Effect of the Earthworms Lumbricus terrestris and ... - Springer Link

Microb Ecol (2010) 59:574–587 DOI 10.1007/s00248-009-9604-y

SOIL MICROBIOLOGY

Effect of the Earthworms Lumbricus terrestris and Aporrectodea caliginosa on Bacterial Diversity in Soil Taras Y. Nechitaylo & Michail M. Yakimov & Miguel Godinho & Kenneth N. Timmis & Elena Belogolova & Boris A. Byzov & Alexander V. Kurakov & David L. Jones & Peter N. Golyshin

Received: 9 July 2009 / Accepted: 9 October 2009 / Published online: 4 November 2009 # Springer Science + Business Media, LLC 2009

Abstract Earthworms ingest large amounts of soil and have the potential to radically alter the biomass, activity, and structure of the soil microbial community. In this study, the diversity of eight bacterial groups from fresh soil, gut, and casts of the earthworms Lumbricus terrestris and Aporrectodea caliginosa were studied by single-strand conformation polymorphism (SSCP) analysis using both newly designed 16S rRNA genespecific primer sets targeting Alphaproteobacteria, Betaproteobacteria, Gammaproteobacteria, Deltaproteobacteria, Bacteroidetes, Verrucomicrobia, Planctomycetes, and Firmicutes and a conventional universal primer set for SSCP, with RNA and DNA as templates. In parallel, the study of the relative abundance of these taxonomic groups in the same samples was performed using fluorescence in situ hybridization. Bacteroidetes, Alphaproteobacteria, and Betaproteobac-

teria were predominant in communities from the soil and worm cast samples. Representatives of classes Flavobacteria and Sphingobacteria (Bacteroidetes) and Pseudomonas spp. (low-abundant Gammaproteobacteria) were detected in soil and worm cast samples with conventional and taxontargeting SSCP and through the sequence analysis of 16S rRNA clone libraries. Physiologically active unclassified Sphingomonadaceae (Alphaproteobacteria) and Alcaligenes spp. (Betaproteobacteria) also maintained their diversities during transit through the earthworm intestine and were found on taxon-targeting SSCP profiles from the soil and worm cast samples. In conclusion, our results suggest that some specific bacterial taxonomic groups maintain their diversity and even increase their relative numbers during transit through the gastrointestinal tract of earthworms.

Electronic supplementary material The online version of this article (doi:10.1007/s00248-009-9604-y) contains supplementary material, which is available to authorized users. T. Y. Nechitaylo (*) : M. Godinho : K. N. Timmis : E. Belogolova : P. N. Golyshin Environmental Microbiology Laboratory, Helmholtz Center for Infection Research, Inhoffenstr. 7, 38124 Braunschweig, Germany e-mail: [email protected] M. M. Yakimov Istituto per L’Ambiente Marino Costiero, IAMC-CNR, Sezione di Messina, 98122 Messina, Italy B. A. Byzov : A. V. Kurakov Department of Soil Biology, Faculty of Soil Science, Moscow State Lomonosov University, 119899 Moscow, Russia

K. N. Timmis Institute of Microbiology, Biozentrum, Technical University of Braunschweig, 38106 Braunschweig, Germany

D. L. Jones School of the Environment and Natural Resources, Bangor University, Bangor, LL57 2UW Gwynedd, UK

P. N. Golyshin School of Biological Sciences, Bangor University, Bangor, LL57 2UW Gwynedd, UK

Effect of Earthworms on Diversity of Soil Bacteria

Introduction Earthworms of the family Lumbricidae are ubiquitous inhabitants of terrestrial ecosystems, with the majority of species found in the Holarctic: from Canada and the USA through to Eurasia and Japan [44]. Earthworms can process an enormous amount of soil through their digestive tract, the environment of which represents a unique ecological niche characterized by relatively stable conditions and which contrasts strongly with the surrounding soil (e.g., lower O2, higher water content, elevated concentrations of both inorganic and organic nutrients, and a permanent mechanical and chemical influence of the host [9, 10, 17, 24, 28, 49]). The impact of the earthworm gut on the global cycling of elements has attracted considerable scientific interest in recent years, particularly in relation to the emissions of nitrous oxide [25–30, 39] and methane [23]. A number of studies have been conducted using both culture-dependent and culture-independent molecular methods to address the following questions: (1) are there any autochthonous microorganisms present in the gut, and (2) how do microbial communities of the soil change their density and diversity during transit through the gut? Symbiotic bacteria of the phylum Tenericutes have been detected in earthworm tissues including the intestine [42, 53]; however, there is no definitive evidence of their association with the lumen of the gastrointestinal (GI) tract of the host. Studies from a diverse range of soils have shown that the bacterial community present in the ingested material strongly influences the microbial community that subsequently develops in the earthworm gut [17]. However, there is no consensus on how soil microbial autochthonous populations are affected by environmental constraints in the GI tract. For example, actinomycetes and Gammaproteobacteria were suggested to increase or to maintain their numbers in the gut and casts in comparison to the surrounding soil [15, 21, 32, 45, 56]. Furthermore, a number of molecular studies have shown a higher abundance of Gammaproteobacteria, Deltaproteobacteria, and Bacteroidetes in the earthworm intestine, as compared to the surrounding soil [21, 51]. Acidobacteria, Firmicutes, and Betaproteobacteria appear to possess intestine-specific phylotypes, whose presence depended on the date of sampling [53]. In contrast, Egert and coworkers [19] could not identify any specific earthworm-intestineassociated microorganisms. Among those bacteria negatively affected in the worm intestine, Schönholzer and colleagues [51] demonstrated that Alphaproteobacteria, Betaproteobacteria, and Gammaproteobacteria declined in the GI tract of Lumbricus terrestris relative to the soil. While a reduction in species abundance could simply be due to enhanced competition in the GI tract, it also appears that certain species of proteobacteria, bacilli, and actinobacteria are susceptible to the digestive fluids of Aporrectodea caliginosa

575

[31]. Thus, a number of rather conflicting views have arisen, most likely due to the wide range of experimental conditions used in the various studies alongside the different microbiological approaches used for quantification. In the present work, we performed an analysis of bacterial communities from a soddy-podzolic soil and from fresh casts of two earthworm species, L. terrestris and A. caliginosa, collected at the same sampling site and earlier assessed by a culturing approach [12, 31]. The main aim was to identify individual bacterial community components that maintain their relative diversities within the earthworm GI tract. The study was conducted by combining three independent molecular methods, the principal of which involved a taxon-targeting single-strand conformation polymorphism (TT-SSCP) fingerprinting approach, which allowed a fast comparative small subunit (SSU) RNA-based analysis of the taxonomic composition of bacterial communities.

Materials and Methods Sampling and General Experimental Design Soddy-podzolic soil (spodosol) and earthworms (L. terrestris and A. caliginosa) were collected at the Ecological Soil Station of Lomonosov Moscow State University (Moscow Region, Russia). Samples were collected in three campaigns: (1) in autumn 2003, five and six individuals of L. terrestris and A. caliginosa, respectively; (2) in spring 2004, A. caliginosa only (ten individuals); and (3) in spring 2005, 40 and 50 individuals of L. terrestris and A. caliginosa, respectively. Earthworm species from sampling campaigns 1 and 2 were kept together in plastic containers while those collected during sampling campaign 3 were maintained separately. The soil in the containers was exchanged every 2 weeks. Earthworms were kept in a relatively small volume of soil (approximately 100–250 cm3 per individual) at 15°C for 2 weeks (groups 1 and 2) and for >3 months (group 3) prior to analysis. Sterile (autoclaved) leaf litter was used to feed the animals. Clone libraries of 16S rRNA gene fragments were constructed via reverse transcription from total RNA extracted from soil, earthworm gut, and cast samples of the earthworms obtained in years 2003 and 2004. SSCP analysis of 16S rRNA and rRNA genes was done from the total RNA and DNA extracted from samples of soil and earthworm casts collected in 2005. The same samples were analyzed with fluorescence in situ hybridization (FISH). Sampling of Earthworm Gut Contents, Casts, and Soil Freshly excreted casts were collected every 20 min over a period of 6 h while the animals were maintained on a wet

576

T. Y. Nechitaylo et al.

sterile Whatman 3MM paper (Schleicher & Schuell BioScience GmbH) in Petri dishes at 15°C. Soil samples were collected from containers at the same time. In total, six sampling rounds were carried out, each at intervals of 2–4 days. The gut content of earthworms was collected as follows: the middle parts (approximately 1 cm) of all earthworms collected during campaigns 1 and 2 were excised, and the gut contents were flushed out with icecold phosphate-buffered saline (PBS) solution (137 mM NaCl; 2.7 mM KCl; 10 mM Na2HPO4; 2 mM KH2PO4) using a syringe and subsequently concentrated by centrifugation at 10,000×g. Immediately after collection, samples for each earthworm type were mixed thoroughly and either resuspended in a 4% paraformaldehyde solution for FISH analysis or placed in resuspension buffer supplemented with a FastDNA® and FastRNA® Spin Kit for soil (Qbiogen, Germany).

Invitrogen) with subsequent transformation into electrocompetent Escherichia coli TOP10 cells (Invitrogen). After blue/white screening, randomly picked colonies were resuspended in PCR lysis solution A without proteinase K (67 mM Tris–Cl (pH 8.8); 16 mM NH4SO4; 5 µM βmercaptoethanol; 6.7 mM MgCl2; 6.7 µM EDTA (pH 8.0)) [49] and heated at 95°C for 5 min. The lysate (approximately 0.2 ng DNA) was used as the template for PCR amplification with primers M13F (5′-GACGTTGTAAAACGACGGC CAG-3′) and M13R (5′-GAGGAAACAGCTATGAC CATG-3′). PCR products were purified with a MinElute 96 UF PCR Purification Kit (Qiagen) and sequenced using reverse primer R1492 according to the protocol for BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems Inc., USA).

Total RNA/DNA Isolation, Reverse Transcription, and PCR

Taxon-targeting SSCP primers of 18–25 bp in length were designed using PRIMEROSE software [4] to span taxonconserved regions situated 300–500 bp apart (Table 1) in target sequences from the clone libraries and in bacterial sequences available in GenBank [7]. The specificity of the designed primers was checked using PRIMEROSE software [4] against clones from libraries and with the PROBE MATCH function within the Ribosomal Database Project (RDP) database (http://rdp.cme.msu.edu) [13]. Pure bacterial cultures of Sphingopyxis witflariensis (FM199944; Alphaproteobacteria), Alcaligenes faecalis (FM199945; Betaproteobacteria), Pseudomonas putida KT2440 (NC002947; Gammaproteobacteria), Chryseobacterium soldanellicola (FM199946; Bacteroidetes), Bacillus licheniformis (FM199947; Firmicutes), and Oerskovia enterophila (FM199948; Actinobacteria) and 16S recombinant RNA clones of Verrucomicrobia, Planctomycetes, and Deltaproteobacteria were used to determine the specificity of the primers for annealing using temperature gradient PCR in an Eppendorf 5341 thermocycler (Eppendorf, Germany). Reactions were performed in a final volume of 20 µl using recombinant Taq DNA Polymerase (Qiagen) and original reagents. Reaction mixtures were subjected to the following thermal cycling parameters: 30 cycles of denaturation at 96°C for 1 min, annealing with temperature gradient (45–65°C) for 1 min, and extension at 72°C for 1 min, followed by a final extension at 72°C for 7 min. The quality of PCR products was verified through 2% agarose gel electrophoresis. Bacterial species from an out-group were used as a negative control for each primer set.

Total RNA was extracted with a FastRNA® Spin Kit for soil (Qbiogen) from soil, fresh excrements (approximately 1 g wet weight), and from gut content samples obtained from the worms from campaigns 1 and 2. Total DNA and RNA were extracted using FastDNA® and FastRNA® Spin Kits for soil (Qbiogen) from soil and cast samples (approximately 2-g wet weight) obtained from the worms during sampling campaign 3. Each type of nucleic acid extracted from the same sample (soil, gut content, or casts) was combined and processed together. RNA samples (approximately 1 µg each) were treated with DNase I (Invitrogen, Germany) according to the manufacturer’s protocol and subjected to reverse transcription with Super Script® First Strand Synthesis System for reverse transcription polymerase chain reaction (RT-PCR; Invitrogen), using universal primers for 16S rRNA genes R1492 (5′-CGGY TACCTTGTTACGACTT-3′) and R1087 (5′-CTCGTTGC GGCACTTAACCC). Constructing the 16S rRNA Clone Libraries and Sequence Analysis A serial dilution of single-stranded DNA obtained via reverse transcription with the standard primer R1492 was performed before the following PCR amplification set up using the 16S rRNA gene-specific primers F530 (5′TCCGTGCCAGCAGCCGCGG-3′) and R1492, recombinant Taq DNA Polymerase (Invitrogen), and original reagents according to the basic PCR protocol with an annealing temperature of 45°C for 30 cycles. PCR products were purified via gel electrophoresis using a QIAEX II Gel Extraction Kit (Qiagen, Germany) and were ligated into the plasmid vector pCRII-TOPO (TOPO TA® Cloning kit;

Design of Taxon-Targeting SSCP Primers

SSCP Procedures Amplification of the single-stranded DNA, obtained from RNA samples as described above, and 16S rRNA genes


577

Table 1 Characteristics of universal and new taxon-targeting primers applied for SSCP analysis of 16S rRNA genes Target group

Primer name

Sequence (5′–3′)

Alphaproteobacteria

Alf F805pb Alf R1234 Bet F750 Bet R1227p Gam F538 Gam R1041p Del F972p Del R1434 Cfb F522 Cfb R939p Bcl F348 Bcl R833p Ver F901p Ver R1209 Pla F949p Pla R1408 Com1 Com2-Ph

CCACGCCGTAAACKATGA CSYGTAAGGGCCATGAGG GACGCTCAKGCACGAAAGCGT TGACGTGTGWAGCCCCACCYA RAGGGTGCAAGCGTTAAT YNNNGTTCCCGAAGGC CGCAGAACCTTACCTGGK GACTTCTGGAGCAAYYG TYAYTGGGTTTAAAGGGT TAAGGTTCCTCGCGTAXCA CAGCAGTAGGGAATCTTC CTAACACYTAGCAYTCAT AGCGGTGGAGTATGTGGC GCATTGTAGTACGTGTGC CCNCNCTTTSGTGGCT GCGMARAACCTTATCC CAGCAGCCGCGGTAATAC CCGTCAATTCCTTTGAGTTT

Betaproteobacteria Gammaproteobacteria Deltaproteobacteriac Bacteroidetes Firmicutes Verrucomicrobiac Planctomycetesc Bacteria

Position in 16S rRNA gene of E. coli

Annealing (°C)

Fragmenta (bp)

805–822 1200–1217 752–772 1179–1199 538–555 1026–1041 972–989 1317–1333 561–578 965–983 352–369 1462–1479 938–955 1225–1242 759–774 1105–1120 519–536 907–926

50

410

45

477

50

503

48

462

50

417

50

485

48

309

48

459

50

407

Reference

This This This This This This This This This This This This This This This This [34] [34]

study study study study study study study study study study study study study study study study

a

PCR product length expected for following representatives of the taxonomic group: B. diminuta X87274 (Alphaproteobacteria), A. faecalis AF155147 (Betaproteobacteria), E. coli NC004431 (Gammaproteobacteria), M. fulvus AJ233917 (Deltaproteobacteria), F. johnsoniae AB078043 (Bacteroidetes), B. subtilis AY030331 (Bacilli), V. spinosum X90515 (Verrucomicrobia), P. limnophilus X62911 (Planctomycetes), E. coli NC004431 (Bacteria)

b

“p” indicates the phosphate group at the 5′ terminus

c

Forty cycles of amplification were applied with these primer sets

from total DNA was performed with serial dilutions of template using universal 16S rRNA gene-specific bacterial primers Com1 (5′-CAGCAGCCGCGGTAATAC-3′) and Com2-Ph (5′-CCGTCAATTCCTTTGAGTTT-3′) [34] and also with newly designed taxon-targeting primers at annealing temperatures shown in Table 1. Amplification was performed for 30 cycles for the nonspecific and majority of the taxon-targeting primer sets; 40 cycles were applied for amplification using the Deltaproteobacteria-, Planctomycetes-, and Verrucomicrobia-targeting primer sets. Amplicons were purified with QiaQuik PCR Purification Kit (Qiagen) and treated with λ-exonuclease (Fermentas, Germany). Consequent SSCP analysis was performed as previously described [52] on 21-cm-long 0.6×MDE gels (Cambrex, Germany). Resolution of amplicons on the SSCP gels depends on the size and G + C content of singlestranded DNA fragments, and thus markers were used to control running and silver-staining conditions. The electrophoresis was performed in a Pharmacia Multiphor II apparatus (Pharmacia, Germany) at 400 V for 14 h at 20°C. Gels were silver-stained [6] and dried at room temperature. Fingerprinting of each sample was performed at least twice. Single bands were cut out with disposable

blades. Gel slices were transferred to 96-well microtiter plate containing 20 µl of Taq polymerase buffer (10 mM Tris–base; 50 mM KCl; 1.5 mM MgCl2 ×6H2O; 0.1% Triton ×100 (pH 9.0)) and heated at 95°C for 10 min. Reamplification with corresponding primers was done under the conditions described above, with 0.1 ng DNA as a template. PCR products were purified with a MinElute 96 UF PCR Purification Kit (Qiagen) and sequenced with corresponding taxon-targeting primers according to the protocol for BigDye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems). In case the sequencing result was unclear, the PCR product was cloned with the TOPO TA Cloning Kit and sequenced using M13 primer as described above. Chimera Checking, Library Comparison, and Phylogenetic Analysis Sequences with identity below 95% to those of bacterial species with known published names were analyzed with the Chimera Detection function (http://rdp8.cme.msu.edu/ cgis/chimera.cgi?su=SSU) available at the Ribosomal Database Project II URL [14] and with MALLARD

578

software [3]; clonal composition in corresponding 16S rRNA libraries was compared using the LIBCOMPARE tool (http://rdp.cme.msu.edu/comparison/comp.jsp) [13]. Sequences considered to be possible chimeras were excluded from the analysis. Gene fragments were scored against GenBank using the BLAST alignment software [1]. The closest hits and sequences of clones and SSCP bands were then subjected to phylogenetic analysis, which was performed with Kimura’s two-parameter algorithm for neighbor-joining treeing method using software MEGA version 4.0 [54]. Bacterial clone sequences used for phylogenetic analysis were deposited to the European Molecular Biology Laboratory/GenBank/DNA Databank of Japan with accession numbers AM266589×AM266808; sequences from SSCP band have the accession numbers AM989554–AM989923. Fluorescence In Situ Hybridization Procedure Samples of soil and fresh casts (approximately 3-g wet weight) from sampling campaign 3 were fixed overnight at 4°C in 10 ml of freshly prepared 4% paraformaldehyde/ PBS solution. Samples were then homogenized by vortexing for 5 min and were centrifuged at 200 g for 1 min. Microbial cells were collected from the supernatant fluids via a Nycodenz® gradient centrifugation, as described previously [8]. Cells were washed twice with PBS, dehydrated in serial ethanol dilutions, air-dried, and hybridized with Cy3-labeled oligonucleotide probes EUB338 (5′-GCTGCCTCCCGTAGGAGT-3′) [2] and NONEUB (5′-ACTCCTACGGGAGGCAGC-3′) [58] as positive and negative controls, respectively; ALF968 (5′GGTAAGGTTCTGCGCGTT-3′) for Alphaproteobacteria (except of Rickettsiales) [43]; BET42a (5′-GCCTTCC CACTTCGTTT-3′) for Betaproteobacteria and GAM42a (5′-GCCTTCCCACATCGTTT-3′) for Gammaproteobacteria [38]; DELTA495a (5′-AGTTAGCCGGTGCTTCCT-3′) for most Deltaproteobacteria and Gemmatimonadetes [36]; CF319a (5′-CCGTMTTACCGCGGCTGCTGGCA-3′) for Cytophaga–Flavobacterium group of the Bacteroidetes [37]; LGC354A (5′-TGGAAGATTCCCTACTGC-3′) for Firmicutes [40]; HGC69A (5-TATAGTTACCACCGC CGT-3) for Actinobacteria [47]; EUB338 II (5′-GCAGCCA CCCGTAGGTGT-3′) for Planctomycetes; and EUB338 III (5′-CTGCCACCCGTAGGTGT-3′) for Verrucomicrobia [16]. Further details on the above oligonucleotides can be found at the Probe Base URL http://www.microbialecology.net/probebase [35]. After hybridization, cells were stained with 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen) at a final concentration of 1 µg ml−1, rinsed with distilled water, air-dried, coated with antifading agent (Citifluor Ltd., UK), and viewed with an Axioskop 40 epifluorescence microscope (Zeiss, Germany).


Cell Enumeration and Statistical Analysis of the FISH Data Bacterial cells hybridized with oligonucleotide probes and those stained with DAPI were counted in ten randomly selected view fields in three repeats. In total, 30 view fields with approximately 2,000–5,000 mounted DAPI-stained cells were examined per each oligonucleotide probe from every sample. Relative abundance of each bacterial taxon was calculated from the average number of cells hybridized with a specific probe (Table 3), relative to the total bacterial number of the whole community. The relative abundances of certain bacterial taxa in all samples were analyzed statistically (Suppl. Table 1). Initially, the distributions in the samples were assessed by Shapiro–Wilk test [48]. Where normal distributions were found, analysis by analysis of variance (ANOVA) and t test was carried out. Analyses of nonnormally distributed populations were carried out with the NPMC package [22], available for the statistical computing software R (http://www.r-project.org) [46]. The Mann–Whitney test [24] was used for comparison of collected soils due to the fact that only two were taken.

Results Analysis of 16S rRNA Clone Libraries Eight clone libraries from total RNA extracted from the soil, earthworm gut content, and fresh casts collected in years 2003 and 2004 were generated by RT-PCR amplification with the universal primers F530 and R1492, to estimate bacterial diversity and to design the taxontargeting primers for SSCP analysis. In total, 256 cloned gene fragments (32–50 clones per library) were sequenced, yielding 132 bacterial operational taxonomic units (OTUs; defined as sharing sequence identity of 99.5% or greater). We excluded several clones of “Candidatus Lumbricincola” reported elsewhere [42] and clones of mitochondrial or eukaryotic SSU rRNA of the earthworms, nematodes (genus Rhabditis), and a protist of genus Monocystis (Apicomplexa) found in the libraries from L. terrestrisderived sources (data not shown). Overall, phylogenetic diversity of bacterial clones was high; OTUs corresponding to the phylum Proteobacteria were the most abundant in all libraries (38%) and were represented by sequences affiliated to classes Alphaproteobacteria, Betaproteobacteria, Gammaproteobacteria, and Deltaproteobacteria (Table 2). Among them, the genus Pseudomonas (Gammaproteobacteria) was detected in the majority of the libraries (Fig. S1). The Bacteroidetes-related phylotypes delivered the second most abundant number of clones belonging to Flavobacteria and Sphingobacteria.


579

Table 2 Phylogenetic distribution of the 16S rRNA clones and OTUs over bacterial groups in the libraries from soil and earthworm-derived sources Phylogenetic group

Autumn 2003 Soil

Spring 2004

L. terrestris

A. caliginosa

Soil

Gut content

Cast

Gut content

Cast

Total number

A. caliginosa Gut content

Cast

Alphaproteobacteria Betaproteobacteria Gammaproteobacteria Deltaproteobacteria Sphingobacteria Flavobacteria Verrucomicrobia

5/5a 3/3 14/12 0 2/1 0 0

0 1/1 4/4 0 0 5/5 1/1

0 1/1 4/4 0 0 5/5 1/1

2/2 3/3 2/2 0 6/2 7/5 0

4/3 3/3 12/7 0 0 1/1 1/1

3/2 3/3 2/1 0 8/4 0 0

3/3 0 2/2 1/1 1/1 5/2 1/1

7/7 7/3 2/2 2/2 2/1 0 0

Planctomycetes Acidobacteria Chloroflexi Actinobacteria Bacilli Total number

1/1 0 0 0 1/1 26/23

4/4 0 1/1 1/1 1/1 18/18

5/5 0 0 2/2 2/2 20/20

0 0 0 0 4/4 24/18

0 2/2 2/2 7/6 0 32/25

0 0 2/2 0 3/2 21/14

0 0 0 7/7 0 20/17

0 0 2/2 3/3 5/3 30/23

a

24/20 21/15 42/34 3/3 19/9 23/18 4/4 10/10 2/2 7/7 20/19 16/13 191/158

Clones/OTUs

Clones related to the class Flavobacteria were diverse and abundant in all gut content libraries (Table 2, Fig. S1). Sequences affiliated to Acidobacteria, Planctomycetes, Verrucomicrobia, Chloroflexi collectively yielded 23 OTUs, and Actinobacteria were detected mainly in the gut content and cast libraries of the earthworms (Table 2, Fig. S1). Many clones affiliated to Bacteroidetes, Verrucomicrobia, Planctomycetes, Betaproteobacteria, and Gammaproteobacteria from gut content libraries were identical to those from cast libraries of corresponding worm species and sampling campaigns (Fig. S1). Sequences of Firmicutes were represented by phylotypes affiliated with members of class Bacilli and were found in the majority of libraries (Table 2, Fig. S1). SSCP Profiles Generated with Universal Primers Single-stranded DNA obtained via reverse transcription with universal primer R1087 was used as a template to amplify gene fragments with universal primers Com1 and Com2-Ph. Correspondent SSCP profiles from two independent experiments were somewhat different, although the composition of ribotypes was similar between the samples (Fig. S2). Sequence analysis revealed 17 OTUs shared between all profiles; those phylotypes affiliated to the Proteobacteria (classes Alphaproteobacteria, Betaproteobacteria, Gammaproteobacteria (genus Pseudomonas)), Bacteroidetes (classes Flavobacteria and Sphingobacteria), Actinobacteria, and Acidobacteria (Fig. S2). Another 17 unique OTUs were found to be distributed over the patterns

without any clear differences between soil and cast profiles generated from both 16S rRNA and rRNA gene pools. In addition to bacteria, two mitochondrial fungal 12S rRNA sequences were detected on the soil and L. terrestris cast profiles (Fig. S2). Taxon-Targeting SSCP Analysis The oligonucleotides for SSCP were designed for targeting eight bacterial groups (Table 1). Preliminary in silico evaluation of designed primers revealed that some oligonucleotide sets covered a higher diversity of bacteria presented in the RDP database than the conventional universal SSCP primers, although some newly designed primers also targeted sequences from out-groups: the Alf F805p forward primer had low specificity and targeted 14.5% taxonomically nonrelated sequences (Table 3). Nevertheless, we accepted the imperfect nature of the designed oligonucleotides as certain nonspecificity of oligonucleotide-targeting phyla and classes also occurs with many other primers (e.g., probes for FISH analysis are also not fully specific). Single-stranded DNA was generated via reverse transcription with universal primer R1087 and subsequently used as a template for amplification with primer sets targeting Gammaproteobacteria and Bacteroidetes; ssDNA transcribed with universal primer R1492 was used in the PCR reactions with other taxon-targeting primer sets due to targeting different regions of rRNA. Most of the SSCP profiles produced from independent experiments were similar to each

580


Table 3 Assessment of universal and newly designed bacterial taxon-targeting primers for conventional SSCP and TT-SSCP analyses Target group

Taxon coveragea (%) Conventional setb

Number of OTUs from SSCP profiles Taxon-targeting sets

Conventional

Specific group

Out-groups

Taxon-targeting

Bacteria Alphaproteobacteria

68.1/46.1c 67.0/48.3

– 32.1/31.4

– 14.5/0.1

42d 8

229d 41/0e

Betaproteobacteria Gammaproteobacteria Deltaproteobacteria Bacteroidetes Verrucomicrobia Planctomycetes Firmicutes Others

71.0/50.7 72.2/9.8 67.4/40.8 79.9/58.6 68.4/7.7 20.1/52.7 75.1/52.6 nd

52.1/7.9 42.9/35.0 11.3/11.7 45.7/52.6 31.2/15.0 43.1/42.0 11.8/38.6 –

0.8/0.0 0.3/0.5 0.1/0.0 0.0/0.5 0.0/0.0 0.0/0.0 0.0/0.0 –

2 4 1 17 0 0 0 10

24/5 42/2 9/24 27/1 14/0 19/2 15/0 nd/2

nd not determined a

Percentage of sequences in the RDP database (release 10, update 11) matching the primer, as revealed by Probe Match software application without mismatches allowed (http://rdp.cme.msu.edu/probematch/search.jsp)

b

Universal primers for 16S rRNA gene Com1 and Com2-Ph [34]

c

Values for forward and reverse primers, respectively; a primer with lower coverage in set is marked in italics

d

Total number

e

OTUs from taxon-targeting profiles generated with specific primers set/nonspecifically amplified OTUs from different taxon-targeting profiles

other. Consequently, only a single example for each group is presented here. Overall, a fivefold higher number of OTUs emerged from SSCP profiles generated with taxon-targeting primers compared to the profiles generated with the universal Com1 and Com2-Ph primer set (Table 3). TT-SSCP Profiles of Proteobacteria SSCP patterns generated during independent reactions of amplification with Alphaproteobacteria-targeting primers from DNA samples looked different to some extent (Fig. 1a). In contrast, profiles generated with these primers from ssDNA samples obtained via reverse transcription during independent reactions were similar to each other (one example shown). Sequence analysis of the bands from individual RNA-originated profiles from the soil and casts revealed that nine to 11 of 12 OTUs solely affiliated with the unclassified Sphingomonadaceae (Fig. 1b, S3). DNAderived patterns were more complex and yielded ten to 27 of 28 OTUs affiliated to the members of three orders of Alphaproteobacteria (Fig. 1b, S3). In addition, 22 OTUs from the DNA-derived profiles were affiliated with bacteria from out-groups due to the nonspecific amplification with Alphaproteobacteria-targeting primers (Fig. S3). Profiles generated with Betaproteobacteria-specific primers from RNA of soil and cast samples contained a single band of a single OTU affiliated with A. faecalis E690 FN298276 (97.8% sequence identity), isolated earlier from

the same soil (Fig. 2), whereas TT-SSCP profiles obtained from DNA showed numerous bands containing 16–21 OTUs related to four bacterial families and also some unclassified ribotypes (Fig. S4). PCR amplifications were successfully performed using Gammaproteobacteria-targeting primers from RNA of soil and worm cast samples and from total DNA of soil sample. Generally, SSCP profiles from soil samples generated from both DNA and RNA were more complex than those from earthworm casts (Fig. 3). The phylotypes from the soil samples were derived from four families of Gammaproteobacteria and from two phylogenetically unclassified clusters (Fig. 3b). In contrast, the majority of ribotypes from the worm cast SSCP profiles were affiliated with P. putida and Pseudomonas entomophila (Fig. 3). PCR amplicons of Deltaproteobacteria were generated only from DNA samples of soil and casts of A. caliginosa after additional amplification cycles. Soil DNA pattern showed eight OTUs affiliated with the family Polyangiaceae (Fig. S5). The pattern from A. caliginosa cast samples was represented by a single OTU affiliated with the order Myxococcales with uncertain placement within this taxonomic group (Fig. S5). TT-SSCP Profiles of Bacteroidetes The primer set designed for Bacteroidetes had the highest group coverage among all the primers constructed


581

Figure

1 Images of SSCP profiles generated with the Alphaproteobacteria-targeting primer set (a) and the phylogenetic analysis of ribotypes related to the branch of unclassified Sphingomonadaceae detected from the TT-SSCP profiles (b). The lanes and ribotypes are marked as follows: RS soil RNA, RL RNA from L. terrestris cast, RA RNA from A. caliginosa cast, DS soil DNA, DL DNA from L. terrestris cast, DA DNA from A. caliginosa cast. Different DNA-derived profiles were generated during independent amplification reactions from the same samples. Numbers on the gel correspond to ribotypes on the phylogenetic trees. Ribotypes from SSCP profiles are marked in bold on the tree; those amplified from RNA are shown in gray boxes. Ribotypes detected in the same band are marked on the phylogenetic tree with numbers and small letters. Sequences with identity >99.5% were taken as belonging to a single OTU and are shown as one ID. Numbers at nodes indicate bootstrap values greater than 50%. The phylogenetic analysis of all ribotypes amplified with Alphaproteobacteria-targeting primer set is presented on Fig. S3

A))

TT-SSCP Profiles of Firmicutes Similar to Gammaproteobacteria, PCR amplifications with Firmicutes-targeting primers were successfully performed

A))

B)

A-RS/RL/RA-4 AM989617 A-RS/RL/RA-2 AM989616 A-RL/RA-9 AM989622 A-RS-9 AM989621 A-RS/RL/RA-6, 7 AM989619 A-RS-14 AM989627 A-RS/RL/RA-8 AM989620 A-RS/RL/RA-5 AM989618 A-RS/RL/RA-11 AM989625 A-RS/RL/RA-1, 3, 12 AM989615 A-RS/RA-10 AM989623 55 A-RS-13 AM989626 A-DA-1b, 5-7, 10c AM989673 73 A-RL-10 AM989624 tree Caulobacter leidyi AJ227812 Asticcacaulis excentricus AJ007800 63 Asticcacaulis biprosthecium AJ007799 Caulobacter subvibrioides CB81 M83797

B)

96 B-RS/RL/RA-1 AM989682 98

97

tree

B-DS/DL/DA-12 AM989706 Alcaligenes faecalis E690 FN298276 Achromobacter xylosoxidans AF411021

0.01 0.02

(Table 3). SSCP patterns generated during independent reactions with these taxon-targeting primers were also somewhat different (Fig. 4a), although the sequence analysis of bands from the profiles of soil and cast samples generated from both DNA and RNA showed similar ribotype composition between all profiles and relatively high diversity of both classes Flavobacteria and Sphingobacteria comprising 19 of total 21–25 OTUs and present in all TT-SSCP profiles (Fig. 4b).

Figure 2 Images of SSCP profiles generated with Betaproteobacteriatargeting primer set (a) and the phylogenetic analysis of the ribotypes related to the family Alcaligenaceae detected from the TT-SSCP profiles (b). The lanes are marked as follows: RS soil RNA, RL RNA from L. terrestris cast, RA RNA of A. caliginosa cast, DS soil DNA, DL DNA of L. terrestris cast; DA DNA of A. caliginosa cast. Numbers on the gel correspond to ribotypes on the phylogenetic trees. Ribotypes from SSCP profiles are marked in bold on the tree; those amplified from RNA are shown in a gray box. Sequences with identity >99.5% were taken as belonging to a single OTU and are shown as one ID. Numbers at nodes indicate bootstrap values greater than 50%. The phylogenetic analysis of all ribotypes amplified with Betaproteobacteria-targeting primer set is presented on Fig. S4

582


Figure

3 Images of SSCP profiles generated with the Gammaproteobacteria-targeting primer set (a) and the phylogenetic analysis of the ribotypes detected from the TT-SSCP profiles (b). The lanes are marked as follows: RS soil RNA, DS soil DNA, RL RNA from L. terrestris cast, RA RNA of A. caliginosa cast. Numbers on the gel correspond to ribotypes on the phylogenetic trees. Ribotypes from SSCP profiles are marked in bold on the tree; those amplified from RNA are shown in gray boxes, phylotypes amplified from earthworm cast samples are marked with an asterisk. Ribotypes detected in the same band are marked on the phylogenetic tree with numbers and small letters. Sequences with identity >99.5% were taken as belonging to a single OTU and are shown as one ID. Numbers at nodes indicate bootstrap values greater than 50%

A)

G-RS-10, 18 AM989731 G-RA-7, 8 AM989753 * G-RL-1, 4-6 AM989744 98 G-RA-3 AM989750 G-RL-2 AM989745 98 G-RA-5, 6 AM989752 G-RL-3 AM989746 99 G-RA-4 AM989751 Pseudomonas entomophila AY9075 59 Pseudomonas putida Z76667 Pseudomonas syringae AY574914 G-DS-5 AM989712 59 G-DS-7 AM989714 G-DS-4 AM989711 65 G-RS-4b 9a AM989723 92 Pseudomonas alcaligenes Z76653 58 76 G-DS-3 AM989710 G-DS-6 AM989713 G-RS-16 17 AM989737 G-RS-7 AM989727 100 G-RS-9c AM989730 Cellvibrio japonicus AF452103 72 G-RS-14 AM989734 G-RS-15a AM989735 Cellvibrio gandavensis AJ28916 G-RS-19 AM989738 G-DS-8a AM989715 Cellvibrio vulgaris AF448513 G-RS-15c AM989736 62 55 Cellvibrio fibrivorans AJ28916 G-RA-1b AM989748 G-RS-9b 11 AM989729 63 Legionella longbeachae M36029 100 Legionella pneumophila AF122885 G-RS-12 15b AM989732 Legionella drancourtii X97366 uncultured proteobacterium AY212747 uncultured proteobacterium AY212658 100 uncultured proteobacterium AJ318139 63 G-RS-20 AM989739 G-RS-21 AM989740 G-DS-9 AM989718 G-RS-22 AM989741 G-RS-23 AM989742 G-DS-10 AM989719 67 76 G-RS-24 AM989743 G-DS-8b AM989716 Nitrosococcus oceanus M96398 65 G-DS-8c AM989717 G-RS-13 AM989733 G-RS-1, 2 AM989720 94 97 G-RS-4a AM989722 75 G-RS-4c AM989724 G-RS-6 AM989726 82 84 uncultured proteobacterium AY921670

B)

*

*

TT-SSCP Profiles of Planctomycetes and Verrucomicrobia Amplifications with the primer sets targeting Planctomycetes and Verrucomicrobia were successfully performed only from DNA samples after additional cycles of amplification. Sequence and phylogenetic analyses of the bands from the patterns generated with Verrucomicrobia-targeting primers revealed a wide-ranging diversity of OTUs [16, 17] belonging to the target group and also unspecifically amplified Streptomycetes-related ribotypes (Fig. S7). The phylotypes from the bands V-DL/DA-1/1 appearing in the cast samples of both earthworm species were similar to the clones detected in the L. terrestris-derived libraries (sequence identity 95.6%; Fig. S7). The soil and cast profiles generated with Planctomycetestargeting primers did not exhibit significant differences between each other and were rich in OTUs [18, 19], which belonged solely to the phylum Planctomycetes without clear clustering (Fig. S8).

59

Chromatiaceae

unclassified

*

Legionellaceae

Pseudomonadaceae

* * * * *

A. caliginosa cast samples were more complex (Fig. S6). In addition, seven OTUs affiliated to the order Myxococcales (Deltaproteobacteria) were nonspecifically amplified with the Firmicutes-targeting primer set from soil RNA and DNA preps (Fig. S6).

Betaproteobacteria

99

98 81 100

51

73

0.02

Fluorescence In Situ Hybridization

100 60

G-DS-1 AM989708 G-RA-2a b AM989749 100 Hydrocarboniphaga effusa AY363 Nevskia ramosa AJ001343 100 G-DS-2 AM989709 G-RS-5 AM989725 uncultured bacterium AY922016 G-RS-8 AM989728 99 G-RS-3 AM989721 G-RA-1a AM989747 Stenotrophomonas maltophilia* X95924 Stenotrophomonas rhizophila AJ293463

*

unclassified

75

Xanthomonadaceae

57

root

from all RNA and DNA samples. Sequence analysis of TTSSCP profiles showed the presence of a single OTU affiliating to the genus Bacillus in cast samples of L. terrestris (ribotype L-RL-1AM989839), while the soil and

FISH analysis was performed to correlate relative abundances of bacterial taxonomic groups with occurrence of corresponding taxa on the fingerprints. Gram-negative bacteria were predominant in all samples; Bacteroidetes, Alphaproteobacteria, and Betaproteobacteria had the highest numbers among the other bacterial groups (Table 4). Cells of the Gemmatimonadetes, Deltaproteobacteria, Verrucomicrobia, and Planctomycetes were present in all samples in low numbers (below 1%) or were undetectable. Relative abundances of all taxa were quite stable with minor variations, whereas Bacteroidetes were more abundant in the casts of L. terrestris than in the soil (Table 4).


A)

B)

65

89

91 53

98

root 60 89

99

0.05

C-5, 5/1 (AM989762, AM989761) C-12b (AM989785, AM989786) C-RL/RA/DS/DL-6b (AM989765, AM989766) 99 C-RL/RA/DS/DL/DA-6a (AM989764, AM989763) Flavobacterium granuli AB180738 C-2, 4 (AM989756, AM989757) Flavobacterium frigidimaris AB183888 Flavobacterium columnare M58781 Flavobacterium hibernum L39067 C-3 (AM989759, AM989760) Flavobacterium psychrophilum AB078060 72 86 Flavobacterium limicola AB075232 C-RL-2/1 AM989758 C-RL/DL-1/1 AM989755 99 Flavobacterium saliperosum DQ021903 61 97 C-RL-1 AM989754 Flavobacterium johnsoniae AB078043 99 Flavobacterium johnsoniae isolate 451-1 FN298315 Flexibacter sancti AB078067 99 Flexibacter filiformis AB078049 C-8c (AM989771, AM989772) symbiont cf. Flavobacterium of T. binghami AF459795 uncultured Bacteroidetes bacterium DQ201672 C-8b (AM989769, AM989770) C-10 (AM989779, AM989780) C-9c (AM989777, AM989778) C-9b (AM989775, AM989776) 99 C-DS/DL/DA-3/1 AM989800 99 C-8a (AM989767, AM989768) uncultured Sphingobacterium sp. AY599659 Sphingobacterium spiritivorum M58778 56 Sphingobacteriaceae bacterium isolate 611-2 FN298316 Flexibacter canadensis AB078046 C-13 (AM989788, AM989789) C-11 (AM989781, AM989782) C-12a (AM989783, AM989784) C-17 (AM989796, AM989797) C-14 (AM989790, AM989791) C-16 (AM989794, AM989795) 97 C-18 (AM989798, AM989799) 59 97 C-15 (AM989792, AM989793) C-9a (AM989773, AM989774) Flexibacter tractuosus AB078072 Flexibacter flexilis AB078053 C-RL-12c AM989787 Cyclobacterium marinum AY533665

Flavobacteria

72 C-RL/DL-7 AM989801

Sphingobacteria

Figure 4 Images of SSCP profiles generated with the Bacteroidetes-targeting primer set (a) and the phylogenetic analysis of the ribotypes detected from the TT-SSCP profiles (b). The lanes and the origin of ribotypes are marked as follows: RS soil RNA, RL L. terrestris cast RNA, RA RNA from A. caliginosa cast, DS soil DNA, DL DNA of L. terrestris cast, DA DNA of A. caliginosa cast. Different RNA- and DNA-derived profiles were generated during independent amplification reactions from the correspondent samples. Numbers on the gel correspond to ribotypes on the phylogenetic trees. Ribotypes from SSCP profiles are marked in bold on the tree; those amplified from RNA only are shown in gray boxes. Ribotypes detected in the same band are marked on the phylogenetic tree with numbers and small letters. Sequences with identity >99.5% were taken as belonging to a single OTU and are shown as one ID. Numbers at nodes indicate bootstrap values greater than 50%

583


FISH counts for Bacteroidetes were subjected to the statistical analysis with Shapiro–Wilk test, which has revealed that the datasets from L. terrestris contained a nonnormally distributed population (value below 0.05; Table S1) due to the heterogeneous distribution of cells on the microscope slides. Consequently, we did not use ANOVA or t test but instead applied a nonparametric multiple comparison of means with the nonparametric Behrens–Fisher-type test procedure [11]. This revealed that there were no statistically significant differences between the cell number of Bacteroidetes in all samples (P>0.05; Table S2).

c

Average number of counted bacteria per field of view ± standard deviation

For calculation procedure, see “Cell enumeration and statistical analysis of the FISH data” in Materials and Methods

Discussion

b

a

Gemmatimonadetes, Deltaproteobacteria, Verrucomicrobia, and Planctomycetes are not presented and were excluded from analysis due to their very low abundance

26.1 26.1 1.0 42.9 2.0 2.0 5.3±2.9 5.3±3.6 0.2±0.4 8.7±4.8 0.4±0.8 0.4±0.6 108.1±40.6 71.5±29.1 182.9±39.7 96.5±20.5 90.9±30.1 177.0±31.3 Alphaproteobacteria Betaproteobacteria Gammaproteobacteria Bacteroidetes Actinobacteria Firmicutes

97.1±53.0 93.0±35.1 76.7±31.4 86.2±36.1 109.6±28.4 116.1±30.4

7.2±5.3 5.8±3.1 0.8±1.0 7.3±5.2 0.8±0.8 0.9±0.9

31.6 25.4 3.5 32.0 3.5 3.9

170.5±45.7 72.2±31.6 64.1±29.4 97.5±34.6 74.9±24.5 145.6±38.9

6.6±3.0 5.0±3.1 0.3±0.6 14.3±6.3 0.8±0.8 0.4±0.6

24.1 18.2 1.1 52.2 2.9 1.5

Probe DAPI DAPI Probeb

Abundancec (%) DAPIb

Probe

Abundance (%)

A. caliginosa L. terrestris Soil Target groupa

Table 4 FISH counts and relative abundances of bacterial groups in soil and cast samples of L. terrestris and A. caliginosa collected in spring 2005

Abundance (%)

584

Fingerprinting analysis of 16S rRNA allows a quick comparison of bacterial communities in multiple samples avoiding large-scale sequencing efforts. The efficiency of a fingerprinting approach with group-specific primers for an in-depth analysis of microbial community has recently been reported for denaturing gradient gel electrophoresis [41], whereas the present work has demonstrated the same for SSCP. Additionally, the results of SSCP were also dependent on the type of nucleic acid analyzed (i.e., RNA or DNA). On one hand, soil bacterial DNA is derived from physiologically active, dormant, dead bacteria, and free DNA; all of these DNA species might be accumulated in soil enriching the pool of 16S rRNA genes and thus increasing the PCR-detectable SSU rRNA gene diversity also observed in a number of previous studies [9, 33, 55, 59]. Very-low-abundance (below 1%, according to the FISH counts) members of Planctomycetes and Verrucomicrobia were detected only in DNA preps with taxontargeting primers after additional amplification cycles. In contrast, using RNA as the template yielded much higher signals for these organisms than those for DNA isolated from soil. Actively growing cells of Firmicutes and Gammaproteobacteria present in low abundance (1–3.9%) possessed high amounts of ribosomal RNA, which increased their chances of detection. Highly abundant Bacteroidetes, Alphaproteobacteria, and Betaproteobacteria were regularly amplified from both RNA and DNA preps. However, the low coverage of target groups by taxonspecific and universal primers and possible PCR bias could negatively affect the detection of corresponding bacterial taxa. In particular, this could explain why Deltaproteobacteria-targeting SSCP profiles suggested a relatively low diversity of this group analyzing the DNA preps, while diverse Deltaproteobacteria-related sequences were amplified with universal primers and nonspecifically with primers targeting other bacterial taxa, from RNA and DNA preps.


In the present study, the differences between phylotype composition from RNA and DNA samples were notable for highly abundant Alphaproteobacteria, and especially, for Betaproteobacteria on TT-SSCP profiles. Unclassified Sphingomonadaceae (Alphaproteobacteria) and Alcaligenes spp. (Betaproteobacteria) were detected on corresponding TT-SSCP profiles from soil and cast samples and therefore seemed to maintain their diversity upon transit through the GI tract of earthworms. Ribotypes affiliated to the genus Pseudomonas were detected in clone libraries and on SSCP patterns generated with universal and taxon-targeting primers from soil and cast samples of both earthworm species. Pseudomonas spp. have also been detected in the cast of Lumbricus rubellus [21], and the strains of the same species were regularly isolated from excrements and gut contents of both L. terrestris and A. caliginosa [12, 28]. Moreover, as recently reported, some Pseudomonas strains exhibit enhanced formation of microcolonies after treatment with digestive fluids of A. caliginosa [31]. Thus, some representatives of this genus, and specifically P. putida, appear resistant to the conditions in the earthworm gut, which negatively influence some other groups of Gammaproteobacteria. Sequence analysis of clone libraries, SSCP fingerprinting (conventional and taxon targeting), and FISH counts suggested that both classes of Bacteroidetes, Flavobacteria, and Sphingobacteria did maintain their diversity and density upon the transit through the GI tract of earthworms. In addition, RNA- and DNA-based analyses revealed similar diversity patterns within these taxonomic groups, which indicate that the majority of Bacteroidetes present in soil and cast communities were metabolically active. Therefore, we deduce that the earthworm gut environment has no inhibiting influence to the members of phylum Bacteroidetes. This is supported by other studies on members of the Cytophaga–Flavobacterium group of Bacteroidetes who possessed higher densities in the casts of L. terrestris compared to the surrounding litter [51]. Bacteroidetes have also been found in soil exposed to Eisenia veneta [23] while Flavobacteria have previously been isolated from gut contents and casts of earthworms collected at the same site [12]. Furthermore, Bacteroidetes have also been detected in an independent study on A. caliginosa [28]. Generally, Bacteroidetes represent an important component of the bacterial communities associated with the digestive tracts of other animals (e.g., mammals including humans and some insects such as ants, termites, and larva of humus-feeding beetles) [5, 20, 50, 57]. The Bacteroidetes and other bacteria resistant to, or preferring, the environmental conditions in the gut could be involved in the breakdown of polymeric substrates from soil, plant litter, intestine mucosa, and fermentation products from organic matter turnover [17].

585

In our work, we have also observed certain seasonal variations in the composition of microbial communities in the soil, which together with specific environmental constraints in the earthworm GI tract seem to be major factors predetermining the changes of bacterial community during transit through the worm intestine. Acknowledgments This work was supported by the European Union Project “Biotic and Abiotic Mechanisms of TSE Infectivity Retention and Dissemination in Soil” TSE-SOIL-FATE (QLRT-200102493). K.N.T thanks the Fonds der Chemischen Industrie for generous support. B.A.B. and A.V.K. acknowledge the support of the Russian Foundation for Basic research (RFFI grant 06-04-48557). P.N.G. acknowledges the support from BiotechGenoMik project of the Federal Ministry for Science and Education (BMBF).

References 1. Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ (1997) Gapped BLAST & PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 25:3389–3402 2. Amann RI, Binder BJ, Olson RJ, Chisholm SW, Devereux R, Stahl DA (1990) Combination of 16S rRNA-targeted oligonucleotide probes with flow cytometry for analyzing mixed microbial populations. Appl Environ Microbiol 56:1919–1925 3. Ashelford KE, Chuzhanova NA, Fry JC, Jones AJ, Weightman AJ (2006) New screening software shows that most recent large 16S rRNA gene clone libraries contain chimeras. Appl Environ Microbiol 72:5734–5741 4. Ashelford KE, Weightman AJ, Fry JC (2002) PRIMROSE: a computer program for generating and estimating the phylogenetic range of 16S rRNA oligonucleotide probes and primers in conjunction with the RDP-II database. Nucleic Acids Res 30: 3481–3489 5. Bäckhed F, Ley RE, Sonnenburg JL, Peterson DA, Gordon JI (2005) Host–bacterial mutualism in the human intestine. Science 307:1915–1920 6. Bassam BJ, Caetano-Anolles G, Gresshoff PM (1991) Fast and sensitive silver staining of DNA in polyacrylamide gels. Anal Biochem 80:81–84 7. Benson DA, Karsch-Mizrachi I, Lipman DJ, Ostell J, Wheeler DL (2003) GenBank. Nucleic Acids Res 31:23–27 8. Berry AE, Chiocchini C, Selby T, Sosio M, Wellington EMH (2003) Isolation of high molecular weight DNA from soil for cloning into BAC vectors. FEMS Microb Lett 223:15–20 9. Borneman J, Skroch PW, O'Sullivan KM, Palus JA, Rumjanek NG, Jansen JL, Nienhuis J, Triplett EW (1996) Molecular microbial diversity of an agricultural soil in Wisconsin. Appl Environ Microbiol 62:1935–1943 10. Brown GG (1995) How do earthworms affect microfloral and faunal community diversity? Plant Soil 170:209–231 11. Brunner E, Munzel U (2000) The nonparametric Behrens–Fisher problem: asymptotic theory and a small-sample approximation. Biometrical J 42:17–25 12. Byzov BA, Nechitaylo TY, Bumazhkin BK, Kharin SA, Kurakov AV, Golyshin PN, Zvyagintsev DG (2009) Cultivable microorganisms from digestive tract of earthworms. Microbiol 79:404– 413 13. Cole JR, Chai B, Farris RJ, Wang Q, Kulam SA, McGarrell DM, Bandela AM, Cardenas E, Garrity GM, Tiedje JM (2007) The ribosomal database project (RDP-II): introducing myRDP space

586

14.

15. 16.

17.

18.

19.

20.

21.

22. 23.

24. 25.

26.

27.

28.

29.

30.

31.

T. Y. Nechitaylo et al. and quality controlled public data. Nucleic Acids Res 35(Database issue):D169–D172. doi:101093/nar/gkl889 Cole JR, Chai B, Marsh TL, Farris RJ, Wang Q, Kulam SA, Chandra S, McGarrell DM, Schmidt TM, Garrity GM, Tiedje JM (2003) The Ribosomal Database Project (RDP-II): previewing a new autoaligner that allows regular updates and the new prokaryotic taxonomy. Nucleic Acids Res 31:442–443 Contreras E (1980) Studies on the intestinal actinomycete flora of Eisenia lucens (Annelida, Oligochaeta). Pedobiologia 20:411–416 Daims H, Brühl A, Amann R, Schleifer K-H, Wagner M (1999) The domain-specific probe EUB338 is insufficient for the detection of all Bacteria: development and evaluation of a more comprehensive probe set. Syst Appl Microbiol 22:434–444 Drake HL, Horn MA (2007) As the worm turns: the earthworm gut as a transient habitat for soil microbial biomes. Annu Rev Microbiol 61:169–189 Edwards CA, Fletcher KE (1988) Interactions between earthworms and microorganisms in organic-matter breakdown. Agric Ecosyst Environ 24:235–247 Egert M, Marhan S, Wagner B, Scheu S, Friedrich MW (2004) Molecular profiling of 16S rRNA genes reveals diet-related differences of microbial communities in soil, gut, and casts of Lumbricus terrestris L (Oligochaeta: Lumbricidae). FEMS Microb Ecol 48:187–197 Egert M, Wagner B, Lemke T, Brune A, Friedrich MW (2003) Microbial community structure in midgut and hindgut of the humus-feeding larva of Pachnoda ephippiata (Coleoptera: Scarabaeidae). Appl Environ Microbiol 69:6659–6668 Furlong MA, Singleton DR, Coleman DC, Whitman WB (2002) Molecular and culture-based analyses of prokaryotic communities from an agricultural soil and the burrows and casts of the earthworm Lumbricus rubellus. Appl Environ Microbiol 68: 1265–1279 Helms J, Munzel U (2007) Nonparametric multiple comparisons. http://cran.r-project.org/doc/packages/npmc.pdf Héry M, Singer AC, Kumaresan D, Bodrossy L, Stalis-Pavese N, Prosser J, Thompson IP, Murrel JC (2008) Effect of earthworms on the community structure of active methanotrophic bacteria in a landfill soil. ISME J 2:92–104 Hollander M, Wolfe DA (1999) Nonparametric statistical inference. Wiley, New York Horn MA, Ihssen J, Matthies C, Schramm A, Acker G, Drake HL (2005) Dechloromonas denitrificans sp. nov., Flavobacterium denitrificans sp. nov., Paenibacillus anaericanus sp. nov. and Paenibacillus terrae strain MH72, N2O-producing bacteria isolated from the gut of the earthworm Aporrectodea caliginosa. Int J Syst Evol Microbiol 55:1255–1265 Horn MA, Mertel R, Gehre M, Kastner M, Drake HL (2006) In vivo emission of dinitrogen by earthworms via denitrifying bacteria in the gut. Appl Environ Microbiol 72:1013–1018 Horn MA, Schramm A, Drake HL (2003) The earthworm gut: an ideal habitat for ingested N2O-producing microorganisms. Appl Environ Microbiol 69:1662–1669 Ihssen J, Horn MA, Matthies C, Gößner A, Schramm A, Drake HL (2003) N2O-producing microorganisms in the gut of the earthworm Aporrectodea caliginosa are indicative of ingested soil bacteria. Appl Environ Microbiol 69:1655–1661 Karsten GR, Drake HL (1995) Comparative assessment of the aerobic and anaerobic microfloras of earthworm guts and forest soils. Appl Environ Microbiol 61:1039–1044 Karsten GR, Drake HL (1997) Denitrifying bacteria in the earthworm gastrointestinal tract and in vivo emission of nitrous oxide (N2O) by earthworms. Appl Environ Microbiol 63:1878– 1882 Khomyakov NV, Kharin SA, Nechitaylo TY, Golyshin PN, Kurakov AV, Byzov BA, Zvyagintsev DG (2007) Reaction of

32. 33.

34.

35.

36.

37.

38.

39.

40.

41.

42.

43.

44. 45.

46.

47.

48. 49.

50.

microorganisms to the digestive fluid of the earthworms. Microbiol 76:55–65 Kristufek V, Ravasz K, Pizl V (1993) Actinomycete communities in earthworm guts and surrounding soil. Pedobiologia 37:379–384 Kuske CR, Barns SM, Busch JD (1997) Diverse uncultivated bacterial groups from soils of the arid southwestern United States that are present in many geographic regions. Appl Environ Microbiol 63:3614–3621 Lane DJ, Pace B, Olson GJ, Stahl DA, Sagin ML, Pace NR (1985) Rapid determination of 16S ribosomal RNA sequences for phylogenetic analysis. Proc Natl Acad Sci U S A 82:6955–6959 Loy A, Horn M, Wagner M (2003) ProbeBase—an online resource for rRNA-targeted oligonucleotide probes. Nucleic Acids Res 31:514–516 Loy A, Lehner A, Lee N, Adamczyk J, Meier H, Ernst J, Schleifer K-H, Wagner M (2002) Oligonucleotide microarray for 16S rRNA gene-based detection of all recognized lineages of sulfate-reducing prokaryotes in the environment. Appl Environ Microbiol 68:5064–5081 Manz W, Amann R, Ludwig W, Vancanneyt M, Schleifer K-H (1996) Application of a suite of 16S rRNA-specific oligonucleotide probes designed to investigate bacteria of the phylum Cytophaga–Flavobacter–Bacteroides in the natural environment. Microbiol 142:1097–1106 Manz W, Amann R, Ludwig W, Wagner M, Schleifer K-H (1992) Phylogenetic oligodeoxynucleotide probes for the major subclasses of Proteobacteria: problems and solutions. Syst Appl Microbiol 15:593–600 Matthies C, Griesshammer A, Schmittroth M, Drake HL (1999) Evidence for involvement of gut-associated denitrifying bacteria in emission of nitrous oxide (N2O) by earthworms obtained from garden and forest soils. Appl Environ Microbiol 65:3599–3604 Meier H, Amann R, Ludwig W, Schleifer K-H (1999) Specific oligonucleotide probes for in situ detection of a major group of gram-positive bacteria with low DNA G + C content. Syst Appl Microbiol 22:186–196 Mühling M, Woolven-Allen J, Murrell JC, Joint I (2008) Improved group-specific PCR primers for denaturing gradient gel electrophoresis analysis of the genetic diversity of complex microbial communities. ISME J 2:379–392 Nechitaylo TY, Timmis KN, Golyshin PN (2009) ‘Candidatus Lumbricincola’, a novel lineage of uncultured Mollicutes from earthworms of family Lumbricidae. Environ Microbiol 11:1016–1026 Neef A (1997) Anwendung der in situ Einzelzell-Identifizierung von Bakterien zur Populationsanalyse in komplexen mikrobiellen Biozönosen. Ph.D. thesis, Technische Universität München Omodeo P (1998) History of Clitellata. Ital J Zool 65:51–73 Pedersen JC, Hendriksen NB (1993) Effect of passage through the intestinal tract of detritovore earthworms (Lumbricus spp.) on the number of selected Gram-negative and total bacteria. Biol Fertil Soils 16:227–232 R Development Core Team (2004) R: a language and environment for statistical computing. R Foundation for Statistical Computing, Vienna http://www.r-project.org Roller C, Wagner M, Amann R, Ludwig W, Schleifer K-H (1994) In situ probing of Gram-positive bacteria with high DNA G + C content using 23S rRNA-targeted oligonucleotides. Microbiol 140:2849–2858 Royston P (1982) Algorithm AS181: the W test for normality. Appl Stat 31:176–180 Sambrook J, Russel DW (2001) Preparation and analysis of eukaryotic genomic DNA. In: Sambrook J, Russel DW (eds) Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, New York, p 6.22 Schmitt-Wagner D, Friedrich MW, Wagner B, Brune A (2003) Phylogenetic diversity, abundance, and axial distribution of


51.

52.

53.

54.

bacteria in the intestinal tract of two soil-feeding termites (Cubitermes spp). Appl Env Microbiol 69:6007–6017 Schönholzer F, Hahn D, Zarda B, Zeyer J (2002) Automated image analysis and in situ hybridization as tools to study bacterial populations in food resources, gut and cast of Lumbricus terrestris L. J Microbiol Meth 48:53–68 Schwieger F, Tebbe CC (1998) A new approach to utilize PCR-singlestrand-conformation polymorphism for 16S rRNA gene-based microbial community analysis. Appl Environ Microbiol 64:4870–4876 Singleton DR, Hendrix PF, Coleman DC, Whitman WB (2003) Identification of uncultured bacteria tightly associated with the intestine of the earthworm Lumbricus rubellus (Lumbricidae; Oligochaeta). Soil Biol Biochem 35:1547–1555 Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol 24:1596–1599

587 55. Torsvik V, Goksoyr J, Daae FL (1990) High diversity in DNA of soil bacteria. Appl Environ Microbiol 56:782–787 56. Toyota K, Kimura M (2000) Microbial community indigenous to the earthworm Eisenia foetida. Biol Fertil Soils 31: 187–190 57. van Borm S, Buschinger A, Boomsma JJ, Billen J (2002) Tetraponera ants have gut symbionts related to nitrogen-fixing root-nodule bacteria. Proc Biol Sci 269:2023–2027 58. Wallner G, Amann R, Beisker W (1993) Optimizing fluorescent in situ hybridization with rRNA-targeted oligonucleotide probes for flow cytometric identification of microorganisms. Cytometry 14:136–143 59. Zhou J, Davey ME, Figueras JB, Rivkina E, Gilichinsky D, Tiedje JM (1997) Phylogenetic diversity of a bacterial community determined from Siberian tundra soil DNA. Microbiol 143: 3913–3919