Environ Sci Pollut Res DOI 10.1007/s11356-014-3730-x
RESEARCH ARTICLE
Effects of intermediate metabolite carboxylic acids of TCA cycle on Microcystis with overproduction of phycocyanin Shijie Bai & Jingcheng Dai & Ming Xia & Jing Ruan & Hehong Wei & Dianzhen Yu & Ronghui Li & Hongmei Jing & Chunyuan Tian & Lirong Song & Dongru Qiu
Received: 23 June 2014 / Accepted: 14 October 2014 # Springer-Verlag Berlin Heidelberg 2014
Abstract Toxic Microcystis species are the main bloomforming cyanobacteria in freshwaters. It is imperative to develop efficient techniques to control these notorious harmful algal blooms (HABs). Here, we present a simple, efficient, and environmentally safe algicidal way to control Microcystis blooms, by using intermediate carboxylic acids from the tricarboxylic acid (TCA) cycle. The citric acid, alphaketoglutaric acid, succinic acid, fumaric acid, and malic acid all exhibited strong algicidal effects, and particularly succinic acid could cause the rapid lysis of Microcystis in a few hours. It is revealed that the Microcystis-lysing activity of succinic acid and other carboxylic acids was due to their strong acidic activity. Interestingly, the acid-lysed Microcystis cells released large amounts of phycocyanin, about 27-fold higher than those of the control. On the other hand, the transcription of mcyA and mcyD of the microcystin biosynthesis operon was not upregulated by addition of alpha-ketoglutaric acid and other carboxylic acids. Consider the environmental safety of intermediate carboxylic acids. We propose that administration of TCA cycle organic acids may not only provide an algicidal method with high efficiency and environmental safety but also
Responsible editor: Robert Duran S. Bai : J. Dai : M. Xia : J. Ruan : H. Wei : D. Yu : R. Li : L. Song : D. Qiu (*) Institute of Hydrobiology, The Chinese Academy of Sciences and University of Chinese Academy of Sciences, Wuhan 430072, China e-mail:
[email protected] J. Dai : C. Tian School of Life Sciences and Technology, Hubei University of Engineering, 272 Jiaotong Avenue, Xiaogan 432000, China S. Bai : H. Jing Sanya Institute of Deep-sea Science and Engineering, The Chinese Academy of Sciences and University of Chinese Academy of Sciences, Sanya 572000, China
serve as an applicable way to produce and extract phycocyanin from cyanobacterial biomass. Keywords Microcystis blooms . Carboxylic acids . Phycocyanin . High efficiency . Environmental safety
Introduction Harmful algal blooms (HABs) have increasingly become a global environmental and public health problem over the past several decades (Glibert et al. 2005). In the freshwater lakes, rivers, and reservoirs, cyanobacterial (blue-green algal) blooms have frequently occurred on the increasingly large scales and become a severe threat to the accessibility and safety of drinking water (Cheung et al. 2013). Some of the bloom-forming cyanobacteria, particularly Microcystis, could produce cyanotoxins including microcystins that could damage the liver, intestines, skin, and nervous system of mammals through bioaccumulation (O’Neil et al. 2012) or exposure to the microcystins (Hilborn et al. 2013). In order to efficiently mitigate the harmful effects of HABs, it is imperative to develop new prevention methods and various control strategies, such as administration of chemical algicides (Churro et al. 2010), flocculants (Li and Pan 2013) and biological agents, ultrasonication, as well as other types of physical and chemical manipulation, have been tested in Chinese lakes and coastal areas, and billions of dollars have been invested in the lake rehabilitation programs. Biological agents including bacteria (Bai et al. 2011), viruses (Cheng et al. 2013), protozoans (Carman and Dobbs 1997), and fungi (Kong et al. 2013) may serve as potential algal bloom suppressors. However, these methods either have some potential risks to environmental safety or are not efficient enough to eliminate harmful algae. Therefore, it is urgent to seek the high efficiency and environmentally friendly technology to control HABs.
Environ Sci Pollut Res
In previous researches and our experiments, it has been revealed that harmful algal bloom-forming Microcystis species are susceptible to acids. Lysine and malonic acid (malic acid) were sprayed together in enclosures, Dianch Lake, Kunming, China, and the microcystin concentration decreased to 25 % compared to the initial concentration, and the pH shifted from 9.2 to 7.8; the research found that combined treatment with lysine and malonic acid could control toxic Microcystis water blooms (Kaya et al. 2005). However, they just tested one acid, the malonic. In this study, citric acid, alphaketoglutaric acid, succinic acid, fumaric acid, and malic acid, the intermediate metabolites of tricarboxylic acid (TCA) cycle, were tested for their Microcystis-inhibiting activities. Our results showed that administration of these intermediate metabolites of TCA cycle could suppress Microcystis efficiently via decreasing the pH values, resulting in a rapid cell lysis, and the succinic acid exhibited the best algicidal activity. More interestingly, we also detected the overproduction and release of phycocyanin during the process of algal lysis. These results provided important implications in utilization of those tricarboxylic and dicarboxylic acids to control Microcystis blooms, which could be used as the environmentally friendly emergency countermeasures to protect drinking water sources. On the other hand, these methods might be used to treat cyanobacterial biomass for overproduction and extraction of phycocyanin.
Materials and methods Cyanobacterial cultures Cyanobacterial strains including Microcystis sp. 1023 were provided by the Freshwater Algae Culture Collection (FACC), Institute of Hydrobiology of the Chinese Academy of Sciences. They were cultured in BG11 liquid medium (NaNO3 1.5 g/L, K2HPO4 0.04 g/L, MgSO4·7H2O 0.075 g/L, CaCl2·2H2O 0.036 g/L, citric acid 0.006 g/L, ferric ammonium citrate 0.006 g/L, EDTANa2 0.001 g/L, Na2CO3 0.02 g/L, and trace metal mix A5 1 ml/L and the composition of A5 solution includes H 3 BO 3 2.86 g/L, MnCl 2 ·4H 2 O 1.86 g/L, ZnSO 4 ·7H 2 O 0.22 g/L, Na 2 MoO 4 ·2H 2 O 0.39 g/L, CuSO4·5H2O 0.08 g/L, and Co(NO3)2·6H2O 0.05 g/L) (Stanier et al. 1971). The cultures were subjected to a 12-h light/12-h dark cycle with a photosynthetically active radiation (PAR) intensity of 30 μmol photons s−1 m−2 provided by cool white fluorescent lamps at 25±1 °C. The cultured cyanobacteria were harvested during the exponential growth phase. Algicidal effects on Microcystis The algicidal assays of carboxylic acids against Microcystis were conducted as follows. To make the stock solutions, equal
molar quantity of each acid, i.e., 0.146 g of alpha-ketoglutaric acid, 0.118 g of succinic acid, 0.116 g of fumaric acid, 0.134 g of malic acid, and 0.210 g of citric acid monohydrate, was added to 10 ml of BG11 sterile liquid medium, respectively, and 30 μl of acetic acid was added to 9.970 ml of medium. Then, 99 ml exponentially growing algal cultures of Microcystis sp. 1023 were cultured in 250-ml flasks. One milliliter of each carboxylic acid stock solution was added to the cultures to make the final concentration to be 1 mmol/L (mM). In addition, 1 ml sterile BG11 sterile liquid medium was added to the cultures as a control. Experiments were carried out in triplicate. The growth of Microcystis sp. 1023 was monitored by measuring the optical density at the wavelength of 680 nm (nm) (Jiménez et al. 2003). The sample was taken by pipette at different time point. Each carboxylic acid was added to the Microcystis cultures, and after the algicidal assays, the pH values were measured by the pH/mV meter (Denver Instrument, USA). Extraction of proteins from Microcystis cultures The blue pigments released during the cell lysis of Microcystis by the treatments of alpha-ketoglutaric acid, succinic acid, and malic acid were extracted from the supernatants of algal culture after ultrasonic treatment. One hundred milliliters of culture supernatant was prepared by centrifugation at 12,000 rpm for 40 min, and then, the supernatant was concentrated by Amicon Ultra-15 Centrifugal Filter Units until (Membrane NMWL, 3 kDa; protein retentate recovery, 97.5 %; EMD Millipore Corporation, Billerica, MA, USA) the final volume was 500 μl. The control algal cultures were subjected to ultrasonic treatment to lyse the algal cells, and the released proteins were extracted and collected by the same method described above and taken as control. The concentration of total protein was measured by BCA protein assay kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). Tricine-SDS-PAGE electrophoresis and spectral analyses of protein samples Twenty micrograms of total protein from succinic acid and control treatments, respectively, was loaded to the tricinesodium dodecyl sulfate-polyacrylamide gel electrophoresis (Tricine-SDS-PAGE) gel. The tricine-SDS-PAGE was carried out using 3 ml of 16.5 % T, 6 % C separating gel; 0.7 ml of 10 % T, 3 % C spacer gel; and 1.25 ml of 4 % T, 3 % C stacking gel. Gels were run at room temperature and visualized by staining with Coomassie brilliant blue R250. The molecular weights of subunits were determined by calibrating the gel with low molecular weight markers (Fermentas). The absorption spectral analysis of proteins was conducted on a UV-1800 PC spectrophotometer (Mapada, Shanghai). From wavelengths of 400 to 750 nm, the light absorption
Environ Sci Pollut Res
was recorded every 5 nm, and the absorption readings were then plotted against the wavelengths for absorption profiling and the maximum absorbance peak. The relative amounts of specific proteins were estimated by comparing the absorbance of samples at the characteristic wavelength (Patel et al. 2005). RNA extraction and RT-PCR analysis of microcystin biosynthesis gene transcription Total RNA was extracted by using RNAiso Plus (Takara) or RNA prep pure cell/bacteria kit (Tiangen Biotech (Beijing) Co., Ltd), and RNA was further purified using DNase I treatment. The integrity of RNA was evaluated by agarose (0.8 %) gel electrophoresis. The RNA concentration and purity were measured on a spectrophotometer (Nanodrop Technologies, Wilmington, DE, USA). To prepare cDNA, 2 μg of total RNA was reversely transcribed using PrimeScript® RT reagent kit with gDNA Eraser (Takara) and TIANscript RT kit (Tiangen Biotech (Beijing) Co., Ltd) according to the manufacturer’s protocol. The PCR thermal cycles were as follows: 5 min at 95 °C for cDNA denaturation followed by 27–30 cycles of 30 s at 95 °C, 30 s at 55 °C, and 30 s at 72 °C. A final extension step was performed for 10 min at 72 °C. Reverse transcription polymerase chain reaction (RTPCR) products were separated on a 0.8 % agarose gel containing ethidium bromide and visualized by ultraviolet light and BioRad Image software. The data presented are relative mRNA levels normalized against 16S rRNA transcript levels, and the value of the control was set to 1 (Qiu et al. 2013). The primers were designed for reverse transcription analyses of the mcyA (forward primer: AGCAAGCCAAACTTTACCCT GA; reverse: ACAACAAACGATTCCTAATCCC), mcyD (forward: TCTCAAAAACAGCCAGAAAAAT; reverse: ACTAACAGAAGTCCCTGAACCA), and 16S rRNA gene (forward: TCGTGTCGTGAGATGTTGGGTT; reverse: TTGAGGTAATGACTTCGGGCGT) of Microcystis.
acid-supplemented treatments, the cell density of Microcystis began to decrease significantly at the 12th hour, which was most remarkable in the succinic acid-treated cultures. The cyanobacterial cells continued to decrease except for the control and acetic acid-treated groups. Initially, the cell growth of Microcystis sp. 1023 in acetic acid-treated group decreased slightly, probably due to the pH value drop, but the resumed algal cell growth was even faster than that of the control. These results showed that succinic acid exhibited the strongest algicidal effect, followed by the alpha-ketoglutaric acid and malic acid whose algicidal effect was very similar. Other two acids, fumaric acid and citric acid, exhibited even lower but remarkable algicidal effect as compared to acetic acid (Fig. 1). In this study, succinic acid exhibited the best algicidal effects on Microcystis, resulting in cell lysis in a very short time. More interestingly, it seemed that the acetic acid could even stimulate algal growth at the concentration of 1 mM after initial short suppression, and it may be due to the increase of carbon sources.
The change of pH caused by supplement of organic acids The pH of each treatment and control was measured at 84 h after organic acids or sterile BG11 liquid medium was added. Our results showed that the pH of the control and acetic acidtreated groups, between 10.16 and 10.90, was remarkably higher than that of other carboxylic acid treatment groups (Table 1). The citric acid and fumaric acid groups had the lowest pH (pH 4.63–4.68), though these two carboxylic acids did not exhibit the strongest algicidal effect. The succinic acid exhibited the strongest algicidal effect, and the pH of this group was around 5.50, higher than other groups treated by TCA cycle intermediate carboxylic acids. The alpha-
Statistical analysis All data were presented as the mean±standard error (SE) of three replicates. Statistical significance was analyzed by a oneway analysis of variance (ANOVA) and Tukey tests. A significance level of p
