microbiol 46, 3595–3598. Giraud, G., Ramqvist, T., Pastrana, D. V., Pavot, V., Lindau, C., Kogner, P., Orrego, A., Buck, C. B., Allander, T. & other authors (2009). DNA from KI, WU and Merkel cell polyomaviruses is not

detected in childhood central nervous system tumours or neuroblastomas. PLoS One 4, e8239. Gorrill, T. S. & Khalili, K. (2005). Cooperative interaction of p65 and

C/EBPb modulates transcription of BKV early promoter. Virology 335, 1–9.

virus in human salivary gland cells. J Virol 88, 559–573.

Gosert, R., Rinaldo, C. H., Funk, G. A., Egli, A., Ramos, E., Drachenberg, C. B. & Hirsch, H. H. (2008). Polyomavirus BK with

Campello, C., Comar, M., D’Agaro, P., Minicozzi, A., Rodella, L. & Poli, A. (2011). A molecular case-control study of the Merkel cell

polyomavirus in colon cancer. J Med Virol 83, 721–724.

rearranged noncoding control region emerge in vivo in renal transplant patients and increase viral replication and cytopathology. J Exp Med 205, 841–852.

Chen, B. J. & Atwood, W. J. (2002). Construction of a novel JCV/SV40

Gosert, R., Kardas, P., Major, E. O. & Hirsch, H. H. (2010). Rearranged

hybrid virus (JCSV) reveals a role for the JCV capsid in viral tropism. Virology 300, 282–290. Csoma, E., Sa´py, T., Me´sza´ros, B. & Gergely, L. (2012). Novel human

polyomaviruses in pregnancy: higher prevalence of BKPyV, but no WUPyV, KIPyV and HPyV9. J Clin Virol 55, 262–265. Csoma, E., Me´sza´ros, B., Asztalos, L. & Gergely, L. (2015). WU and

KI polyomaviruses in respiratory, blood and urine samples from renal transplant patients. J Clin Virol 64, 28–33. DeCaprio, J. A. & Garcea, R. L. (2013). A cornucopia of human

JC virus noncoding control regions found in progressive multifocal leukoencephalopathy patient samples increase virus early gene expression and replication rate. J Virol 84, 10448–10456. Hampras, S. S., Giuliano, A. R., Lin, H. Y., Fisher, K. J., Abrahamsen, M. E., McKay-Chopin, S., Gheit, T., Tommasino, M. & Rollison, D. E. (2015). Natural history of polyomaviruses in men: the HPV in men

(HIM) study. J Infect Dis 211, 1437–1446. Hirsch, H. H. & Steiger, J. (2003). Polyomavirus BK. Lancet Infect Dis

3, 611–623.

polyomaviruses. Nat Rev Microbiol 11, 264–276.

Ho, J., Jedrych, J. J., Feng, H., Natalie, A. A., Grandinetti, L., Mirvish, E., Crespo, M. M., Yadav, D., Fasanella, K. E. & other authors (2015).

Doerries, K. (2006). Human polyomavirus JC and BK persistent

infection. Adv Exp Med Biol 577, 102–116.

Human polyomavirus 7-associated pruritic rash and viremia in transplant recipients. J Infect Dis 211, 1560–1565.

Do¨rries, K., Sbiera, S., Drews, K., Arendt, G., Eggers, C. & Do¨rries, R. (2003). Association of human polyomavirus JC with peripheral blood

Husseiny, M. I., Anastasi, B., Singer, J. & Lacey, S. F. (2010). A

of immunoimpaired and healthy individuals. J Neurovirol 9 (Suppl. 1), 81–87.

comparative study of Merkel cell, BK and JC polyomavirus infections in renal transplant recipients and healthy subjects. J Clin Virol 49, 137–140.

Enam, S., Gan, D. D., White, M. K., Del Valle, L. & Khalili, K. (2006).

Imajoh, M., Hashida, Y., Nakajima, H., Sano, S. & Daibata, M. (2013).

Regulation of human neurotropic JCV in colon cancer cells. Anticancer Res 26, 833–841.

Prevalence and viral DNA loads of three novel human polyomaviruses in skin cancers from Japanese patients. J Dermatol 40, 657–660.



2301

U. Moens and others

Johannessen, M., Olsen, P. A., Johansen, B., Seternes, O. M. & Moens, U. (2003). Activation of the coactivator four-and-a-half-

Moens, U., Johannessen, M., Barceńa-Panero, A., Gerits, N. & Van Ghelue, M. (2010). Emerging polyomaviruses in the human

LIM-only protein FHL2 and the c-fos promoter through inhibition of protein phosphatase 2A. Biochem Pharmacol 65, 1317–1328.

Moens, U., Ludvigsen, M. & Van Ghelue, M. (2011). Human

Johnsen, J. I., Seternes, O. M., Johansen, T., Moens, U., Ma¨ntyja¨rvi, R. & Traavik, T. (1995). Subpopulations of non-coding control region

variants within a cell culture-passaged stock of BK virus: sequence comparisons and biological characteristics. J Gen Virol 76, 1571–1581. Jordan, J. A., Manley, K., Dugan, A. S., O’Hara, B. A. & Atwood, W. J. (2010). Transcriptional regulation of BK virus by nuclear factor of

activated T cells. J Virol 84, 1722–1730. Khan, Z. M., Liu, Y., Neu, U., Gilbert, M., Ehlers, B., Feizi, T. & Stehle, T. (2014). Crystallographic and glycan microarray analysis of human

polyomavirus 9 VP1 identifies N-glycolyl neuraminic acid as a receptor candidate. J Virol 88, 6100–6111.

population. Rev Infect 1, 59–93.

polyomaviruses in skin diseases. Pathol Res Int 2011, 123491.

Neu, U., Allen, S. A., Blaum, B. S., Liu, Y., Frank, M., Palma, A. S., Stro¨h, L. J., Feizi, T., Peters, T. & other authors (2013). A

structure-guided mutation in the major capsid protein retargets BK polyomavirus. PLoS Pathog 9, e1003688. Newman, J. T. & Frisque, R. J. (1997). Detection of archetype and

rearranged variants of JC virus in multiple tissues from a pediatric PML patient. J Med Virol 52, 243–252. O’Hara, S. D., Stehle, T. & Garcea, R. (2014). Glycan receptors of the

Polyomaviridae: structure, function, and pathogenesis. Curr Opin Virol 7, 73–78.

Korup, S., Rietscher, J., Calvignac-Spencer, S., Trusch, F., Hofmann, J., Moens, U., Sauer, I., Voigt, S., Schmuck, R. & Ehlers, B. (2013).

Okada, Y., Sawa, H., Tanaka, S., Takada, A., Suzuki, S., Hasegawa, H., Umemura, T., Fujisawa, J., Tanaka, Y. & other authors (2000).

Identification of a novel human polyomavirus in organs of the gastrointestinal tract. PLoS One 8, e58021.

Transcriptional activation of JC virus by human T-lymphotropic virus type I Tax protein in human neuronal cell lines. J Biol Chem 275, 17016–17023.

Lednicky, J. A., Butel, J. S., Luetke, M. C. & Loeb, J. C. (2014).

Complete genomic sequence of a new Human polyomavirus 9 strain with an altered noncoding control region. Virus Genes 49, 490–492.

Padgett, B. L., Zurhein, G. M., Walker, D. L., Eckroade, R. J. & Dessel, B. H. (1971). Cultivation of papova-like virus from human brain with

Liang, B., Tikhanovich, I., Nasheuer, H. P. & Folk, W. R. (2012).

Pastrana, D. V., Fitzgerald, P. C., Phan, G. Q., Raiji, M. T., Murphy, P. M., McDermott, D. H., Velez, D., Bliskovsky, V., McBride, A. A. & Buck, C. B. (2013a). A divergent variant of the eleventh human

Stimulation of BK virus DNA replication by NFI family transcription factors. J Virol 86, 3264–3275. Lim, E. S., Reyes, A., Antonio, M., Saha, D., Ikumapayi, U. N., Adeyemi, M., Stine, O. C., Skelton, R., Brennan, D. C. & other authors (2013). Discovery of STL polyomavirus, a polyomavirus of

ancestral recombinant origin that encodes a unique T antigen by alternative splicing. Virology 436, 295–303. Lin, P. Y., Fung, C. Y., Chang, F. P., Huang, W. S., Chen, W. C., Wang, J. Y. & Chang, D. (2008). Prevalence and genotype identification of

human JC virus in colon cancer in Taiwan. J Med Virol 80, 1828–1834. Marshall, L. J., Moore, L. D., Mirsky, M. M. & Major, E. O. (2012). JC

virus promoter/enhancers contain TATA box-associated Spi-Bbinding sites that support early viral gene expression in primary astrocytes. J Gen Virol 93, 651–661. Mertz, K. D., Junt, T., Schmid, M., Pfaltz, M. & Kempf, W. (2010).

Inflammatory monocytes are a reservoir for polyomavirus. J Invest Dermatol 130, 1146–1151.

Merkel

cell

Mertz, K. D., Paasinen, A., Arnold, A., Baumann, M., Offner, F., Willi, N. & Cathomas, G. (2013). Merkel cell polyomavirus large T antigen is

detected in rare cases of nonmelanoma skin cancer. J Cutan Pathol 40, 543–549.

Mishra, N., Pereira, M., Rhodes, R. H., An, P., Pipas, J. M., Jain, K., Kapoor, A., Briese, T., Faust, P. L. & Lipkin, W. I. (2014).

Identification of a novel polyomavirus in a pancreatic transplant recipient with retinal blindness and vasculitic myopathy. J Infect Dis 210, 1595–1599. Moens, U. & Van Ghelue, M. (2005). Polymorphism in the genome of

non-passaged human polyomavirus BK: implications for cell tropism and the pathological role of the virus. Virology 331, 209–231. Moens, U. & Van Ghelue, M. (2011). Merkel cell polyomavirus:

progressive multifocal leucoencephalopathy. Lancet 297, 1257–1260.

polyomavirus species, Saint Louis polyomavirus. Genome Announc 1, e00812-13. Pastrana, D. V., Ray, U., Magaldi, T. G., Schowalter, R. M., Çuburu, N. & Buck, C. B. (2013b). BK polyomavirus genotypes represent distinct

serotypes with distinct entry tropism. J Virol 87, 10105–10113.

Ramqvist, T., Nordfors, C., Dalianis, T. & Ragnarsson-Olding, B. (2014). DNA from human polyomaviruses, TSPyV, MWPyV,

HPyV6, 7 and 9 was not detected in primary mucosal melanomas. Anticancer Res 34, 639–643. Ravichandran, V. & Major, E. O. (2006). Viral proteomics: a promising

approach for understanding JC virus tropism. Proteomics 6, 5628–5636. Rekvig, O. P. & Moens, U. (2002). Polyomavirus BK and

autoimmunity to nucleosomes. Graft 5, S36–S45.

Rennspiess, D., Pujari, S., Keijzers, M., Abdul-Hamid, M. A., Hochstenbag, M., Dingemans, A. M., Kurz, A. K., Speel, E. J., Haugg, A. & other authors (2015). Detection of human

polyomavirus 7 in human thymic epithelial tumors. J Thorac Oncol 10, 360–366. Ricciardiello, L., Chang, D. K., Laghi, L., Goel, A., Chang, C. L. & Boland, C. R. (2001). Mad-1 is the exclusive JC virus strain present

in the human colon, and its transcriptional control region has a deleted 98-base-pair sequence in colon cancer tissues. J Virol 75, 1996–2001. Rockett, R. J., Sloots, T. P., Bowes, S., O’Neill, N., Ye, S., Robson, J., Whiley, D. M., Lambert, S. B., Wang, D. & other authors (2013).

Detection of novel polyomaviruses, TSPyV, HPyV6, HPyV7, HPyV9 and MWPyV in feces, urine, blood, respiratory swabs and cerebrospinal fluid. PLoS One 8, e62764.

a causal factor in Merkel cell carcinoma. In Skin Cancers. Risk Factors, Prevention and Therapy, pp. 109–142. Edited by C. A. M. La Porta. Croatia: InTech.

Romagnoli, L., Wollebo, H. S., Deshmane, S. L., Mukerjee, R., Del Valle, L., Safak, M., Khalili, K. & White, M. K. (2009). Modulation of

Moens, U., Johansen, T., Johnsen, J. I., Seternes, O. M. & Traavik, T. (1995). Noncoding control region of naturally occurring BK virus

Sadeghi, M., Aaltonen, L. M., Hedman, L., Chen, T., So¨derlundVenermo, M. & Hedman, K. (2014). Detection of TS polyomavirus

variants: sequence comparison and functional analysis. Virus Genes 10, 261–275.

DNA in tonsillar tissues of children and adults: evidence for site of viral latency. J Clin Virol 59, 55–58.

2302

JC virus transcription by C/EBPb. Virus Res 146, 97–106.




Safak, M. & Khalili, K. (2001). Physical and functional interaction between viral and cellular proteins modulate JCV gene transcription. J Neurovirol 7, 288–292. Sauvage, V., Foulongne, V., Cheval, J., Ar Gouilh, M., Pariente, K., Dereure, O., Manuguerra, J. C., Richardson, J., M. & other authors (2011). Human polyomavirus related to African green monkey

lymphotropic polyomavirus. Emerg Infect Dis 17, 1364–1370. Schowalter, R. M., Pastrana, D. V., Pumphrey, K. A., Moyer, A. L. & Buck, C. B. (2010). Merkel cell polyomavirus and two previously

unknown polyomaviruses are chronically shed from human skin. Cell Host Microbe 7, 509–515. Schowalter, R. M., Reinhold, W. C. & Buck, C. B. (2012). Entry

tropism of BK and Merkel cell polyomaviruses in cell culture. PLoS One 7, e42181. Schrama, D., Groesser, L., Ugurel, S., Hafner, C., Pastrana, D. V., Buck, C. B., Cerroni, L., Theiler, A. & Becker, J. C. (2014). Presence

of human polyomavirus 6 in mutation-specific BRAF inhibitorinduced epithelial proliferations. JAMA Dermatol 150, 1180–1186. Scuda, N., Hofmann, J., Calvignac-Spencer, S., Ruprecht, K., Liman, P., Ku¨hn, J., Hengel, H. & Ehlers, B. (2011). A novel human

polyomavirus closely related to the African green monkey-derived lymphotropic polyomavirus. J Virol 85, 4586–4590.

Sundsfjord, A., Johansen, T., Flaegstad, T., Moens, U., Villand, P., Subramani, S. & Traavik, T. (1990). At least two types of control

regions can be found among naturally occurring BK virus strains. J Virol 64, 3864–3871. Tan, C. S. & Koralnik, I. J. (2010). Progressive multifocal

leukoencephalopathy and other disorders caused by JC virus: clinical features and pathogenesis. Lancet Neurol 9, 425–437. Tsuzuki, S., Fukumoto, H., Mine, S., Sato, N., Mochizuki, M., Hasegawa, H., Sekizuka, T., Kuroda, M., Matsushita, T. & Katano, H. (2014). Detection of trichodysplasia spinulosa-associated

polyomavirus in a fatal case of myocarditis in a seven-month-old girl. Int J Clin Exp Pathol 7, 5308–5312. Urbano, P. R., Pannuti, C. S., Pierrotti, L. C., David-Neto, E. & Romano, C. M. (2014). Rapid detection of trichodysplasia-associated

polyomavirus in skin biopsy specimen. Genome Announc 2, e0069414.

van der Meijden, E., Janssens, R. W., Lauber, C., Bouwes Bavinck, J. N., Gorbalenya, A. E. & Feltkamp, M. C. (2010). Discovery of a

new human polyomavirus associated with trichodysplasia spinulosa in an immunocompromized patient. PLoS Pathog 6, e1001024. van der Meijden, E., Wunderink, H. F., van der Blij-de Brouwer, C. S., Zaaijer, H. L., Rotmans, J. I., Bavinck, J. N. & Feltkamp, M. C. (2014).

Sharp, C. P., Norja, P., Anthony, I., Bell, J. E. & Simmonds, P. (2009).

Human polyomavirus 9 infection in kidney transplant patients. Emerg Infect Dis 20, 991–999.

Reactivation and mutation of newly discovered WU, KI, and Merkel cell carcinoma polyomaviruses in immunosuppressed individuals. J Infect Dis 199, 398–404.

Wanat, K. A., Holler, P. D., Dentchev, T., Simbiri, K., Robertson, E., Seykora, J. T. & Rosenbach, M. (2012). Viral-associated

trichodysplasia: characterization of a novel polyomavirus infection with therapeutic insights. Arch Dermatol 148, 219–223.

Siebrasse, E. A., Reyes, A., Lim, E. S., Zhao, G., Mkakosya, R. S., Manary, M. J., Gordon, J. I. & Wang, D. (2012a). Identification of

Wang, X., Li, J., Schowalter, R. M., Jiao, J., Buck, C. B. & You, J. (2012).

MW polyomavirus, a novel polyomavirus in human stool. J Virol 86, 10321–10326.

Bromodomain protein Brd4 plays a key role in Merkel cell polyomavirus DNA replication. PLoS Pathog 8, e1003021.

Siebrasse, E. A., Bauer, I., Holtz, L. R., Le, B. M., Lassa-Claxton, S., Canter, C., Hmiel, P., Shenoy, S., Sweet, S. & other authors (2012b). Human polyomaviruses in children undergoing

White, M. K., Kaminski, R., Khalili, K. & Wollebo, H. S. (2014). Rad51

transplantation, United States, 2008–2010. Emerg Infect Dis 18, 1676–1679. Siebrasse, E. A., Nguyen, N. L., Smith, C., Simmonds, P. & Wang, D. (2014). Immunohistochemical detection of KI polyomavirus in lung

and spleen. Virology 468–470, 178–184. Signorini, L., Belingheri, M., Ambrogi, F., Pagani, E., Binda, S., Ticozzi, R., Ferraresso, M., Ghio, L., Giacon, B. & other authors (2014). High frequency of Merkel cell polyomavirus DNA in the

urine of kidney transplant recipients and healthy controls. J Clin Virol 61, 565–570. Stro¨h, L. J., Neu, U., Blaum, B. S., Buch, M. H., Garcea, R. L. & Stehle, T. (2014). Structure analysis of the major capsid proteins of human

polyomaviruses 6 and 7 reveals an obstructed sialic acid binding site. J Virol 88, 10831–10839.


activates polyomavirus JC early transcription. PLoS One 9, e110122.

Wieland, U., Silling, S., Hellmich, M., Potthoff, A., Pfister, H. & Kreuter, A. (2014). Human polyomaviruses 6, 7, 9, 10 and

Trichodysplasia spinulosa-associated polyomavirus in HIV-infected men. J Gen Virol 95, 928–932. Wollebo, H. S., Melis, S., Khalili, K., Safak, M. & White, M. K. (2012).

Cooperative roles of NF-kB and NFAT4 in polyomavirus JC regulation at the KB control element. Virology 432, 146–154. Yogo, Y. & Sugimoto, C. (2001). The archetype concept and

regulatory region rearrangement. In Human Polyomaviruses. Molecular and Clinical Perspectives, pp. 127–148. Edited by K. Khalili & G. L. Stoner. New York: Wiley. Yu, G., Greninger, A. L., Isa, P., Phan, T. G., Martıńez, M. A., de la Luz Sanchez, M., Contreras, J. F., Santos-Preciado, J. I., Parsonnet, J. & other authors (2012). Discovery of a novel polyomavirus in acute

diarrheal samples from children. PLoS One 7, e49449.


2303