Effect of viral dose on neutralizing antibody response and ... - Nature

Gene Therapy (2008) 15, 54–60 & 2008 Nature Publishing Group All rights reserved 0969-7128/08 $30.00 www.nature.com/gt

SHORT COMMUNICATION

Effect of viral dose on neutralizing antibody response and transgene expression after AAV1 vector re-administration in mice H Petry1,3, A Brooks1, A Orme1, P Wang1, P Liu2, J Xie1, P Kretschmer1, HS Qian2, TW Hermiston1 and RN Harkins1 1

Department of Gene Technologies, Berlex Biosciences, Richmond, CA, USA and 2Department of Pharmacology, Berlex Biosciences, Richmond, CA, USA

Neutralizing antibodies (nAB) at the time of administration hamper the effectiveness of adeno-associated virus (AAV) as a clinical DNA delivery system. The present study was designed to investigate if AAV re-administration in muscle tissue is dependent on the nAB titer. Recombinant (r)AAV serotype 1, as a promising candidate for targeting skeletal muscle, was used for gene delivery. C57Bl/6 mice were infected intramuscularly with doses between 1 109 and 5 1010 virus particles (vp) of AAV1-expressing luciferase (AAV1-luc) or human interferon-b (AAV1-hIFNb). Increasing transgene expression was observed over the first 2 months and anti-AAV1 nAB titers peaked between weeks 4 and 8. Six months after the first administration, 5 1010 vp of AAV1-

IFNb were re-administered. Following re-administration, nAB titers increased but did not significantly affect transgene expression from the AAV vector that had been administered first. In contrast, hIFNb expression originating from the second vector administration was significantly diminished and reflected the nAB titer present at the day of readministration. The present study extends earlier observations that preexisting nAB affects AAV1 re-administration. The level of nAB is proportional to the virus dose used for the first injection and transgene expression following re-administration is dependent on preexisting nAB titer. Gene Therapy (2008) 15, 54–60; doi:10.1038/sj.gt.3303037; published online 25 October 2007

Keywords: adeno-associated virus; AAV serotype 1; AAV neutralizing antibodies; AAV re-administration

Introduction Conventional biologic drug therapy requires repeated administration. One proposed advantage of gene therapy is reducing the number of administrations necessary to maintain therapeutically relevant drug levels. Among gene delivery systems recombinant adeno-associated virus (rAAV) is one of the most promising candidates. Although rAAV vectors have a good safety profile compared to other viral vectors, transgene expression may be compromised by preexisting immunity to AAV from naturally acquired infections.1 To date, 11 AAV serotypes have been isolated and evaluated in various model systems and more have been identified.2–5 Most studies were carried out with rAAV2 including several clinical trials where virus was delivered to various organs.6–8 In contrast to the long-term expression observed in animal models the duration of expression in clinical trials was disappointingly short,6 although sustained expression has been reported very recently.9,10 Correspondence: Dr RN Harkins, Target Discovery Biologicals, Bayer HealthCare Pharmaceuticals, 2600 Hilltop Drive, Richmond, CA 94806, USA. E-mail: [email protected] 3 Current address: Research and Development, Amsterdam Molecular Therapeutics BV, Amsterdam 1100 DA, The Netherlands. Received 19 April 2007; revised 8 September 2007; accepted 11 September 2007; published online 25 October 2007

There are strong indications that the immune system impacts AAV-mediated gene delivery and expression more than initially assumed. The clinical data suggest that for long-term treatment of chronic diseases, vector re-administration will be required. For re-administration of AAV any host immune response to the virus in regard to antigen-specific immunity as well as any preexisting immunity to the virus due to naturally acquired infections with the wild-type (wt) virus will be of substantial importance. Following administration of rAAV vectors to humans it is likely that AAV capsids will be recognized by neutralizing antibodies (nABs), since most humans have been infected with one of the AAV serotype, most likely with AAV2.11–13 The impact of nABs on AAV-mediated gene delivery and transgene expression is not clear so far. In clinical studies, in which rAAV was administered to skeletal muscle14 or lung15 the presence of neutralizing antibodies did not significantly block transduction. This observation was not unexpected since natural AAV infection does not necessarily prevent reinfection in the presence of an existing humoral immunity.1 Re-administration experiments in various animal species targeting different organs indicate however that an immune response, especially nABs, generated after the first administration may prevent further application.16–25 However, other studies revealed that the presence of nAB directed against AAV evidently does not reduce

Effect of viral dose on neutralizing antibody response H Petry et al

transgene expression, and that the success of AAV re-administration is dependent on the route of delivery and the AAV serotype used.26–30 In the present study, we investigated if rAAV131 can be repeatedly used for transgene delivery to skeletal muscle. Muscle tissue is an attractive site for gene delivery since it is easily accessible and can express and secrete therapeutically relevant levels of protein, at least in small animal models. We used different doses of AAV1-expressing luciferase (AAV1-luc) or human interferon-b (AAV1-hIFNb) for the first administration. The virus was injected into skeletal muscle (intramuscularly (i.m.)) of immune competent C57Bl/6 mice. Re-administration was performed 6 months following the first administration; to avoid the peak levels of AAV1directed nAB. Transgene expression was measured following the first and second administration to explore if the primary or secondary immune response affects transgene expression and furthermore, if this is dose dependent.

Results Luciferase and hIFNb expression Four groups of C57Bl/6 mice (n ¼ 5 each) were infected intramuscularly (i.m.) with four different doses of AAV1luc: 5 1010 (group 1), 1 1010 (group 2), 5 109 (group 3) or 1 109 (group 4) vp per animal. An additional group of five mice (group 5) was infected with AAV1hIFNb (1 1010 vp) (Table 1). All five groups were given a second administration of 5 1010 vp of AAV1-hIFNb into the same muscles 6 months after the first virus administration. An additional five age-matched control naive mice (group 6) were also injected with 5 1010 vp of AAV1-hIFNb at the time of the repeat administration. A negative control group of uninjected mice (group 7) was also included. Luciferase activity in the skeletal muscle of mice from groups 1–4 and serum levels of hIFNb in group 5 were monitored on a regular basis following the first and second virus administration. All mice that received AAV1-luc showed increasing luciferase activity in muscle tissue over the first 2–4 weeks, independent of the virus dose used for infection (Figure 1a). After this initial period, luciferase activity levels became almost stable over the next 5 months until re-administration. Luciferase activity was dose dependent with lowest levels in mice that received 1 109 vp and highest levels

Table 1 Groups of mice investigated Groups First AAV1 administration 1 2 3 4 5 6 7

AAV1-luc AAV1-luc AAV1-luc AAV1-luc AAV1-hIFNb — —

5 1010 vp 1 1010 vp 5 109 vp 1 109 vp 1 1010 vp — —

Second AAV1 administration AAV1-hIFNb AAV1-hIFNb AAV1-hIFNb AAV1-hIFNb AAV1-hIFNb AAV1-hIFNb —

5 1010 5 1010 5 1010 5 1010 5 1010 5 1010 —

vp vp vp vp vp vp

Abbreviations: AAV, adeno-associated virus; ELISA, enzyme-linked immunosorbent assay; hIFNb, human interferon b; vp, virus particles.

in those mice that were injected with 5 1010 vp. Similar to the kinetics of luciferase expression, hIFNb levels increased within the first month following the administration of AAV1-hIFNb and remained stable until re-administration 5 months later (Figure 2). Following re-administration using 5 1010 vp AAV1hIFNb, luciferase activity and serum levels of hIFNb were measured at week 2 and then on a monthly basis for 3 months, when the study was terminated. In groups 1–4, in which mice were first injected with AAV1-luc, luciferase activity was not significantly different compared to those levels measured before re-administration (Figure 1b). Human hIFNb could be detected in mice of groups 3 and 4 that received the lowest doses of AAV-1luc in the first administration but not in those from groups 1 and 2 that received the two highest doses of AAV-1-luc in the first administration (Figure 3). However, serum concentrations of hIFNb in mice of groups 3 and 4 were significantly reduced compared to those levels detected in age-matched naive mice infected with the same dose of AAV1-hIFNb (group 6). The protein results were confirmed by the hIFNb RNA levels that were determined in the injected muscle tissue when the mice were killed 3 months following re-administration. The highest hIFNb RNA expression was detected in ¨ınaive mice infected with AAV1-hIFNb, followed by groups 3 and 4 and low expression was found in groups 1 and 2, but still above background (Figure 4). In mice that first received 1 1010 vp AAV1-hIFNb and 6 months later 5 1010 vp of the same virus (group 5), hIFNb levels following re-administration were approximately the same level as before re-administration (Figure 3). The hIFNb RNA levels in these mice were fourfold lower (Po0.01) than in the mice that received a single administration of AAV1-hIFNb (group 6) (Figure 4). In conclusion, the results showed that the re-administration did not affect transgene expression originating from the first AAV1 injection, but that there was diminished transgene expression following re-administration dependent on the dose used for the first AAV1 administration.

55

NABs directed against AAV1 Mice were monitored for serum nABs directed against AAV1 following the first and the second AAV1 administration. Following the first injection using AAV1-luc or AAV1-hIFNb, anti-AAV1 nABs developed in all mice with peak levels observed between weeks 4 and 8 (Figure 5). The development of nABs was dose dependent with the highest levels in mice that received the highest AAV1 dose (5 1010 vp) and the lowest levels in those mice that received the lowest virus dose (1 109 vp). No significant difference was observed in the level of nABs between mice that were injected with 1 1010 vp AAV1-hIFNb and those that received the same dose of AAV1-luc. NAB titers declined over time with the largest decline occurring in the mice that received the lowest two doses of virus. In contrast, the nAB titers in the mice that received the highest two doses of virus declined only slightly such that at the time of repeat administration the nAB titer in these mice were significantly higher than in the two groups that received the lowest doses of virus (5 109 and 1 109 vp). Following re-administration nABs increased 10- to 100-fold in all groups examined. In conclusion, nAB titers showed an inverse relation to hIFNb serum levels following re-administration. Gene Therapy


56 weeks after 1st administration 2

4

8

12

20

16

24

luciferase activity (units)

1.00E+09

1.00E+08

1.00E+07

1.00E+06 Group 1 (5E+10 vp)

Group 2 (1E+10 vp)

Group 3 (5E+09 vp)

Group 4 (1E+09 vp)

Groups weeks after 1st / 2nd administration

luciferase activity (units)

24/0

25/1

26/2

28/4

32/8

1.00E+08

1.00E+07

Group 1 (5E+10 vp)

Group 2 (1E+10 vp)

Group 3 (5E+09 vp)

Group 4 (1E+09 vp)

Groups Figure 1 Luciferase activity following the administration of AAV1-luc. Four groups of C57Bl/6 mice (n ¼ 5 each) were infected i.m. with four different doses of AAV1-luc: 5 1010, 1 1010, 5 109 or 1 109 vp per animal. Luciferase activity in muscle tissue was monitored over a period of 24 weeks following the first virus administration (a) and for additional 8 weeks after the second administration using AAV1-hIFNb (b). Luciferase activity was determined using an in vivo imaging system. AAV, adeno-associated virus; hIFNb, human interferon b; i.m., intramuscularly; vp, virus particles.

Discussion Injection of AAV-gene delivery vectors into skeletal muscle results in long-term gene expression in a variety of animal models including mice, dogs and non-human primates. However, quantitative analysis in those models showed a modest decline in transgene expression over a period of 1 year or longer, indicating that vector readministration may be necessary at intervals of several years. Mechanisms responsible for the steady decline have yet to be determined, although a number of hypotheses have been entertained including promoter shut off, degradation of the vector genome, turnover of the transduced muscle fiber and vector- or transgenetargeted immune events. In the present study, we evaluated if the level of nAB directed against AAV1 affect transgene expression after Gene Therapy

i.m. vector re-administration. AAV1 was selected for the experiments since several studies have shown that this serotype is of particular interest for gene delivery into muscle tissue.31–34 Recently, it was reported that humans harbor a marginal preexisting immunity to AAV131 indicating that nAB can interfere with transduction efficiency. AAV1 was however successfully used for gene delivery into human muscle.14 This brought up the question if the titer of nAB is critical for successful first or repeated administration in muscle tissue. We designed an experiment in C57Bl/6 mice to study if the success of rAAV1 administration is dependent on the nAB titer. To achieve different levels of nABs, mice were injected with different doses of rAAV1-luc or with AAV1-IFNb, assuming that the amount of AAV antigen is determining the strength of the immune response, as it has been reported recently.24 All mice developed nAB, with the


57 AAV1 readministration

Luc RNA

hIFNβ β RNA

700 1.00E+07 copies mRNA/ug

hIFN (pg/ml)

600 500 400 300 200

1.00E+06 1.00E+05 1.00E+04 1.00E+03

100

0

10 20 30 40 Weeks after 1st administration

50

Figure 2 Levels of hIFNb in sera of mice that were injected with AAV1-IFNb, 1 1010 vp for the first administration and 5 1010 vp for re-administration. C57Bl/6 mice (n ¼ 5 each) were infected i.m. with 1 1010 vp per animal of AAV1-hIFNb. Human IFNb in serum was determined over a period of 24 weeks after the first virus administration and for additional 8 weeks following the second administration of AAV1-hIFNb. Serum levels of hIFNb were measured using a commercially available ELISA (R&D). AAV, adeno-associated virus; ELISA, enzyme-linked immunosorbent assay; hIFNb, human interferon b; i.m., intramuscularly; vp, virus particles.

1

2

3

4 Groups

5

0 6

00 7

Figure 4 Copy numbers of luciferase and hIFNb mRNA in the injected muscles 3 months after re-administration. Copy numbers of luciferase and hIFNb mRNA in the injected muscles were measured by TaqMan real-time RT-PCR of total RNA extracted from the entire injected muscles of each mouse (n ¼ 5 per group). The number on the x-axis indicates the group number. Data are expressed as mean copies per microgram of total muscle RNA and the error bars represent s.d. AAV, adeno-associated virus; ELISA, enzyme-linked immunosorbent assay; hIFNb, human interferon b; i.m., intramuscularly; vp, virus particles; RT, reverse transcriptase.

weeks after administration 1

2

8

12

hIFN (pg/ml)

2000

1500

1000

500

0 1

2

3

4

5

6

7

Groups Figure 3 Levels of hIFNb in sera of mice following virus readministration. Human IFNb was determined in sera from mice that received first the AAV1-luc (Group 1: 5 1010, Group 2: 1 1010, Group 3: 5 109, or Group 4: 1 109 vp per animal) and were infected after 6 months with 1 1010 vp per animal AAV1-hIFNb, or from mice that received first 1 1010 vp per animal of AAV1-hIFNb and were re-administered with 5 1010 vp per animal of the same virus (Group 5), or from mice (age-matched) that were with infected with the 5 1010 vp per animal of AAV1-hIFNb only (Group 6). Human IFNb was monitored over a period of 119 days (17 weeks). As negative controls we used sera from naive mice (Group 7). Serum levels of hIFNb were measured using a commercially available ELISA (R&D). AAV, adeno-associated virus; ELISA, enzyme-linked immunosorbent assay; hIFNb, human interferon b; vp, virus particles.

highest titers in mice that received the highest rAAV1 dose and the lowest in those injected with the lowest virus dose. Peak levels were measured between 1 and

2 months following administration but did not affect the transgene expression. Most re-administration studies reported so far performed the second administration in a 1- to 2-month time frame after the first administration. For the so-called immune privileged brain, it was shown that the success of re-administration is dependent on the time span between the first and second administration of rAAV.35 In other studies that used immune non-privileged tissues, like skeletal muscle, and where the same serotype of AAV was re-administered within 3 months following the first virus injection, transgene expression was abolished or heavily diminished.17–19,35 On the basis of our observation that nAB titers declined slowly over time we decided to wait 6 months before readministration. At the day of the second administration, nABs were detectable in all mice irrespective of the dose that was used for the first administration and transgene levels remained stable. The second administration was carried out with a high dose of 5 1010 vp of rAAV1-IFNb. In mice that were injected twice with AAV1-IFNb blood levels of IFNb did not significantly change, indicating that the second administration was not successful. There is a chance that antibodies directed against IFNb had played a role in the inhibition since the same rAAV1IFNb was used for the first and second administration, but in this case we should have observed an inhibition effect on the IFNb blood levels over time following the first administration, but this was not the case. Re-administration was also not successful in mice that received the higher doses of 1 1010 vp or 5 1010 vp of rAAV1-luc. In contrast, re-administration was successful in those mice that received the lower doses, either 1 109 vp or 2 109 vp, of rAAV1-luc. The IFNb blood levels measured in those mice were however reduced compared to control mice of the same age injected with the same dose of rAAV1-IFNb only. Gene Therapy


58

AAV1-luc Grp1 (5x10e10 vp)

Grp2 (1x10e10 vp)

AAV1-hIFN

Grp3

Grp4

Grp5

(5x10e09 vp)

(5x10e09 vp)

(5x10e09 vp)

AAV1 readministration

nAB titre

1.00E+04

1.00E+03

1.00E+02

2

4

8

12

16

20

24

26

29

33

Weeks after 1st administration Figure 5 NABs against AAV1 following first and second virus administration. Neutralizing antibodies directed against AAV1 were determined in sera from mice (n ¼ 5 per group) that received first the AAV1-luc (5 1010, 1 1010, 5 109 or 1 109 vp per animal) and were infected after 6 months (week 24) with 1 1010 vp per animal AAV1-hIFNb, or from mice that received first 1 1010 vp per animal of AAV1hIFNb and were re-administered with 5 1010 vp per animal of the same virus. The titer is expressed as the serum dilution that inhibits 50% of the AAV1-luc activity. AAV, adeno-associated virus; ELISA, enzyme-linked immunosorbent assay; hIFNb, human interferon b; i.m., intramuscularly; nABs, neutralizing antibodies; vp, virus particles; RT, reverse transcriptase.

The data for hIFNb protein expression obtained after re-administration showed that the inhibitor effect was correlated with the nAB titer. Not surprisingly, a very similar pattern was found for hIFNb RNA expression in the muscle. Compared to the mice that received a single injection of 5 1010 vp of AAV1-hIFNb the level of hIFNb RNA was reduced to 0.02, 0.4, 13 and 21% in the mice that had received increasing doses of AA1-luc in the first administration. The low but detectable levels of hIFNb RNA in muscle tissue from mice that received the two high doses of AAV1-luc showed that re-administration of rAAV1-IFNb was not completely inhibited. Several reports demonstrate that successful re-administration is more likely in so-called immune-privileged organs, such as the brain, compared to other tissues like muscle. Clinical data showed that rAAV transduction is possible despite the presence of nAB. We have shown that transduction of muscle tissue in a preclinical mouse model is feasible using rAAV1 and the results indicate that the efficiency is dependent on the titer of nAB. The data further suggest that the time span between the first and second rAAV1 administration is critical for the nAB titer and for the success of re-administration.

Materials and methods Construction of AAV shuttle plasmids and AAV preparation AAV-human IFNb shuttle plasmid was created by ligation of an SpeI/AscI fragment of pGT3028 containing the human IFNb gene and NheI/MluI digested AAV Gene Therapy

CMV eGFP plasmid29 to create a shuttle vector in which the human IFNb gene is expressed from the CMV promoter. AAV-luciferase shuttle plasmid was similarly generated by inserting an Nhe1/Xba1 fragment of pGL3Basic (Promega, Madison, WI, USA) containing the Firefly luciferase gene into the AAV CMV eGFP plasmid. Viral production from this plasmid with AAV-1 capsid proteins was as described previously.36,37

C57Bl/6 mice Adult male C57Bl/6 mice (Jackson Laboratory, Bar Harbor, ME, USA) were used for the experiments. All mice were housed under controlled temperature (24 1C) and lighting (14:10 hour light–dark cycle) conditions with free access to food and water. The experiments were conducted according to the protocols approved by the Animal Care Committee at Berlex Biosciences, in agreement with the recommendation of the American Association for the Accreditation of Laboratory Animal Care. During the in vivo gene transfer, all of the animals were anesthetized by 1.5% isoflurane inhalation. Human IFNb enzyme-linked immunosorbent assay Serum samples were analyzed for human IFNb (hIFNb) using a commercial enzyme-linked immunosorbent assay kit from R&D (Minneapolis, MN, USA). Neutralization assay Serial dilutions of serum were mixed with 1 107 vp of AAV1-luc and incubated at 37 1C for 1 h then the mixture was added to HeLa cells (2 104 cells per well) in a


96-well plate. The medium was changed 4 h later then cells were harvested at 72 h and assayed for luciferase activity (Luciferase kit, Promega).

TaqMan analysis After the mice were killed, the AAV-injected muscles from each mouse were pooled, cut into pieces not larger than 3 mm3 then placed in RNAlater buffer (Qiagen, Valencia, CA, USA) to preserve the nucleic acid. The entire muscle tissue was homogenized in RLT buffer containing 0.17 M b-mercaptoethanol (10 ml per mg of tissue) using a mixer mill (Qiagen). After centrifugation to remove debris, an aliquot of the lysate was diluted with two volumes of water and incubated at 55 1C for 10 min in the presence of proteinase K. Precipitated protein was removed by centrifugation and total RNA was purified from the resulting supernatant using RNeasy mini columns (Qiagen) including on column DNaseI digestion to remove residual DNA contamination. RNA was recovered in water and concentrations were determined by measuring the absorbance at 260 nm. The 260:280 ratios were all 1.9 or greater and the integrity of the RNA was routinely checked by agarose gel electrophoresis. The copy number of luciferase or hIFNb mRNA levels in the muscle RNA samples was determined by one step real-time reverse transcriptase PCR (RT-PCR) utilizing TaqMan chemistry (Applied Biosystems, Foster City, CA, USA). Each sample was assayed in duplicate in a reaction containing 1 PCR master mix (Applied Biosystems), forward and reverse primers (500 nM each for luciferase and 300 nM each for hIFNb), FAM labeled probe (250 nM for luciferase and 50 nM for hIFNb) and 1 RT and RNasin mix (Applied Biosystems). The sequences of primers and probe were as follows: LucF, CGCAGGTCTTCCCGACG; LucR, TTCCGTGCTCCAAAACAACA; Luc probe, CCGGT GAACTTCCCGCCGC; hIFN-F, GACATCCCTGAGG AGATTAAGCA; hIFN-R, GGAGCATCTCATAGATGG TCAATG and hIFN-probe, CGTCCTCCTTCTGGAA CTGCTGCAG. Assays were run in an ABI7300 real-time instrument (Applied Biosystems) with the following reaction conditions; 48 1C for 30 min, 95 1C for 10 min, 40 cycles of 95 1C for 15 s and 60 1C for 1 min. Each plate contained RNA copy number standards consisting of serial dilutions of synthetic RNA containing the target sequence of the assay. This synthetic RNA standard was prepared by in vitro transcription of linearized plasmids containing the target sequence. Luciferase in vivo imaging In vivo luciferase expression was noninvasively evaluated by a bioluminescence imaging system. It consisted of a camera (model LN/CCD-1300EB) equipped with a 50-mm Nikon lens (Roper Scientific, Princeton Instruments, Trenton, NJ, USA), a light–tight specimen chamber, a camera controller (ST-133) and a computer system for the data analysis. This system detects bioluminescent photons that are emitted from tissues of living animals expressing the luciferase gene and allows continuous, noninvasive monitoring of gene expression. Mice were anesthetized for the measurements and light emission was monitored by placing the animals in a dark box. Two minutes before the detection, animals were injected with beetle luciferin (Promega), 125 mg per kg body weight, into the peritoneal cavity. Light

measurements were taken under the same conditions including time (2 min) and distance of lenses from the mice.

59

References 1 Blackow NR, Hoggan MD, Rowe WP. Serologic evidence for human infection with adeno-associated viruses. J Natl Cancer Inst 1968; 40: 319–327. 2 Gao GP, Vandenberghe LH, Alvira MR, Lu Y, Calcedo R, Zhou X et al. Clades of adeno-associated viruses are widely disseminated in human tissues. J Virol 2004; 78: 6381–6388. 3 Grimm D, Kay MA. From virus evolution to vector revolution: use of naturally occurring serotypes of adeno-associated virus (AAV) as novel vectors for human gene therapy. Curr Gene Ther 2003; 3: 281–304. 4 Gao GP, Alvira MR, Wang L, Calcedo R, Johnston J, Wilson JM. Adeno-associated virus serotype 9 vectors transduce murine alveolar and nasal epithelia and can be readministered. Proc Natl Acad Sci USA 2002; 99: 11854–11859. 5 Gao GP, Vandenberghe LH, Wilson JM. New recombinant serotypes of AAV vectors. Curr Gene Ther 2005; 5: 285–297. 6 Warrington Jr HH, Herzog RW. Treatment of human disease by adeno-associated viral gene transfer. Hum Genet 2006; 199: 571–603. 7 Manno CS, Pierce GF, Arruda VR, Glader B, Ragni M, Rasko JJE et al. Successful transduction of liver in hemophilia by AAVfactor IX and limitations imposed by the host immune system. Nat Med 2006; 12: 342–347. 8 McPhee SWJ, Janson CG, Li C, Samulski RJ, Camp AS, Francis JD et al. Immune responses to AAV in a phase I study for Canavan disease. J Gene Med 2006; 8: 577–588. 9 Jian H, Pierce GF, Ozelo MC, DePaula EV, Vargas JA, Smith P et al. Evidence of multilayer factor IX expression by AAVmediated gene transfer to skeletal muscle in an individual with severe hemophilia B. Mol Ther 2006; 14: 452–455. 10 Manno CS, Chew AJ, Hutchison S, Larson PJ, Herzog RW, Arruda VR et al. AAV-mediated factor IX gene transfer to skeletal muscle in patients with severe hemophilia B. Gene Therapy 2003; 101: 2963–2972. 11 Erles K, Sebokova P, Schlehofer JR. Update on the prevalence of serum antibodies (IgG and IgM) to adeno-associated virus (AAV). J Med Virol 1999; 59: 406–411. 12 Moskalenko M, Chen L, van Roey M, Donahue BA, Snyder RO, McArthur JG et al. Epitope mapping of human anti-adenoassociated virus type 2 neutralizing antibodies: implications for gene therapy and virus structure. J Virol 2000; 74: 1761–1766. 13 Chirmule N, Propert K, Magosim S, Qian Y, Qian R, Wilson J. Immune responses to adenovirus and adeno-associated virus in humans. Gene Therapy 1999; 6: 1574–1583. 14 Manno CS, Chew AJ, Hutchison S, Larson PJ, Herzog RW, Arruda VR et al. AAV-mediated factor IX gene transfer to skeletal muscle in patients with severe hemophilia B. Blood 2003; 101: 2963–2972. 15 Moss RB, Rodman D, Spencer LT. Repeated adeno-associated virus serotype 2 aerosol-mediated cystis fibrosis transmembrane regulator gene transfer to the lungs of patients with cystic fibrosis: a multicenter, double-blind, placebo-controlled trial. Chest 2004; 125: 509–521. 16 Halbert CL, Standaert TA, Aitken ML, Alexander IE, Russell DW, Miller AD. Transduction by adeno-associated virus vectors in the rabbit airway: efficiency, persistence, and readministration. J Virol 1997; 71: 5932–5941. 17 Chirmule N, Xiao W, Truneh A, Schnell MA, Hughes JV, Zoltick P et al. Humoral immunity to adeno-associated virus type 2 vectors following administration to murine and nonhuman primate muscle. J Virol 2000; 74: 2420–2425. Gene Therapy


60 18 Xiao W, Chirmurle N, Schnell MA, Tazelaar J, Hughes JV, Wilson JM. Route of administration determines induction of T-cellindependent humoral responses to adeno-associated virus vectors. Mol Ther 2000; 1: 323–329. 19 Hildinger M, Auricchio A, Gao G, Wang L, Chirmule N, Wilson JM. Hybrid vectors based on adeno-associated virus serotypes 2 and 5 for muscle-directed gene transfer. J Virol 2001; 75: 6199–6203. 20 Ge Y, Powell S, vanRoey M, McArthur JG. Factors influencing the development of an anti-factor IX (FIX) immune response following administration of adeno-associated virus-FIX. Blood 2001; 97: 3733–3737. 21 Peden CS, Burger C, Muzyzka N, Mandel RJ. Circulating antiwild-type adeno-associated virus type-2 (AAV2) antibodies inhibit recombinant AAV2 (rAAV2)-mediated but not rAAV5mediated gene transfer in the brain. J Virol 2004; 78: 6344–6359. 22 Zhang YC, Powers M, Wasserfall C, Brusko T, Song S, Flotte T et al. Immunity to adeno-associated virus serotype 2 delivered transgenes imparted by genetic predisposition to autoimmunity. Gene Therapy 2004; 11: 233–240. 23 Kok MR, Voutetakis A, Yamano S, Wang J, Cotrim A, Katano H et al. Immune responses following salivary gland administration of recombinant adeno-associated serotype 2 vectors. J Gene Med 2005; 7: 432–441. 24 Riviere C, Danos O, Douar AM. Long term expression and repeated administration of AAV type 1, 2 and 5 vectors in skeletal muscle of immunocompetent adult mice. Gene Therapy 2006; 13: 1300–1308. 25 Scallan CD, Jiang H, Liu T, Patarroyo-White S, Sommer JM, Zhou S et al. Human immunoglobulin inhibits liver transduction by AAV vectors at low AAV2 neutralizing toters in SCID mice. Blood 2006; 107: 1810–1817. 26 Lo WD, Qu G, Sferra TJ, Clark R, Chen R, Johnson PR. Adenoassociated virus-mediated gene transfer to the brain: duration and modulation of expression. Hum Gene Ther 1999; 10: 201–213. 27 Jerebtsova M, Batshaw ML, Ye X. Humoral immune response to recombinant adenovirus and adeno-associated virus after in utero administration of viral vectors in mice. Pediatr Res 2002; 52: 95–104.

Gene Therapy

28 Limberis MP, Wilson JM. Adeno-associated virus serotype 9 vectors transduce murine alveolar nasal epithelia and can be readministered. Proc Natl Acad Sci USA 2006; 103: 12993–12998. 29 Mastakow MY, Baer K, Symes CW, Leichtlein CB, Kotin RM, During MJ. Immunological aspects of recombinant adenoassociated virus delivery to the mammalian brain. J Virol 2002; 76: 8446–8454. 30 Anand V, Chirmule N, Fersh M, Maguire AM, Bennett J. Additional transduction events after subretinal readministration of recombinant adeno-associated virus. Hum Gene Ther 2000; 11: 449–457. 31 Xiao W, Chirmule N, Berta SC, McCullough B, Gao G, Wilson JM. Gene therapy vectors based on adeno-associated virus type 1. J Virol 1999; 70: 8098–8108. 32 Chao H, Liu Y, Rabimowitz J, Li C, Samulski RJ, Welsh CE. Several log increase in therapeutic transgene delivery by distinct adeno-associated viral serotype vectors. Mol Ther 2000; 2: 619–623. 33 Rivera VM, Gao GP, Grant RL, Schnell MA, Zoltick PW, Rozamus LW et al. Long term pharmacologically regulated expression of erythropoietin in primates following AAVmediated gene transfer. Blood 2005; 105: 1424–1430. 34 Kay MA, Manno CS, Ragni MV, Larson PJ, Couto LB, McClelland A et al. Evidence for gene transfer and expression of factor IX in haemophilia B patients treated with an AAV vector. Nat Genet 2000; 24: 257–261. 35 Brockstedt DG, Podsakoff GM, Fong L, Kurtzman G, MuellerRucholtz W, Engleman EG. Induction of immunity to antigens expressed by recombinant adeno-associated virus depends on the route of administration. Clin Immunol 1999; 92: 67–75. 36 Szymanski P, Kretschmer PJ, Bauzon MM, Jin F, Qian HS, Rubanyi GM et al. Development and validation of a robust and versatile one-plasmid regulated gene expression system. Mol Ther 2007; 15: 1340–1347. 37 Auricchio A, Hildinger M, O’Connor E, Gao GP, Wilson JM. Isolation of highly infectious and pure adeno-associated virus type 2 vectors with a single-step gravity-flow column. Hum Gene Ther 2001; 12: 71–76.